The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	10532	54257	2082741	integrase,transposase	Streptococcus_phage(25.0%)	47	24950:24966	38260:38276
AYE60577.1|10532_11459_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.2	2.9e-28
AYE60578.1|12334_13927_-	ABC transporter ATPase and permease	NA	W8CYL7	Bacillus_phage	25.9	1.0e-12
AYE60579.1|13904_15233_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60580.1|15261_15672_-|transposase	transposase	transposase	H7BWC8	unidentified_phage	39.2	3.1e-22
AYE60581.1|15827_16154_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60582.1|16332_18354_+	DHH domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AYE60583.1|18365_18821_+	ribosomal protein L9	NA	NA	NA	NA	NA
AYE60584.1|18851_20246_+	replicative DNA helicase DnaB1	NA	A0A1P8VVQ6	Streptococcus_phage	50.6	3.7e-120
AYE60585.1|20507_21845_-|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	26.7	1.3e-37
AYE60586.1|21819_22035_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE60587.1|22089_22437_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE60588.1|22750_23680_+	putative alkylphosphonate ABC transporter	NA	NA	NA	NA	NA
AYE60589.1|24002_24929_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.2	2.9e-28
24950:24966	attL	GCTTTTGCAGTTTGATC	NA	NA	NA	NA
AYE60590.1|25202_26132_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60591.1|26567_27131_+	fructokinase	NA	NA	NA	NA	NA
AYE60592.1|27207_28590_-|integrase	DNA integrase	integrase	A0A1B1P773	Bacillus_phage	46.7	6.9e-58
AYE60593.1|28653_29883_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60594.1|29966_30671_-	hypothetical protein	NA	G3MA03	Bacillus_virus	43.6	2.1e-18
AYE60595.1|31039_31276_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60596.1|31343_31514_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60597.1|31864_32065_-	transcriptional regulator	NA	NA	NA	NA	NA
AYE60598.1|32233_32872_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.8	2.7e-17
AYE60599.1|32868_33627_+	ABC transporter permease protein	NA	NA	NA	NA	NA
AYE60600.1|33775_34645_+	SIR2 family protein	NA	NA	NA	NA	NA
AYE60601.1|34654_34879_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60602.1|34888_35476_+	transcriptional regulator	NA	NA	NA	NA	NA
AYE60603.1|35579_36881_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60604.1|36960_37200_+	cytosol non-specific dipeptidase	NA	NA	NA	NA	NA
AYE60605.1|37362_37899_+	dipeptidase	NA	NA	NA	NA	NA
AYE60606.1|39072_39810_+|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	45.9	2.5e-51
38260:38276	attR	GATCAAACTGCAAAAGC	NA	NA	NA	NA
AYE60607.1|40027_41407_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60608.1|41503_42277_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60609.1|42315_42876_-	putative cobalamin adenosyltransferase	NA	NA	NA	NA	NA
AYE60610.1|42876_43401_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60611.1|43412_43811_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60612.1|43831_46066_-	adenosylcobalamin-dependent ribonucleoside-triphosphate reductase RtpR	NA	A0A220NRW8	Mycobacterium_phage	32.3	7.9e-88
AYE60613.1|46403_47351_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60614.1|47347_47920_+	putative esterase	NA	NA	NA	NA	NA
AYE60615.1|47948_48131_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60616.1|48308_48656_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60617.1|49029_49791_-	ABC transporter ATP binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	1.4e-07
AYE60618.1|49787_50684_-	ABC transporter membrane spanning permease	NA	NA	NA	NA	NA
AYE60619.1|50680_51673_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYE60620.1|52022_52730_+	putative HAD-like hydrolase	NA	NA	NA	NA	NA
AYE60621.1|52800_52926_-	Mg+2 and co2 transporter	NA	NA	NA	NA	NA
AYE60622.1|53430_53958_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60623.1|53999_54257_+|transposase	putative transposase	transposase	NA	NA	NA	NA
>prophage 2
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	61202	108716	2082741	integrase,transposase,protease	Bacillus_virus(14.29%)	44	57678:57698	114910:114930
57678:57698	attL	CGCTCAAGAAATTATTGCAGA	NA	NA	NA	NA
AYE60630.1|61202_62537_-|transposase	transposase	transposase	G3MB42	Bacillus_virus	35.5	1.6e-51
AYE60631.1|62566_63175_-|transposase	transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	4.0e-34
AYE60632.1|63606_64434_+	Exodeoxyribonuclease A	NA	M1PSC0	Streptococcus_phage	63.5	3.4e-97
AYE60633.1|64843_65182_+	APC family amino acid-polyamine-organocation transporter	NA	NA	NA	NA	NA
AYE60634.1|65450_68282_+	DNA/RNA helicase	NA	U3PFS7	Lactobacillus_phage	28.6	2.0e-27
AYE60635.1|68321_69308_-	penicillin-binding protein	NA	NA	NA	NA	NA
AYE60636.1|69621_69864_+	Polypeptide deformylase	NA	NA	NA	NA	NA
AYE60637.1|75607_75766_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60638.1|76069_76528_-	transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	32.9	1.1e-17
AYE60639.1|76845_77475_-	transcriptional regulator	NA	NA	NA	NA	NA
AYE60640.1|77933_78803_-	phospho-beta-glycosidase	NA	NA	NA	NA	NA
AYE60641.1|78799_79747_-	Lipopolysaccharide biosynthesis glycosyltransferase	NA	NA	NA	NA	NA
AYE60642.1|79758_80715_-	putative glucosyl transferase	NA	NA	NA	NA	NA
AYE60643.1|80733_81570_-	putative glycosyl transferase	NA	NA	NA	NA	NA
AYE60644.1|81665_82484_+	transcriptional regulator	NA	NA	NA	NA	NA
AYE60645.1|82903_83293_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60646.1|83342_84101_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60647.1|84229_85351_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60648.1|85410_86148_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60649.1|86250_87153_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60650.1|87685_87907_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60651.1|88235_88952_+	Alkaline phosphatase synthesis transcriptional regulatory proteinphoP	NA	W8CYM9	Bacillus_phage	38.8	8.8e-41
AYE60652.1|89015_90875_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.4	3.9e-32
AYE60653.1|90864_92214_+	YycH-like protein	NA	NA	NA	NA	NA
AYE60654.1|92216_93041_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60655.1|93056_93854_+	putative zinc-dependent hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	34.6	5.4e-31
AYE60656.1|93940_95182_+|protease	HtrA-like serine protease	protease	W5SAB9	Pithovirus	27.1	4.1e-09
AYE60657.1|95659_96139_+	rRNA large subunit methyltransferase	NA	NA	NA	NA	NA
AYE60658.1|96348_96993_+	surface layer protein	NA	NA	NA	NA	NA
AYE60659.1|97174_98059_-	proline iminopeptidase	NA	NA	NA	NA	NA
AYE60660.1|98067_98721_-	putative ABC transporter permease component	NA	NA	NA	NA	NA
AYE60661.1|98724_100074_-	cobalt transport protein ATPase component	NA	G3M9Y6	Bacillus_virus	28.1	3.3e-12
AYE60662.1|100231_101173_+	regulatory protein	NA	NA	NA	NA	NA
AYE60663.1|101254_101668_-|integrase	integrase	integrase	A0A0C5AEA5	Paenibacillus_phage	49.4	4.3e-16
AYE60664.1|102435_102750_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE60665.1|102841_103738_-|protease	protease htpX-like protein	protease	NA	NA	NA	NA
