The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
AP017603	Sphingopyxis sp. EG6 DNA, complete genome	3848331	1466349	1537687	3848331	integrase,transposase	Vibrio_phage(14.29%)	60	1466350:1466409	1537379:1538232
BBB08435.1|1466349_1466658_-|transposase	transposase	transposase	NA	NA	NA	NA
1466350:1466409	attL	CTAGGTCGTGTTGACAAAAGATTTCAGCCATAGTCGCATGGCGGCGAGGTTGAGGAAGCT	NA	NA	NA	NA
BBB08436.1|1466699_1467131_-|transposase	transposase	transposase	NA	NA	NA	NA
BBB08437.1|1467932_1468214_+	phage transcriptional regulator AlpA	NA	NA	NA	NA	NA
BBB08438.1|1468328_1469393_+	replication protein A	NA	NA	NA	NA	NA
BBB08439.1|1469389_1470043_+	cobyrinic acid ac-diamide synthase	NA	K7R2R7	Vibrio_phage	40.4	1.5e-31
BBB08440.1|1470039_1470291_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08441.1|1470287_1470809_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08442.1|1470805_1471351_+	conjugal transfer protein	NA	NA	NA	NA	NA
BBB08443.1|1471419_1471755_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08444.1|1471824_1472538_+	lytic transglycosylase catalytic subunit	NA	A0A0K8IY29	Cronobacter_phage	31.3	4.4e-08
BBB08445.1|1472781_1474521_+	type IV secretory pathway VirD2 components	NA	NA	NA	NA	NA
BBB08446.1|1474547_1476539_+	conjugal transfer coupling protein TraG	NA	NA	NA	NA	NA
BBB08447.1|1476543_1476990_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
BBB08448.1|1477160_1478144_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
BBB08449.1|1478140_1478473_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
BBB08450.1|1478472_1478754_+	conjugal transfer protein TrbB	NA	NA	NA	NA	NA
BBB08451.1|1478768_1481216_+	conjugal transfer ATPase TrbE	NA	NA	NA	NA	NA
BBB08452.1|1481221_1482001_+	conjugal transfer protein TrbJ	NA	NA	NA	NA	NA
BBB08453.1|1482011_1482296_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08454.1|1482299_1483658_+	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
BBB08455.1|1483654_1484344_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
BBB08456.1|1484397_1485321_+	conjugal transfer protein TrbG/VirB9/CagX	NA	NA	NA	NA	NA
BBB08457.1|1485317_1486502_+	conjugation TrbI family protein	NA	NA	NA	NA	NA
BBB08458.1|1486503_1486743_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08459.1|1486737_1487517_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
BBB08460.1|1487774_1491071_-	ATPase AAA	NA	NA	NA	NA	NA
BBB08461.1|1491084_1493331_-	hypothetical protein	NA	Q684G2	Sulfolobus_virus	23.8	4.0e-15
BBB08462.1|1493872_1498102_-	ATPase	NA	NA	NA	NA	NA
BBB08463.1|1498098_1498587_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08464.1|1498586_1499567_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08465.1|1499563_1503067_-	helicase domain-containing protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	29.3	6.2e-55
BBB08466.1|1503090_1503975_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08467.1|1504174_1506832_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08468.1|1506831_1510224_+	UvrD/REP helicase	NA	NA	NA	NA	NA
BBB08469.1|1510238_1513580_+	type III restriction protein res subunit	NA	A0A291LA02	Bordetella_phage	24.2	3.5e-07