AYE60666.1|103752_104313_-	Membrane protein LemA-like protein	NA	A0A0C5K8T5	Enterococcus_phage	28.1	6.7e-12
AYE60667.1|104379_105486_-	cation transporter	NA	NA	NA	NA	NA
AYE60668.1|105663_106068_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60669.1|106137_106320_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
AYE60670.1|107085_107514_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60671.1|107639_107882_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	67.3	3.8e-12
AYE60672.1|107935_108235_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE60673.1|108221_108716_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	53.7	1.8e-37
114910:114930	attR	TCTGCAATAATTTCTTGAGCG	NA	NA	NA	NA
>prophage 3
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	199912	264479	2082741	tRNA,transposase,protease	Lactobacillus_virus(21.05%)	60	NA	NA
AYE60763.1|199912_200935_+|tRNA	tryptophanyl-tRNA synthetase	tRNA	NA	NA	NA	NA
AYE60764.1|200959_201439_+	dCMP deaminase	NA	A7KUY9	Bacillus_phage	59.0	5.2e-37
AYE60765.1|201428_202037_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60766.1|202335_204999_+	magnesium-transporting ATPase	NA	M1HK51	Paramecium_bursaria_Chlorella_virus	23.0	7.6e-37
AYE60767.1|205091_207068_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	1.0e-99
AYE60768.1|207067_207835_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60769.1|207821_208388_+	ribonuclease M5	NA	NA	NA	NA	NA
AYE60770.1|208377_209262_+	dimethyladenosine transferase	NA	NA	NA	NA	NA
AYE60771.1|209356_209581_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60772.1|209699_210530_+	purine operon repressor	NA	NA	NA	NA	NA
AYE60773.1|210576_211962_+	UDP-N-acetylglucosamine-1-phosphate uridyltransferase	NA	A0A1V0SFS6	Hokovirus	35.0	3.9e-29
AYE60774.1|212198_212513_+	S-layer protein	NA	NA	NA	NA	NA
AYE60775.1|212669_212951_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	54.4	4.8e-19
AYE60776.1|212934_213570_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.3	4.7e-62
AYE60777.1|213941_214964_+	Cell separation protein	NA	NA	NA	NA	NA
AYE60778.1|215099_216494_+	putative bacterial surface layer protein	NA	NA	NA	NA	NA
AYE60779.1|216734_217709_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.8	6.6e-47
AYE60780.1|217774_218188_+	ROK family protein	NA	NA	NA	NA	NA
AYE60781.1|218737_219013_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60782.1|219040_220405_-	HD family phosphohydrolase	NA	E3T4P8	Cafeteria_roenbergensis_virus	30.1	9.6e-28
AYE60783.1|220518_220920_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60784.1|220966_221524_+	DNA-directed RNA polymerase delta subunit	NA	NA	NA	NA	NA
AYE60785.1|221641_223261_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.2	5.6e-136
AYE60786.1|223390_224686_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AYE60787.1|224775_225033_+	CbbY	NA	NA	NA	NA	NA
AYE60788.1|225066_225429_+	haloacid dehalogenase	NA	NA	NA	NA	NA
AYE60789.1|225484_226909_-	peptidase U34	NA	NA	NA	NA	NA
AYE60790.1|226989_227814_-	raffinose operon transcriptional regulator	NA	NA	NA	NA	NA
AYE60791.1|227913_229188_-	xanthine permease	NA	NA	NA	NA	NA
AYE60792.1|229191_229770_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AYE60793.1|230043_230649_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60794.1|230957_232187_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.7	4.2e-123
AYE60795.1|232725_232998_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60796.1|233040_233193_-	HTH XRE family transcription regulator	NA	NA	NA	NA	NA
AYE60797.1|233416_234967_+	GMP synthase	NA	A0A1V0SH76	Hokovirus	34.1	6.2e-23
AYE60798.1|235353_236481_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.5	1.8e-117
AYE60799.1|236687_236960_+	zinc-binding dehydrogenase family oxidoreductase	NA	NA	NA	NA	NA
AYE60800.1|237356_238592_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.4	5.3e-102
AYE60801.1|238720_240001_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	3.5e-48
AYE60802.1|240145_240976_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60803.1|241160_241406_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
AYE60804.1|241531_242899_+	UDP-N-acetylmuramoylalanyl-D-glutamyl-2, 6-diaminopimelate-D-alanyl-D-alanine ligase	NA	NA	NA	NA	NA
AYE60805.1|242911_244423_+	putative ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	38.1	2.9e-65
AYE60806.1|244505_244862_+	4'-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AYE60807.1|244864_245995_+	alanine racemase	NA	NA	NA	NA	NA
AYE60808.1|246311_246728_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60809.1|246779_247487_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60810.1|247674_248646_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AYE60811.1|248780_249338_+|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AYE60812.1|249339_252837_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AYE60813.1|252848_253091_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60814.1|253156_253534_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60815.1|253533_253896_+	putative ribosomal protein	NA	NA	NA	NA	NA
AYE60816.1|253936_255193_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	25.6	2.7e-16
AYE60817.1|255347_257453_+	cell division protein FtsH	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	47.8	1.7e-108
AYE60818.1|257505_258396_+	Hsp33-like chaperonin	NA	NA	NA	NA	NA
AYE60819.1|258473_259499_+|tRNA	tRNA dihydrouridine synthase B	tRNA	NA	NA	NA	NA
AYE60820.1|259514_261065_+|tRNA	lysyl-tRNA synthetase	tRNA	A0A2K9L3L6	Tupanvirus	35.8	1.2e-82
AYE60821.1|261438_261894_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60822.1|261998_264479_+|protease	ATP-dependent protease ATP-binding subunit ClpC	protease	A0A223W0B1	Agrobacterium_phage	33.4	2.8e-118
>prophage 4
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	293982	360516	2082741	integrase,tRNA,transposase,protease	Streptococcus_phage(29.17%)	79	300968:301009	309417:309458
AYE60860.1|293982_294774_+|tRNA	tRNA pseudouridine synthase A	tRNA	NA	NA	NA	NA
AYE60861.1|294874_295318_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AYE60862.1|295333_295729_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AYE60863.1|295819_296077_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60864.1|296280_296865_-	4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis enzyme, amidase family protein	NA	NA	NA	NA	NA
AYE60865.1|296861_297317_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60866.1|297640_298399_+	membrane protein	NA	NA	NA	NA	NA
AYE60867.1|298437_299118_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
AYE60868.1|299180_300080_+	cation efflux protein	NA	NA	NA	NA	NA
AYE60869.1|300088_300271_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60870.1|300284_300965_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
300968:301009	attL	TGAAGTGAGACCTAAAAGTGAGACACTTTTAGGTCTTTTACT	NA	NA	NA	NA
AYE60871.1|301009_302392_+|integrase	DNA integrase	integrase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AYE60872.1|302523_303459_+	2',3'-cyclic nucleotide 3'-phosphodiesterase	NA	NA	NA	NA	NA
AYE60873.1|303603_304086_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.9	1.0e-37
AYE60874.1|304063_304834_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	60.1	3.3e-78
AYE60875.1|305302_307981_+	magnesium-translocating P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	24.4	1.1e-43
AYE60876.1|308033_309416_-|integrase	DNA integrase	integrase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AYE60877.1|309650_309839_-	hypothetical protein	NA	NA	NA	NA	NA
309417:309458	attR	AGTAAAAGACCTAAAAGTGTCTCACTTTTAGGTCTCACTTCA	NA	NA	NA	NA
AYE60878.1|310278_311559_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.8	3.9e-47
AYE60879.1|311579_312395_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60880.1|312538_313888_-	oligoendopeptidase E2 PepE2	NA	R4TV59	Phaeocystis_globosa_virus	36.1	3.9e-74
AYE60881.1|314198_314510_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	71.1	8.5e-33
AYE60882.1|314618_315320_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	51.1	6.6e-57
AYE60883.1|315597_315900_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60884.1|316034_316586_+	dUTP diphosphatase	NA	A0A249XZY3	Enterococcus_phage	55.2	4.6e-29
AYE60885.1|316585_317962_+	DNA repair protein RadA	NA	NA	NA	NA	NA
AYE60886.1|318037_319537_+|tRNA	glutamyl-tRNA synthetase	tRNA	NA	NA	NA	NA
AYE60887.1|319629_321060_+|tRNA	cysteinyl-tRNA synthetase	tRNA	M1PG92	Moumouvirus	29.4	9.6e-47
AYE60888.1|321052_321496_+	Ribonuclease III	NA	NA	NA	NA	NA
AYE60889.1|321482_322235_+	TrmH family RNA methyltransferase	NA	NA	NA	NA	NA
AYE60890.1|322377_322923_+	Putative DNA-directed RNA polymerase sigma factor, sigma H	NA	NA	NA	NA	NA
AYE60891.1|322998_323217_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60892.1|323328_324825_+	gluconate kinase	NA	NA	NA	NA	NA
AYE60893.1|325351_326173_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AYE60894.1|326908_327076_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
AYE60895.1|327183_327741_+	transcription antiterminator	NA	NA	NA	NA	NA
AYE60896.1|327868_328294_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
AYE60897.1|328376_329069_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
AYE60898.1|329427_330657_-|transposase	transposase	transposase	A0A1X9I619	Streptococcus_phage	38.4	1.8e-65
AYE60899.1|330894_332049_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.7	2.9e-41
AYE60900.1|332286_332514_-	mobile genetic element	NA	NA	NA	NA	NA
AYE60901.1|332671_333091_-	DDE endonuclease	NA	NA	NA	NA	NA
AYE60902.1|333215_334088_+	ABC transporter	NA	NA	NA	NA	NA
AYE60903.1|334091_335087_+	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AYE60904.1|335088_335976_+	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AYE60905.1|335983_336781_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	8.1e-11
AYE60906.1|336782_337538_+	phosphate ABC transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.1	4.6e-16
AYE60907.1|337554_338232_+	phosphate uptake regulator	NA	NA	NA	NA	NA
AYE60908.1|338390_338603_+	auxin efflux transporter type protein	NA	NA	NA	NA	NA
AYE60909.1|338627_339566_+	Receptor	NA	NA	NA	NA	NA
AYE60910.1|339826_340339_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
AYE60911.1|340389_340752_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
AYE60912.1|341157_341652_+	potassium transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	34.7	1.7e-11
AYE60913.1|341653_342283_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYE60914.1|342272_342779_+	cytidine/deoxycytidylate deaminase, zinc-binding region	NA	NA	NA	NA	NA
AYE60915.1|342973_344761_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	39.7	2.0e-49
AYE60916.1|344792_345128_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60917.1|345128_345728_+	recombination protein RecR	NA	NA	NA	NA	NA
AYE60918.1|345727_345973_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60919.1|346076_346715_+	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	50.5	8.9e-53
AYE60920.1|346726_347047_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60921.1|347047_347905_+	DNA polymerase III, delta subunit	NA	M1NSC1	Streptococcus_phage	29.2	3.9e-19
AYE60922.1|347915_348266_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
AYE60923.1|348267_349122_+	putative methyltransferase	NA	M1PLC5	Streptococcus_phage	47.7	2.3e-64
AYE60924.1|349124_349859_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
AYE60925.1|349900_350419_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60926.1|350443_351178_+	ROK family protein	NA	NA	NA	NA	NA
AYE60927.1|351212_351734_+	putative N-acetyltransferase	NA	NA	NA	NA	NA
AYE60928.1|351730_352834_+|protease	protease	protease	A0A0R6PI74	Moraxella_phage	35.3	4.7e-49
AYE60929.1|353312_353450_+	Deoxyribose-phosphate aldolase (Phosphodeoxyriboaldolase) (Deoxyriboaldolase) (DERA)	NA	NA	NA	NA	NA
AYE60930.1|353538_354768_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.2	2.2e-124
AYE60931.1|354905_355094_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
AYE60932.1|355103_356075_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AYE60933.1|356067_356778_+	transcriptional regulator	NA	NA	NA	NA	NA
AYE60934.1|357218_357566_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE60935.1|357620_357836_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE60936.1|357810_359148_+|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	26.7	1.3e-37
AYE60937.1|359236_359476_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE60938.1|359454_360516_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.6	1.7e-40
>prophage 5
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	365546	424612	2082741	integrase,tRNA,transposase	Streptococcus_phage(16.67%)	53	382146:382161	416365:416380
AYE60944.1|365546_366776_-|transposase	transposase	transposase	A0A1X9I619	Streptococcus_phage	38.6	6.1e-66
AYE60945.1|367102_367336_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AYE60946.1|367731_368355_+	PTS transport system subunit IIABC	NA	NA	NA	NA	NA
AYE60947.1|368518_368782_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60948.1|369319_369844_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60949.1|370700_371360_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60950.1|371412_372879_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60951.1|372996_373317_-	prophage DNA packaging protein NU1	NA	NA	NA	NA	NA
AYE60952.1|373332_374046_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60953.1|374659_374839_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60954.1|374972_375704_+	transcriptional regulator, Cro/CI family	NA	Q9AZN3	Lactococcus_phage	49.2	7.7e-08
AYE60955.1|376095_377247_+|integrase	integrase	integrase	A0A1S5S7K9	Streptococcus_phage	36.8	7.0e-56
AYE60956.1|377483_377768_+	co-chaperonin GroES	NA	A0A221S3C8	uncultured_virus	42.4	4.3e-15
AYE60957.1|377821_379444_+	heat shock protein 60 family chaperone GroEL	NA	A0A240F766	uncultured_virus	54.2	5.8e-157
AYE60958.1|379602_382200_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	25.3	1.0e-38
382146:382161	attL	GCAGATTATGCAAATG	NA	NA	NA	NA
AYE60959.1|382199_384110_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.8	2.6e-55