BBB08470.1|1513644_1514862_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08471.1|1514858_1516664_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08472.1|1516660_1519669_+	helicase domain-containing protein	NA	NA	NA	NA	NA
BBB08473.1|1519988_1520219_+	hypothetical protein	NA	H2DE65	Erwinia_phage	59.7	5.3e-16
BBB08474.1|1520240_1520417_-|transposase	transposase	transposase	NA	NA	NA	NA
BBB08475.1|1520882_1521362_-	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
BBB08476.1|1521393_1522200_-	short-chain dehydrogenase/reductase SDR	NA	NA	NA	NA	NA
BBB08477.1|1522196_1523081_-	glutathione S-transferase domain-containing protein	NA	NA	NA	NA	NA
BBB08478.1|1523111_1523816_-	glutathione S-transferase domain-containing protein	NA	NA	NA	NA	NA
BBB08479.1|1523812_1524829_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08480.1|1525019_1525286_+	regulatory protein TetR	NA	NA	NA	NA	NA
BBB08481.1|1525357_1526233_+	PAS/PAC sensor-containing diguanylate cyclase	NA	NA	NA	NA	NA
BBB08482.1|1527230_1528367_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
BBB08483.1|1528968_1529547_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
BBB08484.1|1529767_1530256_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08485.1|1530306_1530819_-	peptide methionine sulfoxide reductase MsrA	NA	NA	NA	NA	NA
BBB08486.1|1530818_1531265_-	peptide methionine sulfoxide reductase MsrB	NA	NA	NA	NA	NA
BBB08487.1|1531416_1532292_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
BBB08488.1|1532515_1533532_+|transposase	transposase IS1111A/IS1328/IS1533	transposase	NA	NA	NA	NA
BBB08489.1|1533830_1535072_+|integrase	integrase family protein	integrase	A0A248SL35	Klebsiella_phage	67.3	1.5e-160
BBB08490.1|1535068_1535506_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08491.1|1535527_1536187_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08492.1|1536283_1537135_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08493.1|1537131_1537395_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08494.1|1537378_1537687_-|transposase	transposase	transposase	NA	NA	NA	NA
1537379:1538232	attR	CTAGGTCGTGTTGACAAAAGATTTCAGCCATAGTCGCATGGCGGCGAGGTTGAGGAAGCTCTCGAACGAGAGCAGGGTTTTGTCATAGCGTGTTGCAATGCGTCGTTGCTGTTTTAGCTTGCCGAACATGCGCTCGACGCGGTTGCGGTCCTTGTAGCGGCGATAGTCGGGATGCTCTGGCACCTTGCGGTTCGAGCGAGGCGGGATGATCGGCAGGATGCCCCGGACCAGCAGGCTTTCCCGGAAGCGATCACCATCATATCCCTTGTCCGCGAGCAGCGCCTTGGGTGTGGCGACGGGGATCGCCATCAGCGGTTCGGCAGCAGTGTAATCGGAAGCCTCGCCGCCGGTCAGGATGAAGCCGACAGGCAGTCCTTGATTGTCGCAGCGGGCGTGGATTTTGCTCGTAAAGCCGCCGCGTGATCGACCAAGAGCGTTCGCACAAGCCCCCCTTTTCCGCCCGCTGCCGAGACGTGGCCGCGAACGCTGGTGCTGTCGATCATGTGTTGCCAGTCGTCGGTTAGACCCAGATCGACCAGTGTTTGCAGCAGGGCATCCCAGACACCCTGTTCGGCCCAGCGCCGGAAGCGGACATAGACCGAGTTCCACTTGCCGTAGCGCTCGTGCATGTCGCGCCAGGGGCAGCCGACCCGCAGCACGTGAAGCATTCCATTGAGGAACCGCCGGTTATCGCCCGCCGGCCGCGCCCAACGACCGCGCTCAGGCGGCAGCAGCGGCCCAATCAGATCCCACTCCGCTTCCGACAAATCCCCGCGACCCATGACTGCTCCTCAAAAAGCAGTCTTGAATCAGAAGTCGACGCGATTGGGAATCCCTTTTGTCAACACGGCCTA	NA	NA	NA	NA
>prophage 2
AP017603	Sphingopyxis sp. EG6 DNA, complete genome	3848331	1681552	1703014	3848331	transposase,protease,tRNA	Stx2-converting_phage(25.0%)	20	NA	NA
BBB08640.1|1681552_1681972_+|transposase	putative transposase	transposase	NA	NA	NA	NA
BBB08641.1|1681968_1682316_+	IS66 Orf2 family protein	NA	A0A0P0ZDM8	Stx2-converting_phage	59.8	1.9e-33