AYE60960.1|384110_384701_+	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
AYE60961.1|384749_385766_+	Holliday junction DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	31.6	5.5e-12
AYE60962.1|385824_386250_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AYE60963.1|386383_387835_+	glucose-6-phosphate 1-dehydrogenase	NA	M4SIY3	Cyanophage	32.6	1.5e-63
AYE60964.1|387827_388949_+	DNA-damage-inducible protein	NA	NA	NA	NA	NA
AYE60965.1|389008_389965_+	oligoribonuclease	NA	NA	NA	NA	NA
AYE60966.1|389957_391319_+	putative RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.2	4.4e-49
AYE60967.1|391589_391844_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60968.1|391934_392192_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60969.1|392651_395291_+|tRNA	alanyl-tRNA synthase	tRNA	A0A1V0SK38	Klosneuvirus	33.0	1.0e-62
AYE60970.1|395351_395609_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60971.1|395608_396037_+	Putative Holliday junction resolvase	NA	NA	NA	NA	NA
AYE60972.1|396038_396350_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60973.1|396412_398770_+	DNA mismatch repair protein MutS	NA	Q94M10	Lactobacillus_phage	48.7	9.7e-20
AYE60974.1|398890_399202_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	37.8	9.1e-19
AYE60975.1|399246_399618_-	large-conductance mechanosensitive channel	NA	NA	NA	NA	NA
AYE60976.1|399688_400216_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE60977.1|400212_400545_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE60978.1|400679_401081_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60979.1|401169_401973_+	glutamate racemase	NA	NA	NA	NA	NA
AYE60980.1|401972_402593_+	putative nucleoside triphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	30.5	1.4e-10
AYE60981.1|402948_404151_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.1	6.0e-42
AYE60982.1|404407_405226_-	hypothetical protein	NA	NA	NA	NA	NA
AYE60983.1|405391_405817_+	Methyl-accepting chemotaxis-like protein	NA	NA	NA	NA	NA
AYE60984.1|405834_406206_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60985.1|406271_407378_-	Xaa-Pro aminopeptidase Q PepQ	NA	NA	NA	NA	NA
AYE60986.1|407524_408526_+	catabolite control protein A	NA	NA	NA	NA	NA
AYE60987.1|408606_409977_-	putative glycerophosphoryl diester phosphodiesterase	NA	A0A173GBD0	Staphylococcus_phage	26.5	9.6e-12
AYE60988.1|410070_410391_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60989.1|410405_411797_+	Ser/Thr phosphatase family protein	NA	NA	NA	NA	NA
AYE60990.1|411780_412404_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60991.1|412403_413183_+	putative sugar phosphatase	NA	NA	NA	NA	NA
AYE60992.1|413320_413788_+	Membrane protein	NA	NA	NA	NA	NA
AYE60993.1|413854_415237_+|integrase	DNA integrase	integrase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AYE60994.1|415256_415907_-	membrane protein	NA	NA	NA	NA	NA
AYE60995.1|415915_416740_-	ferredoxin-NADP reductase	NA	A0A249XZT7	Enterococcus_phage	29.6	1.1e-07
416365:416380	attR	CATTTGCATAATCTGC	NA	NA	NA	NA
AYE60996.1|424147_424612_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	447651	500083	2082741	integrase,tRNA,transposase	Bacillus_phage(17.65%)	53	469854:469869	495347:495362
AYE61010.1|447651_449034_-|integrase	DNA integrase	integrase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AYE61011.1|449094_449757_-	PAP2 family protein	NA	NA	NA	NA	NA
AYE61012.1|450045_452460_+|tRNA	leucyl-tRNA synthetase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.8	0.0e+00
AYE61013.1|452553_454200_+	transporter	NA	NA	NA	NA	NA
AYE61014.1|454379_455084_+|transposase	transposase	transposase	Q9MBM9	Staphylococcus_prophage	31.3	1.6e-23
AYE61015.1|455067_455427_+|transposase	transposase	transposase	H7BWC8	unidentified_phage	41.1	9.5e-20
AYE61016.1|455880_456633_+	PrtP precursor	NA	NA	NA	NA	NA
AYE61017.1|456651_457107_+	Thermostable pullulanase	NA	NA	NA	NA	NA
AYE61018.1|457915_459223_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61019.1|460025_460409_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61020.1|460491_460779_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61021.1|461036_461402_+	thioredoxin	NA	NA	NA	NA	NA
AYE61022.1|461391_462042_+	putative transcription regulator	NA	NA	NA	NA	NA
AYE61023.1|462155_463079_+	thioredoxin reductase	NA	G3MA85	Bacillus_virus	49.7	9.5e-80
AYE61024.1|463386_463740_+	dithiol-disulfide isomerase	NA	NA	NA	NA	NA
AYE61025.1|463800_464100_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61026.1|464386_464587_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61027.1|464647_464956_-	PspC family transcription regulator	NA	NA	NA	NA	NA
AYE61028.1|465255_466551_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
AYE61029.1|466552_467401_+	ribokinase-like protein	NA	NA	NA	NA	NA
AYE61030.1|467528_468203_+	putative cell surface protein	NA	NA	NA	NA	NA
AYE61031.1|468301_468766_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AYE61032.1|468820_469348_-	Phenolic acid decarboxylase padC	NA	NA	NA	NA	NA
AYE61033.1|469529_470054_+	hypothetical protein	NA	NA	NA	NA	NA
469854:469869	attL	TTAGATAAAGATAATC	NA	NA	NA	NA
AYE61034.1|470066_470378_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61035.1|470586_472272_+|tRNA	arginyl-tRNA synthetase	tRNA	A0A2I2L3K1	Orpheovirus	31.4	6.0e-72
AYE61036.1|472382_473294_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AYE61037.1|473366_473885_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61038.1|473887_474157_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61039.1|474304_474589_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61040.1|475189_476173_+	ATP-binding protein	NA	W5SAS9	Pithovirus	27.8	1.8e-12
AYE61041.1|476551_477730_+|transposase	transposase IS1201	transposase	A0A220NQR7	Corynebacterium_phage	28.8	5.2e-38
AYE61042.1|478206_479067_+	phage protein	NA	A0A1B0Y4T1	Lactobacillus_phage	36.8	1.9e-37
AYE61043.1|479744_480551_+	DNA primase	NA	A0A060ADU2	Enterococcus_phage	26.9	2.4e-10
AYE61044.1|482469_483453_+|integrase	putative integrase	integrase	NA	NA	NA	NA
AYE61045.1|483472_484255_+	ATPase, para family protein	NA	Q8JL10	Natrialba_phage	38.0	1.5e-17
AYE61046.1|485394_485625_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61047.1|485843_486056_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61048.1|487302_488481_+|transposase	transposase IS1201	transposase	A0A220NQR7	Corynebacterium_phage	29.5	8.8e-38
AYE61049.1|488753_490349_+	lactococcin A	NA	W8CYL7	Bacillus_phage	20.8	3.1e-09
AYE61050.1|490345_491929_+	ABC transport protein ATPase and permease	NA	A0A076FI99	Aureococcus_anophage	24.6	3.3e-16
AYE61051.1|492345_492597_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61052.1|492693_492867_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61053.1|493237_493585_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE61054.1|493639_493855_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE61055.1|493829_495167_+|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	26.7	1.3e-37
AYE61056.1|495624_495921_+	hypothetical protein	NA	NA	NA	NA	NA