BBB08642.1|1682369_1683911_+	mobile element protein	NA	A0A0P0ZBS5	Stx2-converting_phage	45.8	5.4e-120
BBB08643.1|1683865_1684519_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08644.1|1684773_1685982_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08645.1|1686016_1688197_-	non-specific protein-tyrosine kinase	NA	NA	NA	NA	NA
BBB08646.1|1688237_1689029_-	polysaccharide export protein	NA	NA	NA	NA	NA
BBB08647.1|1689053_1690235_-	O-antigen polymerase	NA	NA	NA	NA	NA
BBB08648.1|1690648_1690957_-|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	41.0	4.5e-10
BBB08649.1|1690977_1691406_-|transposase	transposase	transposase	NA	NA	NA	NA
BBB08650.1|1691487_1692273_-	metallophosphoesterase	NA	K4JNE2	Caulobacter_virus	32.9	3.2e-20
BBB08651.1|1692520_1693639_+	UDP-N-acetylglucosamine 2-epimerase	NA	A0A1V0SAG5	Catovirus	25.9	9.3e-21
BBB08652.1|1693625_1694921_+	UDP-glucose/GDP-mannose dehydrogenase	NA	M1HEP0	Acanthocystis_turfacea_Chlorella_virus	27.5	5.5e-25
BBB08653.1|1694993_1695776_+	phosphomannose isomerase-like protein	NA	NA	NA	NA	NA
BBB08654.1|1695830_1696397_+|protease	ATP-dependent protease peptidase subunit	protease	NA	NA	NA	NA
BBB08655.1|1696402_1697704_+|protease	ATP-dependent protease ATP-binding subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.6	3.8e-34
BBB08656.1|1698103_1698970_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
BBB08657.1|1699090_1700029_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08658.1|1699994_1700987_+|tRNA	tRNA(Ile)-lysidine synthetase-like protein	tRNA	NA	NA	NA	NA
BBB08659.1|1701067_1703014_+|protease	ATP-dependent metalloprotease FtsH	protease	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	43.6	2.9e-118
>prophage 3
AP017603	Sphingopyxis sp. EG6 DNA, complete genome	3848331	1984048	2042886	3848331	integrase,transposase	uncultured_Mediterranean_phage(25.0%)	59	1990562:1990577	2026458:2026473
BBB08933.1|1984048_1984357_-|transposase	transposase	transposase	NA	NA	NA	NA
BBB08934.1|1984398_1984830_-|transposase	transposase	transposase	NA	NA	NA	NA
BBB08935.1|1985189_1985399_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08936.1|1985739_1986387_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08937.1|1986383_1987400_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08938.1|1987396_1988413_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08939.1|1988409_1989093_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08940.1|1989398_1992008_+	hypothetical protein	NA	NA	NA	NA	NA
1990562:1990577	attL	CCTGAAGCAGGATGAC	NA	NA	NA	NA
BBB08941.1|1992007_1995403_+	UvrD/REP helicase	NA	NA	NA	NA	NA
BBB08942.1|1995463_1996630_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08943.1|1996619_1998482_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08944.1|1998478_2001604_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
BBB08945.1|2001585_2001996_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08946.1|2002676_2003111_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08947.1|2003438_2003783_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08948.1|2003809_2004097_+	TraL family protein	NA	NA	NA	NA	NA
BBB08949.1|2004109_2004682_+	conjugal transfer pilus assembly protein TraE	NA	NA	NA	NA	NA
BBB08950.1|2004681_2005440_+	conjugal transfer pilus assembly protein TraK	NA	NA	NA	NA	NA
BBB08951.1|2005432_2006767_+	pilus assembly protein	NA	NA	NA	NA	NA
BBB08952.1|2006763_2007654_+	thiol disulfide interchange protein DsbC	NA	NA	NA	NA	NA
BBB08953.1|2007659_2008403_+	conjugal transfer pilus assembly protein TraV	NA	NA	NA	NA	NA
BBB08954.1|2008402_2010985_+	inner-membrane protein traC	NA	NA	NA	NA	NA
BBB08955.1|2010981_2011830_-|integrase	integrase	integrase	NA	NA	NA	NA
BBB08956.1|2011874_2012153_-|transposase	transposase	transposase	NA	NA	NA	NA
BBB08957.1|2012154_2012400_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08958.1|2012429_2013302_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08959.1|2013711_2014356_+	prophage MuMc02-like	NA	A5X9F5	Aeromonas_virus	43.2	3.8e-19
BBB08960.1|2014783_2015092_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08961.1|2015091_2015289_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08962.1|2015322_2015562_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08963.1|2015634_2018571_-	TrwC protein	NA	NA	NA	NA	NA
BBB08964.1|2018608_2020993_-	type IV secretory pathway VirD4 components-like	NA	NA	NA	NA	NA
BBB08965.1|2020982_2021315_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08966.1|2021756_2021951_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08967.1|2022053_2022290_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08968.1|2022562_2022847_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08969.1|2022963_2023353_-	single-strand binding protein	NA	A0A2I6PDH4	Staphylococcus_phage	35.5	1.7e-14
BBB08970.1|2023652_2024081_-	hypothetical protein	NA	A0A1B1IUL8	uncultured_Mediterranean_phage	60.5	3.3e-35
BBB08971.1|2024091_2024529_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08972.1|2024646_2025600_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08973.1|2025900_2026323_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08974.1|2026334_2027276_-	antirestriction protein	NA	A0A1V0EBY3	Caulobacter_phage	46.0	3.1e-54
2026458:2026473	attR	GTCATCCTGCTTCAGG	NA	NA	NA	NA
BBB08975.1|2027431_2029420_-	DNA-binding protein	NA	NA	NA	NA	NA
BBB08976.1|2029955_2031089_+	peptidase S1 and S6	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.9e-28
BBB08977.1|2031140_2031641_-	heat shock protein Hsp20	NA	NA	NA	NA	NA
BBB08978.1|2031744_2032221_-	heat shock protein Hsp20	NA	R9S5E2	Prochlorococcus_phage	42.7	5.0e-24
BBB08979.1|2032646_2033705_+	hypothetical protein	NA	NA	NA	NA	NA
BBB08980.1|2033791_2035177_+	phospholipase D/transphosphatidylase	NA	NA	NA	NA	NA
BBB08981.1|2035195_2036893_+	sodium/hydrogen exchanger	NA	NA	NA	NA	NA
BBB08982.1|2036933_2037587_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08983.1|2037725_2038226_-	heat shock protein Hsp20	NA	A0A1B2LRT2	Wolbachia_phage	40.0	2.1e-12
BBB08984.1|2038238_2038631_-	heat shock protein Hsp20	NA	NA	NA	NA	NA
BBB08985.1|2038640_2038997_-	heat shock protein Hsp20	NA	NA	NA	NA	NA
BBB08986.1|2039240_2039792_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08987.1|2039705_2040017_+|transposase	transposase IS5 family protein	transposase	NA	NA	NA	NA
BBB08988.1|2040142_2040412_-	hypothetical protein	NA	NA	NA	NA	NA
BBB08989.1|2040905_2041373_+	ferritin and DPS	NA	W5S6G8	Pithovirus	32.8	4.3e-12