495347:495362	attR	GATTATCTTTATCTAA	NA	NA	NA	NA
AYE61057.1|496081_496345_+	toxin-antitoxin system	NA	NA	NA	NA	NA
AYE61058.1|496409_496724_+	PemK family protein	NA	NA	NA	NA	NA
AYE61059.1|496773_497631_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE61060.1|497702_499097_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	42.6	2.8e-51
AYE61061.1|499276_499594_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE61062.1|499750_500083_+|transposase	transposase	transposase	G3MB42	Bacillus_virus	35.2	5.0e-07
>prophage 7
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	507173	552700	2082741	integrase,tRNA,transposase,protease	Staphylococcus_virus(20.0%)	43	514154:514171	555732:555749
AYE61071.1|507173_508949_+|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.8e-88
AYE61072.1|509816_511874_+	penicillin-binding protein	NA	NA	NA	NA	NA
AYE61073.1|511894_512245_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61074.1|512253_513474_+	phosphoesterase	NA	NA	NA	NA	NA
AYE61075.1|513454_515956_+	hypothetical protein	NA	NA	NA	NA	NA
514154:514171	attL	GCTTTAGCTAATATTCAA	NA	NA	NA	NA
AYE61076.1|515948_516926_+	CMP-binding factor	NA	NA	NA	NA	NA
AYE61077.1|517073_518831_+|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.8e-88
AYE61078.1|519337_520240_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AYE61079.1|520356_520692_-	putative tropomyosin	NA	NA	NA	NA	NA
AYE61080.1|520701_521139_-	histidine triad (HIT) family protein	NA	D7NW73	Streptomyces_phage	34.9	5.4e-09
AYE61081.1|521350_521605_+	RelE family toxin-antitoxin system	NA	NA	NA	NA	NA
AYE61082.1|521634_521970_+	XRE family transcription regulator	NA	NA	NA	NA	NA
AYE61083.1|521984_522728_+	putative ABC transporter	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.7e-21
AYE61084.1|522720_523908_+	putative ABC transporter	NA	NA	NA	NA	NA
AYE61085.1|523919_524573_+	methyltransferase	NA	NA	NA	NA	NA
AYE61086.1|524642_524963_+	thioredoxin	NA	NA	NA	NA	NA
AYE61087.1|524982_525630_+|tRNA	Phenylalanine--tRNA ligase beta subunit	tRNA	NA	NA	NA	NA
AYE61088.1|525681_526989_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61089.1|527134_527476_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61090.1|527784_528396_-	Transposase ISLhe15	NA	NA	NA	NA	NA
AYE61091.1|528577_528775_+	permease protein	NA	NA	NA	NA	NA
AYE61092.1|528882_529491_+|transposase	transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	3.0e-34
AYE61093.1|529520_530855_+|transposase	transposase	transposase	G3MB42	Bacillus_virus	35.3	1.3e-50
AYE61094.1|531026_531617_+	permease	NA	NA	NA	NA	NA
AYE61095.1|531954_536925_+	peptidase S8	NA	A0A2P0VP02	Tetraselmis_virus	27.3	2.6e-06
AYE61096.1|537021_538302_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.8	3.9e-47
AYE61097.1|538907_539117_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	53.2	6.8e-10
AYE61098.1|539537_540260_-|integrase	DNA integrase	integrase	NA	NA	NA	NA
AYE61099.1|540579_540960_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61100.1|540994_541627_-	putative aggregation promoting protein	NA	A0A0E3XCL7	Enterococcus_phage	62.2	4.1e-18
AYE61101.1|541925_542102_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61102.1|542200_542779_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61103.1|542933_544247_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AYE61104.1|544301_545279_-	putative surface protein	NA	NA	NA	NA	NA
AYE61105.1|545377_546892_-	aminopeptidase N	NA	NA	NA	NA	NA
AYE61106.1|547029_548007_+	Bacteriocin helveticin J	NA	NA	NA	NA	NA
AYE61107.1|548474_549332_+|transposase	transposase, IS4 family protein	transposase	NA	NA	NA	NA
AYE61108.1|549389_549704_+	putative DNA-damage-inducible protein	NA	NA	NA	NA	NA
AYE61109.1|549721_550603_+|protease	Membrane protease subunit, stomatin/prohibitin family	protease	NA	NA	NA	NA
AYE61110.1|550747_551131_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61111.1|551619_551904_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE61112.1|551982_552483_-	Transposase IS1201	NA	NA	NA	NA	NA
AYE61113.1|552538_552700_-|transposase	transposase IS1201	transposase	NA	NA	NA	NA
555732:555749	attR	GCTTTAGCTAATATTCAA	NA	NA	NA	NA
>prophage 8
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	571089	619933	2082741	integrase,tRNA,transposase	Tupanvirus(27.27%)	52	618522:618549	625363:625390
AYE61130.1|571089_573024_+|tRNA	theronyl-tRNA synthetase	tRNA	A0A2K9L297	Tupanvirus	33.2	3.6e-97
AYE61131.1|573291_574116_-|transposase	transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	23.4	1.9e-07
AYE61132.1|574155_574278_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE61133.1|574898_575255_+	translational initiation factor IF3	NA	NA	NA	NA	NA
AYE61134.1|575276_575477_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AYE61135.1|575520_575877_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AYE61136.1|576022_576547_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61137.1|576539_577649_+	GTP-binding protein YqeH	NA	NA	NA	NA	NA
AYE61138.1|577659_578316_+	Nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AYE61139.1|578296_578890_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61140.1|578911_579259_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61141.1|579264_580416_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61142.1|580417_580972_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61143.1|581134_581851_+	two-component system regulator	NA	W8CYM9	Bacillus_phage	30.1	1.8e-25
AYE61144.1|581837_583397_+	two-component sensor	NA	Q8QNA2	Ectocarpus_siliculosus_virus	32.2	3.2e-11
AYE61145.1|583433_583922_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61146.1|583969_584932_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61147.1|584978_585251_-	acylphosphate phosphohydrolase	NA	NA	NA	NA	NA
AYE61148.1|585348_586116_+	rRNA methylase	NA	NA	NA	NA	NA
AYE61149.1|586227_586578_+	putative transcription regulator	NA	NA	NA	NA	NA
AYE61150.1|586862_587912_+|tRNA	phenylalanyl-tRNA synthetase alpha chain	tRNA	A0A2K9L3A8	Tupanvirus	37.3	5.3e-34
AYE61151.1|587915_590330_+|tRNA	phenylalanyl-tRNA synthetase beta chain	tRNA	NA	NA	NA	NA
AYE61152.1|590406_590883_+	transcription elongation	NA	NA	NA	NA	NA
AYE61153.1|590945_591860_+	L-2-hydroxyisocaproate dehydrogenase	NA	NA	NA	NA	NA
AYE61154.1|592380_592653_+	putative transcriptional regulator	NA	NA	NA	NA	NA
AYE61155.1|592708_594103_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	41.9	7.0e-50
AYE61156.1|594186_595110_-	BadF/BadG/BcrA/BcrD ATPase family protein	NA	NA	NA	NA	NA
AYE61157.1|595216_597808_-	putative ABC transporter	NA	NA	NA	NA	NA
AYE61158.1|597898_600007_+	penicillin-binding protein	NA	NA	NA	NA	NA
AYE61159.1|600083_600233_+	50S ribosomal protein l33	NA	NA	NA	NA	NA
AYE61160.1|600295_600856_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AYE61161.1|600876_601557_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61162.1|601557_601785_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61163.1|601843_602245_+	putative rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
AYE61164.1|602323_603244_+|tRNA	tRNA delta(2)-isopentenylpyrophosphate transferase	tRNA	NA	NA	NA	NA