BBB08990.1|2041461_2041629_-	transcriptional regulator Anr	NA	NA	NA	NA	NA
BBB08991.1|2042049_2042886_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
AP017603	Sphingopyxis sp. EG6 DNA, complete genome	3848331	2327509	2441200	3848331	transposase,holin,integrase,lysis,protease	Stx2-converting_phage(25.0%)	114	2338385:2338401	2441167:2441264
BBB09240.1|2327509_2329525_-|holin	glucose-methanol-choline oxidoreductase	holin	NA	NA	NA	NA
BBB09241.1|2329745_2330897_-	hypothetical protein	NA	NA	NA	NA	NA
BBB09242.1|2331175_2333269_-	malate synthase G	NA	NA	NA	NA	NA
BBB09243.1|2333483_2333783_+	hypothetical protein	NA	NA	NA	NA	NA
BBB09244.1|2333873_2335100_+	hypothetical protein	NA	NA	NA	NA	NA
BBB09245.1|2335164_2336376_+	peptidase dimerization domain-containing protein	NA	NA	NA	NA	NA
BBB09246.1|2336372_2337374_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
BBB09247.1|2337377_2338625_+	succinylarginine dihydrolase	NA	NA	NA	NA	NA
2338385:2338401	attL	GTCGATGGCGAACGGCG	NA	NA	NA	NA
BBB09248.1|2338634_2339300_+	spermidine synthase-like protein	NA	NA	NA	NA	NA
2338385:2338401	attL	GTCGATGGCGAACGGCG	NA	NA	NA	NA
BBB09249.1|2339582_2339822_+	hypothetical protein	NA	NA	NA	NA	NA
BBB09250.1|2339870_2340626_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
BBB09251.1|2340576_2341617_-	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	29.0	1.2e-17
BBB09252.1|2341676_2343341_-	transporter	NA	NA	NA	NA	NA
BBB09253.1|2343460_2344840_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	7.1e-55
BBB09254.1|2345074_2345854_-	permease	NA	NA	NA	NA	NA
BBB09255.1|2345899_2346433_-	rhodanese-like sulfurtransferase	NA	NA	NA	NA	NA
BBB09256.1|2346432_2346762_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
BBB09257.1|2346826_2347693_+	beta-lactamase-like protein	NA	NA	NA	NA	NA
BBB09258.1|2347759_2349232_+	carbohydrate kinase	NA	NA	NA	NA	NA
BBB09259.1|2349315_2349543_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
BBB09260.1|2349713_2350193_-	beta-hydroxyacyl-(acyl-carrier-protein) dehydratase FabZ	NA	NA	NA	NA	NA
BBB09261.1|2350197_2350890_-	outer membrane chaperone Skp	NA	NA	NA	NA	NA
BBB09262.1|2350889_2353493_-	surface antigen	NA	NA	NA	NA	NA
BBB09263.1|2353653_2354790_-	peptidase M50 membrane-associated zinc metallopeptidase	NA	NA	NA	NA	NA
BBB09264.1|2354776_2355943_-	1-deoxy-D-xylulose 5-phosphate reductoisomerase	NA	NA	NA	NA	NA
BBB09265.1|2355944_2356622_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
BBB09266.1|2356807_2357485_-	undecaprenyl diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	37.8	9.3e-16
BBB09267.1|2357644_2358199_-	ribosome recycling factor	NA	NA	NA	NA	NA
BBB09268.1|2358225_2358957_-	uridylate kinase	NA	NA	NA	NA	NA
BBB09269.1|2359187_2360114_-	elongation factor Ts	NA	NA	NA	NA	NA
BBB09270.1|2360247_2361072_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
BBB09271.1|2361383_2361644_+	hypothetical protein	NA	NA	NA	NA	NA
BBB09272.1|2361627_2362401_-	CDP-alcohol phosphatidyltransferase	NA	NA	NA	NA	NA
BBB09273.1|2362402_2363137_-	phosphatidylserine decarboxylase	NA	A0A1V0SDU9	Indivirus	38.6	2.3e-12
BBB09274.1|2363287_2364502_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
BBB09275.1|2364753_2366535_+	sodium/hydrogen exchanger	NA	NA	NA	NA	NA
BBB09276.1|2366643_2369580_-	peptidase M16-like protein	NA	NA	NA	NA	NA
BBB09277.1|2369712_2370525_+	nitrilase/cyanide hydratase	NA	NA	NA	NA	NA
BBB09278.1|2370664_2370892_-	hypothetical protein	NA	NA	NA	NA	NA
BBB09279.1|2371064_2371823_-	NUDIX hydrolase	NA	NA	NA	NA	NA
BBB09280.1|2371964_2372600_+	putative transmembrane protein	NA	NA	NA	NA	NA
BBB09281.1|2372734_2373964_-	ferredoxin reductase component of carbazole 1,9a-dioxygenase	NA	NA	NA	NA	NA
BBB09282.1|2374088_2374880_-	response regulator of the LytR/AlgR family	NA	NA	NA	NA	NA
BBB09283.1|2374867_2375965_-|lysis	putative regulator of cell autolysis	lysis	Q9EYF3	Enterobacteria_phage	32.5	4.5e-20
BBB09284.1|2376109_2376553_+	two component LuxR family transcriptional regulator	NA	NA	NA	NA	NA
BBB09285.1|2376471_2376663_-	hypothetical protein	NA	NA	NA	NA	NA
BBB09286.1|2376796_2377888_-	putative aldehyde-dehydrogenase-like protein y4uC	NA	NA	NA	NA	NA
BBB09287.1|2377884_2378523_-	protein PhlB	NA	NA	NA	NA	NA
BBB09288.1|2378947_2379586_+	response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain	NA	NA	NA	NA	NA
BBB09289.1|2379707_2381393_-	two-component sensor	NA	NA	NA	NA	NA
BBB09290.1|2381646_2388720_-	outer membrane autotransporter barrel domain protein	NA	F5B3Z3	Synechococcus_phage	51.4	3.1e-21
BBB09291.1|2389366_2390248_-	diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
BBB09292.1|2390188_2390647_+	outer membrane autotransporter barrel	NA	NA	NA	NA	NA
BBB09293.1|2390643_2390952_-|transposase	transposase	transposase	NA	NA	NA	NA
BBB09294.1|2390993_2391425_-|transposase	transposase	transposase	NA	NA	NA	NA
BBB09295.1|2391609_2391750_-|transposase	transposase IS1328	transposase	NA	NA	NA	NA
BBB09296.1|2393059_2395138_+|integrase	symbiosis island integrase	integrase	B7SYF8	Stenotrophomonas_phage	47.2	9.6e-88
BBB09297.1|2395466_2395886_+|transposase	putative transposase	transposase	NA	NA	NA	NA
BBB09298.1|2395882_2396230_+	IS66 Orf2 family protein	NA	A0A0P0ZDM8	Stx2-converting_phage	59.8	1.9e-33
BBB09299.1|2396283_2397825_+	mobile element protein	NA	A0A0P0ZBS5	Stx2-converting_phage	45.8	5.4e-120
BBB09300.1|2397779_2398433_+	hypothetical protein	NA	NA	NA	NA	NA
2398191:2398207	attR	GTCGATGGCGAACGGCG	NA	NA	NA	NA
BBB09301.1|2398474_2398999_-	globin	NA	NA	NA	NA	NA
2398191:2398207	attR	GTCGATGGCGAACGGCG	NA	NA	NA	NA
BBB09302.1|2399009_2399900_-	hypothetical protein	NA	NA	NA	NA	NA
BBB09303.1|2399993_2400611_+	hypothetical protein	NA	NA	NA	NA	NA
BBB09304.1|2400607_2401675_+	hypothetical protein	NA	NA	NA	NA	NA
BBB09305.1|2401642_2401951_-|transposase	transposase	transposase	NA	NA	NA	NA
BBB09306.1|2401992_2402424_-|transposase	transposase	transposase	NA	NA	NA	NA
BBB09307.1|2402480_2403464_+	TonB-dependent receptor	NA	NA	NA	NA	NA
BBB09308.1|2403710_2404064_-|integrase	integrase catalytic subunit	integrase	NA	NA	NA	NA
BBB09309.1|2404202_2404586_-|transposase	transposase IS66	transposase	NA	NA	NA	NA
BBB09310.1|2404646_2405342_-	mobile element protein	NA	A0A0P0ZEB3	Stx2-converting_phage	41.5	5.4e-43
BBB09311.1|2405356_2405785_-|transposase	putative transposase	transposase	NA	NA	NA	NA
BBB09312.1|2405855_2406209_-	IS66 Orf2 family protein	NA	NA	NA	NA	NA
BBB09313.1|2406205_2406610_-	hypothetical protein	NA	NA	NA	NA	NA