AYE61165.1|603308_603728_+	DDE endonuclease	NA	NA	NA	NA	NA
AYE61166.1|604446_604875_+	aluminum resistance protein	NA	NA	NA	NA	NA
AYE61167.1|605003_606341_+	glutamine synthetase	NA	NA	NA	NA	NA
AYE61168.1|606680_607028_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE61169.1|607082_607298_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE61170.1|607272_608610_+|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	26.7	1.3e-37
AYE61171.1|608715_609585_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61172.1|609722_610628_+	putative ABC transporter	NA	NA	NA	NA	NA
AYE61173.1|610725_611736_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61174.1|611802_612288_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	46.5	1.2e-33
AYE61175.1|612364_612748_-	Transposase domain protein	NA	NA	NA	NA	NA
AYE61176.1|612856_613201_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE61177.1|613311_614304_-	UDP-galactose 4-epimerase	NA	A0A2K9L1R4	Tupanvirus	39.9	1.1e-52
AYE61178.1|614408_615365_-	beta-galactosidase small subunit	NA	NA	NA	NA	NA
AYE61179.1|615348_617235_-	LacL	NA	L0N6M2	Herpes_simplex_virus	33.5	1.8e-93
AYE61180.1|617461_618469_+	LacI family transcription regulator	NA	NA	NA	NA	NA
618522:618549	attL	AATGAACTGAGACCTAAAAATTAGACAG	NA	NA	NA	NA
AYE61181.1|618550_619933_-|integrase	DNA integrase	integrase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AYE61181.1|618550_619933_-|integrase	DNA integrase	integrase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
625363:625390	attR	AATGAACTGAGACCTAAAAATTAGACAG	NA	NA	NA	NA
>prophage 9
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	625391	668101	2082741	transposase	Synechococcus_phage(18.18%)	40	NA	NA
AYE61188.1|625391_626024_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	51.5	7.0e-50
AYE61189.1|626564_626690_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYE61190.1|626908_627862_+	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
AYE61191.1|627998_629144_+	permease	NA	NA	NA	NA	NA
AYE61192.1|629159_629534_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AYE61193.1|629565_629904_+	3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	35.1	1.3e-10
AYE61194.1|630294_631956_+	formate-tetrahydrofolate ligase	NA	NA	NA	NA	NA
AYE61195.1|631966_632455_+	hypothetical protein	NA	A0A2P0VNU7	Tetraselmis_virus	45.1	4.8e-22
AYE61196.1|632438_633584_+	phosphoribosylaminoimidazole carboxylase	NA	NA	NA	NA	NA
AYE61197.1|633779_634496_+	phosphoribosylaminoimidazole-succinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	37.4	2.8e-39
AYE61198.1|634495_634747_+	putative phosphoribosylformylglycinamidine	NA	NA	NA	NA	NA
AYE61199.1|634746_635418_+	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
AYE61200.1|635414_637646_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	38.9	7.8e-144
AYE61201.1|637621_639055_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.3	3.1e-61
AYE61202.1|639080_640130_+	phosphoribosylaminoimidazole synthetase	NA	A0A0E3F0L1	Synechococcus_phage	43.9	9.2e-63
AYE61203.1|640126_642262_+	phosphoribosylaminoimidazolecarboxamide formyltransferase	NA	Q58MG4	Prochlorococcus_phage	46.3	9.6e-75
AYE61204.1|642274_643531_+	phosphoribosylamine-glycine ligase	NA	NA	NA	NA	NA
AYE61205.1|644100_644580_+	RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AYE61206.1|644610_645567_-	ABC transport protein permease component	NA	NA	NA	NA	NA
AYE61207.1|645572_646721_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYE61208.1|646701_648246_-	ABC transporter	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	2.0e-18
AYE61209.1|648314_649400_-	putative lipoprotein A-antigen precursor	NA	A0A0A7DN02	Lactobacillus_phage	47.5	3.0e-77
AYE61210.1|649547_650186_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE61211.1|650298_650880_+	Transposase ISLhe15	NA	NA	NA	NA	NA
AYE61212.1|651035_652265_+	permease	NA	NA	NA	NA	NA
AYE61213.1|652380_653718_-|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	26.7	1.3e-37
AYE61214.1|653692_653908_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE61215.1|653962_654310_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE61216.1|654606_656463_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61217.1|656996_657803_+	oligopeptide ABC transporter binding protein	NA	NA	NA	NA	NA
AYE61218.1|658622_659171_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61219.1|659173_659608_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61220.1|659832_660051_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AYE61221.1|660431_661838_+	Transposase ISLhe15	NA	NA	NA	NA	NA
AYE61222.1|662552_663719_+	galactokinase	NA	NA	NA	NA	NA
AYE61223.1|663740_665207_+	peptidase S24	NA	NA	NA	NA	NA
AYE61224.1|665326_666322_+	galactose-1-epimerase	NA	NA	NA	NA	NA
AYE61225.1|666557_666923_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61226.1|666979_667579_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61227.1|667741_668101_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	683882	718335	2082741	transposase	unidentified_phage(20.0%)	32	NA	NA
AYE61246.1|683882_684242_-|transposase	transposase	transposase	H7BWC8	unidentified_phage	41.1	9.5e-20
AYE61247.1|684225_684930_-|transposase	transposase	transposase	Q9MBM9	Staphylococcus_prophage	31.3	9.6e-24
AYE61248.1|685042_685672_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
AYE61249.1|686073_687174_+	MFS transporter	NA	M1Q1P2	Streptococcus_phage	46.8	3.4e-92
AYE61250.1|687161_688328_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	46.7	1.7e-97
AYE61251.1|688495_688810_+	chaperone transmembrane protein	NA	NA	NA	NA	NA
AYE61252.1|688894_689437_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AYE61253.1|689565_690348_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE61254.1|691053_692097_-|transposase	transposase	transposase	H7BUM7	unidentified_phage	31.9	2.2e-40
AYE61255.1|692301_693471_+	MFS transporter	NA	NA	NA	NA	NA
AYE61256.1|693722_693989_+|transposase	transposase, ISSmi4	transposase	NA	NA	NA	NA
AYE61257.1|694394_694928_+	surface layer protein	NA	NA	NA	NA	NA
AYE61258.1|695251_696997_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYE61259.1|697095_697263_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61260.1|697253_697385_+	Xre family toxin-antitoxin system	NA	NA	NA	NA	NA
AYE61261.1|697409_698570_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	47.3	2.7e-55
AYE61262.1|698840_700013_+	Permease of the major facilitator superfamily	NA	NA	NA	NA	NA
AYE61263.1|700430_700709_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61264.1|700746_700989_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61265.1|701464_702781_-	chloride channel protein	NA	NA	NA	NA	NA
AYE61266.1|702903_705528_-	Cation-transporting ATPase PacL	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.6	4.0e-83
AYE61267.1|706110_706698_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AYE61268.1|706694_707267_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AYE61269.1|707964_708588_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	30.3	9.1e-26
AYE61270.1|708589_709294_-	orotidine 5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AYE61271.1|709549_710473_+	dihydroorotate dehydrogenase 1B	NA	NA	NA	NA	NA
AYE61272.1|710639_711182_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AYE61273.1|711326_712283_+	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	34.8	8.2e-26
AYE61274.1|712282_713560_+	dihydroorotase	NA	NA	NA	NA	NA
AYE61275.1|713559_714645_+	Carbamoyl-phosphate synthase, small subunit	NA	R4TGJ8	Halovirus	35.5	6.6e-56
AYE61276.1|714637_717826_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AYE61277.1|718038_718335_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	779752	824817	2082741	tRNA,transposase,protease	Streptococcus_phage(14.29%)	43	NA	NA
AYE61337.1|779752_780466_+|transposase	transposase	transposase	H7BWC8	unidentified_phage	36.5	8.0e-26
AYE61338.1|780580_780922_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61339.1|780926_782357_+	Signal recognition protein Ffh	NA	D6PHS7	uncultured_phage	27.0	1.4e-05
AYE61340.1|782446_782719_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYE61341.1|782787_783303_+	16S rRNA-processing protein RimM	NA	NA	NA	NA	NA
AYE61342.1|783292_784012_+|tRNA	tRNA (guanine-1) -methyltransferase	tRNA	NA	NA	NA	NA
AYE61343.1|784094_784472_+	ribosomal protein L19	NA	NA	NA	NA	NA
AYE61344.1|784860_785175_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
AYE61345.1|785525_786311_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AYE61346.1|786339_786966_-	LexA family transcriptional regulator	NA	A0A1B2APZ1	Phage_Wrath	53.6	8.9e-13
AYE61347.1|787116_787380_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61348.1|787442_787661_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61349.1|787959_789189_-|transposase	transposase	transposase	A0A1X9I619	Streptococcus_phage	38.4	1.8e-65
AYE61350.1|789426_789633_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE61351.1|789814_790282_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	34.8	4.1e-15
AYE61352.1|791708_792599_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	41.6	1.9e-24
AYE61353.1|792588_794370_+	ABC transporter ATP-binding protein/permease	NA	A0A1V0SE00	Indivirus	31.0	1.4e-23
AYE61354.1|794477_796421_+	peptidase M13	NA	NA	NA	NA	NA
AYE61355.1|796478_797660_-	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	36.1	4.7e-47
AYE61356.1|797719_798334_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AYE61357.1|798399_799431_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61358.1|799592_800366_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
AYE61359.1|800399_801425_+	elongation factor Ts	NA	NA	NA	NA	NA
AYE61360.1|801563_802289_+	uridylate kinase	NA	NA	NA	NA	NA
AYE61361.1|802288_802846_+	ribosome recycling factor	NA	NA	NA	NA	NA
AYE61362.1|802848_803583_+	undecaprenyl pyrophosphate synthetase	NA	R9W0U9	Flavobacterium_phage	39.0	2.5e-22
AYE61363.1|803584_804400_+	phosphatidate cytidylyltransferase	NA	A0A2K9L268	Tupanvirus	31.4	3.0e-05
AYE61364.1|804410_805667_+|protease	zinc metalloprotease	protease	NA	NA	NA	NA
AYE61365.1|805709_807407_+|tRNA	prolyl-tRNA synthetase	tRNA	NA	NA	NA	NA
AYE61366.1|807412_811723_+	DNA polymerase III alpha subunit	NA	Q8W6C3	Saccharomonospora_phage	22.5	3.9e-27
AYE61367.1|811832_812309_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61368.1|812298_813510_+	transcription elongation factor NusA	NA	NA	NA	NA	NA
AYE61369.1|813510_813816_+	DNA-binding protein	NA	NA	NA	NA	NA
AYE61370.1|813818_814130_+	L7A family ribosomal protein	NA	NA	NA	NA	NA
AYE61371.1|814134_816747_+	translation initiation factor InfB	NA	A0A2H4UTS4	Bodo_saltans_virus	24.5	9.7e-21
AYE61372.1|816766_817132_+	ribosome-binding factor A	NA	NA	NA	NA	NA
AYE61373.1|817183_818077_+|tRNA	tRNA pseudouridine synthase B	tRNA	NA	NA	NA	NA
AYE61374.1|818082_819045_+	riboflavin kinase	NA	NA	NA	NA	NA
AYE61375.1|819214_820264_+	Heat-inducible transcription repressor hrcA	NA	NA	NA	NA	NA
AYE61376.1|820279_820879_+	heat shock protein GrpE	NA	NA	NA	NA	NA
AYE61377.1|820896_822696_+	chaperone protein DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	5.3e-143
AYE61378.1|822777_823932_+	heat shock protein DNAJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	32.9	1.9e-21
AYE61379.1|824520_824817_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	832007	879154	2082741	tail,integrase,terminase,head,transposase	Lactobacillus_phage(42.86%)	58	830002:830017	864312:864327
830002:830017	attL	ATCCAAAGAAGCAACC	NA	NA	NA	NA
AYE61386.1|832007_833399_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE61387.1|833464_834259_-	homoserine o-succinyltransferase	NA	NA	NA	NA	NA
AYE61388.1|835420_835873_-	cardiolipin synthase	NA	NA	NA	NA	NA
AYE61389.1|836015_836513_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61390.1|836580_838854_-	cation transport ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	24.4	5.5e-44
AYE61391.1|838982_839837_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYE61392.1|840721_841150_+	arginine deiminase	NA	NA	NA	NA	NA
AYE61393.1|841397_842006_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AYE61394.1|842200_842623_+	carbamate kinase	NA	NA	NA	NA	NA
AYE61395.1|843149_843686_+	apo-citrate lyase	NA	NA	NA	NA	NA
AYE61396.1|843806_844973_+	putative acetyltransferase	NA	NA	NA	NA	NA
AYE61397.1|844988_845150_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61398.1|845152_845758_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61399.1|845980_846952_+|transposase	transposase	transposase	H7BUM7	unidentified_phage	32.9	1.8e-44
AYE61400.1|846962_847352_-	putative temperature-sensitive replication protein	NA	NA	NA	NA	NA
AYE61401.1|847663_848878_-|integrase	integrase	integrase	F8J1D8	Lactobacillus_phage	32.7	1.5e-45
AYE61402.1|849229_849898_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61403.1|850054_850342_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61404.1|850835_851483_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61405.1|851535_851814_-	repressor	NA	E9LUL3	Lactobacillus_phage	36.9	6.7e-05
AYE61406.1|851980_852364_-	transcriptional regulator	NA	J7KJ52	Streptococcus_phage	56.9	4.7e-17
AYE61407.1|852532_852706_+	Cro-like protein phage associated	NA	L0P7D3	Lactobacillus_phage	80.7	5.1e-19
AYE61408.1|853039_853885_+	prophage antirepressor	NA	Q38330	Lactococcus_phage	46.6	4.1e-61
AYE61409.1|853897_854140_+	hypothetical protein	NA	Q9T1I6	Lactobacillus_phage	37.1	1.3e-07
AYE61410.1|854152_854323_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61411.1|854553_854733_+	hypothetical protein	NA	L0P6F4	Lactobacillus_phage	47.5	1.4e-08
AYE61412.1|854747_854909_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61413.1|854963_855527_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61414.1|855539_855911_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61415.1|855931_856813_+	prophage replication protein	NA	A0A1S5SE30	Streptococcus_phage	25.5	6.6e-06
AYE61416.1|856815_857613_+	prophage replication protein	NA	Q6SE93	Lactobacillus_prophage	46.7	1.5e-57
AYE61417.1|857638_858385_+	hypothetical protein	NA	Q9AZA0	Lactobacillus_prophage	71.1	2.2e-63