BBB09314.1|2406735_2407596_-|transposase	transposase	transposase	U5P429	Shigella_phage	47.5	2.5e-66
BBB09315.1|2407592_2407883_-|transposase	transposase	transposase	NA	NA	NA	NA
BBB09316.1|2407910_2408270_-|integrase	integrase catalytic subunit	integrase	NA	NA	NA	NA
BBB09317.1|2408358_2408640_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	48.3	7.0e-18
BBB09318.1|2409831_2410515_+	thiol disulfide interchange protein DsbC	NA	NA	NA	NA	NA
BBB09319.1|2410699_2411014_+	hypothetical protein	NA	NA	NA	NA	NA
BBB09320.1|2411151_2411418_+	hypothetical protein	NA	NA	NA	NA	NA
BBB09321.1|2411426_2412068_+	hypothetical protein	NA	NA	NA	NA	NA
BBB09322.1|2412051_2412816_+	hypothetical protein	NA	NA	NA	NA	NA
BBB09323.1|2412812_2414105_+	conjugal transfer pilus assembly protein TraB	NA	NA	NA	NA	NA
BBB09324.1|2414134_2414743_+	type IV conjugative transfer system protein TraV	NA	NA	NA	NA	NA
BBB09325.1|2414739_2417268_+	sex pilus assembly protein	NA	NA	NA	NA	NA
BBB09326.1|2417264_2417597_+	hypothetical protein	NA	NA	NA	NA	NA
BBB09327.1|2417825_2418509_+	plasmid transfer protein TraW	NA	NA	NA	NA	NA
BBB09328.1|2419232_2420123_+	conjugal DNA transfer protein	NA	NA	NA	NA	NA
BBB09329.1|2420492_2422397_+	hypothetical exported protein	NA	NA	NA	NA	NA
BBB09330.1|2422393_2423503_+	conjugal transfer mating pair stabilization protein TraN	NA	NA	NA	NA	NA
BBB09331.1|2423474_2424368_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
BBB09332.1|2424339_2424939_+|protease	type IV secretory protease	protease	NA	NA	NA	NA
BBB09333.1|2424935_2425814_+	thioredoxin-like protein	NA	NA	NA	NA	NA
BBB09334.1|2425849_2426260_-	hypothetical protein	NA	NA	NA	NA	NA
BBB09335.1|2426256_2426508_-	hypothetical protein	NA	NA	NA	NA	NA
BBB09336.1|2426602_2427133_+	hypothetical protein	NA	NA	NA	NA	NA
BBB09337.1|2427325_2427601_+	hypothetical protein	NA	NA	NA	NA	NA
BBB09338.1|2427605_2428322_+	hypothetical protein	NA	NA	NA	NA	NA
BBB09339.1|2428622_2429030_-	PilT-like protein	NA	NA	NA	NA	NA
BBB09340.1|2429026_2429221_-	transcriptional regulator of the Arc/MetJ class	NA	NA	NA	NA	NA
BBB09341.1|2429480_2430908_+	sex pilus assembly protein TraH	NA	NA	NA	NA	NA
BBB09342.1|2430913_2434654_+	DNA transfer and F pilus assembly protein	NA	NA	NA	NA	NA
BBB09343.1|2434650_2435100_-	hypothetical protein	NA	NA	NA	NA	NA
BBB09344.1|2435345_2435744_-	two-component response regulator	NA	NA	NA	NA	NA
BBB09345.1|2435969_2436209_+	hypothetical protein	NA	NA	NA	NA	NA
BBB09346.1|2436212_2436641_+	PilT protein domain-containing protein	NA	NA	NA	NA	NA
BBB09347.1|2436753_2436921_+	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
BBB09348.1|2436957_2437176_-	chorismate synthase	NA	NA	NA	NA	NA
BBB09349.1|2437745_2438231_+	luxR family protein	NA	NA	NA	NA	NA
BBB09350.1|2438369_2438717_-|integrase	integrase	integrase	NA	NA	NA	NA
BBB09351.1|2438861_2440154_+|transposase	transposase IS116/IS110/IS902 family protein	transposase	NA	NA	NA	NA
BBB09352.1|2440307_2440877_-|integrase	integrase	integrase	NA	NA	NA	NA
BBB09353.1|2440921_2441200_-|transposase	transposase	transposase	NA	NA	NA	NA
2441167:2441264	attR	TAATCTCTTCCGGGCGATGCTTCTTGCTCGGCATTCTATATCTCCTTCGTCGTCCAAAATATCATCAATTTTGGACCACTCAGAAGGGGGCAGATCAG	NA	NA	NA	NA
>prophage 5
AP017603	Sphingopyxis sp. EG6 DNA, complete genome	3848331	3675727	3719571	3848331	integrase,coat,transposase	Bordetella_phage(20.0%)	37	3666300:3666314	3696848:3696862
3666300:3666314	attL	CGGCGACGCTCATGG	NA	NA	NA	NA
BBB10541.1|3675727_3676996_-|integrase	phage integrase family protein	integrase	A0A291LA13	Bordetella_phage	41.4	2.5e-14
BBB10542.1|3677547_3677742_+	ParB-like protein	NA	NA	NA	NA	NA
BBB10543.1|3677917_3678100_-	hypothetical protein	NA	NA	NA	NA	NA
BBB10544.1|3678424_3678745_-	IstB ATP binding domain-containing protein	NA	A0A059NT77	Lactococcus_phage	40.6	1.4e-17
BBB10545.1|3678793_3679567_-	short chain dehydrogenase	NA	NA	NA	NA	NA
BBB10546.1|3679864_3680587_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
BBB10547.1|3681665_3682175_-|transposase	ISRm2011-2 transposase protein	transposase	A0A1V0SCG6	Indivirus	31.3	2.5e-13
BBB10548.1|3682186_3682552_-|transposase	putative transposase	transposase	NA	NA	NA	NA
BBB10549.1|3683041_3683461_-	molybdopterin biosynthesis protein MoeB	NA	NA	NA	NA	NA
BBB10550.1|3683530_3684226_-|coat	coatomer subunit gamma	coat	NA	NA	NA	NA
BBB10551.1|3685688_3685922_-	short-chain dehydrogenase/reductase SDR	NA	NA	NA	NA	NA
BBB10552.1|3686048_3695063_-	S-antigen protein	NA	NA	NA	NA	NA
BBB10553.1|3695036_3696701_+	hypothetical protein	NA	NA	NA	NA	NA
BBB10554.1|3696792_3698136_+	hypothetical protein	NA	NA	NA	NA	NA
3696848:3696862	attR	CCATGAGCGTCGCCG	NA	NA	NA	NA
BBB10555.1|3698132_3700355_+	hypothetical protein	NA	W8CYL7	Bacillus_phage	23.2	1.3e-26
BBB10556.1|3700351_3701608_+	membrane fusion protein of T1SS	NA	NA	NA	NA	NA
BBB10557.1|3701670_3703371_+	UDP-N-acetylmuramoyl-tripeptide-D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
BBB10558.1|3703367_3703973_+	putative beta-hydroxylase	NA	NA	NA	NA	NA
BBB10559.1|3704237_3704585_+	conserved barrel domain protein	NA	NA	NA	NA	NA
BBB10560.1|3704581_3704860_+	hypothetical protein	NA	NA	NA	NA	NA
BBB10561.1|3705066_3705993_+	D-alanine-D-alanine ligase	NA	NA	NA	NA	NA
BBB10562.1|3706270_3707062_+	prolyl oligopeptidase family protein	NA	NA	NA	NA	NA
BBB10563.1|3707085_3707877_+	hypothetical protein	NA	NA	NA	NA	NA
BBB10564.1|3708128_3709439_+	UDP-N-acetylmuramoyl-tripeptide-D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
BBB10565.1|3709596_3711540_+	hypothetical protein	NA	NA	NA	NA	NA
BBB10566.1|3711985_3712459_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
BBB10567.1|3712566_3713193_+	autoinducer synthesis protein	NA	NA	NA	NA	NA
BBB10568.1|3713189_3714074_+	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
BBB10569.1|3714070_3714685_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
BBB10570.1|3714738_3714966_+	hypothetical protein	NA	NA	NA	NA	NA
BBB10571.1|3715107_3715497_-	PilT domain-containing protein	NA	NA	NA	NA	NA
BBB10572.1|3715493_3715739_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
BBB10573.1|3715900_3716833_+	hypothetical protein	NA	NA	NA	NA	NA
BBB10574.1|3717023_3717368_-	hypothetical protein	NA	NA	NA	NA	NA
BBB10575.1|3717569_3718277_-	exodeoxyribonuclease V beta subunit	NA	NA	NA	NA	NA
BBB10576.1|3718423_3718714_+|transposase	transposase	transposase	NA	NA	NA	NA
BBB10577.1|3718710_3719571_+|transposase	transposase	transposase	U5P429	Shigella_phage	47.1	1.8e-64