AYE61418.1|858381_858555_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61419.1|858590_858788_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61420.1|858774_858999_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61421.1|858985_859240_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61422.1|859253_859565_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61423.1|859579_859747_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61424.1|859743_859992_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61425.1|860039_860543_+	ArpU family transcriptional regulator	NA	B8R690	Lactobacillus_phage	38.2	2.3e-11
AYE61426.1|861578_861788_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61427.1|861897_862410_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61428.1|862402_863860_+|terminase	terminase	terminase	A5GYP8	Lactococcus_phage	47.6	5.1e-120
AYE61429.1|863872_865357_+	hypothetical protein	NA	A8ATG1	Listeria_phage	31.6	1.3e-46
864312:864327	attR	ATCCAAAGAAGCAACC	NA	NA	NA	NA
AYE61430.1|865334_866111_+|head	SPP1 gp7 family phage head morphogenesis protein	head	A9DEG6	Yersinia_phage	27.8	1.5e-17
AYE61431.1|866123_866513_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61432.1|866584_867664_+	hypothetical protein	NA	D6PSX5	Lactobacillus_phage	45.6	4.7e-30
AYE61433.1|867663_868212_+	hypothetical protein	NA	D6PSX6	Lactobacillus_phage	33.8	7.0e-14
AYE61434.1|868214_869192_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61435.1|869191_869587_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61436.1|869583_870120_+	hypothetical protein	NA	A0A1L2JY56	Aeribacillus_phage	32.3	1.4e-19
AYE61437.1|870132_870528_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61438.1|870511_871075_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61439.1|871074_872337_+	hypothetical protein	NA	A8ATH2	Listeria_phage	36.2	2.4e-49
AYE61440.1|872351_872777_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61441.1|872825_873305_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61442.1|873339_873495_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61443.1|873574_879154_+|tail	phage tail tape measure protein	tail	A0A0A7DMV4	Lactobacillus_phage	30.7	8.5e-107
>prophage 13
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	895573	930784	2082741	tRNA,transposase	Streptococcus_phage(20.0%)	38	NA	NA
AYE61465.1|895573_896017_+|tRNA	Glutaminyl-tRNA synthase b subunit	tRNA	A0A0K2FLI9	Brevibacillus_phage	35.2	2.2e-10
AYE61466.1|896042_897002_+	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	46.1	1.7e-47
AYE61467.1|897004_897529_+	rRNA maturation factor	NA	NA	NA	NA	NA
AYE61468.1|897528_898434_+	GTP-binding protein Era	NA	NA	NA	NA	NA
AYE61469.1|898434_899187_+	DNA recombination and repair protein RecO	NA	NA	NA	NA	NA
AYE61470.1|899440_900358_+|tRNA	glycyl-tRNA synthetase subunit alpha	tRNA	NA	NA	NA	NA
AYE61471.1|900350_902414_+|tRNA	glycyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AYE61472.1|902439_904275_+	DNA primase	NA	A0A1S5RH70	Helicobacter_phage	28.2	7.3e-39
AYE61473.1|904291_905404_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	37.6	2.4e-37
AYE61474.1|905522_906803_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.8	3.9e-47
AYE61475.1|907027_908365_-|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	26.7	1.3e-37
AYE61476.1|908339_908555_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE61477.1|908609_908957_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE61478.1|909208_909853_-	Enterolysin A	NA	NA	NA	NA	NA
AYE61479.1|909989_910214_-	MutT/NUDIX family protein	NA	NA	NA	NA	NA
AYE61480.1|910352_911039_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYE61481.1|911031_911829_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61482.1|911848_913090_+	tripeptidase T PepT	NA	NA	NA	NA	NA
AYE61483.1|913363_913711_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYE61484.1|913729_914437_+	ABC transporter ATP binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	2.8e-15
AYE61485.1|914436_915282_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61486.1|915726_916107_+	ABC transporter permease	NA	NA	NA	NA	NA
AYE61487.1|916129_916567_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61488.1|916714_917956_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.2	2.8e-119
AYE61489.1|918960_919617_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	35.3	1.3e-30
AYE61490.1|919613_919805_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61491.1|919949_920807_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE61492.1|920803_920974_-	Malonyl-CoA-(acyl-carrier-protein)transacylase	NA	NA	NA	NA	NA
AYE61493.1|921574_921934_-	toxin MazF	NA	NA	NA	NA	NA
AYE61494.1|921937_922207_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61495.1|922345_923758_+	DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	26.2	1.8e-05
AYE61496.1|923980_924325_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE61497.1|924545_925403_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE61498.1|925581_926973_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE61499.1|927046_927616_-	signal peptidase I	NA	NA	NA	NA	NA
AYE61500.1|927701_928454_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYE61501.1|928443_929427_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61502.1|929401_930784_+|tRNA	tRNA and rRNA cytosine-C5-methylase	tRNA	NA	NA	NA	NA
>prophage 14
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	945400	1000733	2082741	integrase,tRNA,transposase	uncultured_virus(11.76%)	52	945467:945482	1006788:1006803
AYE61511.1|945400_946699_+|tRNA	asparaginyl-tRNA synthetase-like protein	tRNA	A0A2P1EMB4	Moumouvirus	27.3	1.0e-47
945467:945482	attL	TGGTTAACAGATAAAA	NA	NA	NA	NA
AYE61512.1|946784_947429_+	chromosome replication initiation protein dnaD	NA	A0A0N7AE27	Bacillus_phage	36.0	4.2e-10
AYE61513.1|947430_948051_+	endonuclease III	NA	NA	NA	NA	NA
AYE61514.1|948263_950561_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
AYE61515.1|950557_951190_-	recombinase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	37.1	1.5e-20
AYE61516.1|951253_951823_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61517.1|951913_952330_+	Cell division initiation protein	NA	NA	NA	NA	NA
AYE61518.1|952791_953916_+	putative DNA methylase	NA	NA	NA	NA	NA
AYE61519.1|953992_954574_+	3',5'-cyclic-nucleotide phosphodiesterase	NA	NA	NA	NA	NA
AYE61520.1|955498_957175_+	formate-tetrahydrofolate ligase	NA	NA	NA	NA	NA
AYE61521.1|957181_957646_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
AYE61522.1|957638_958550_+	Pseudouridine synthase	NA	NA	NA	NA	NA
AYE61523.1|958552_959608_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
AYE61524.1|959611_962803_+	Carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AYE61525.1|962870_964565_-	fibronectin-binding protein	NA	Q84500	Paramecium_bursaria_Chlorella_virus	40.0	3.2e-09
AYE61526.1|964713_965130_+	L-fucose operon regulator	NA	NA	NA	NA	NA
AYE61527.1|965204_965618_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.9	1.0e-09
AYE61528.1|966256_967339_-|integrase	Phage integrase family site-specific recombinase	integrase	NA	NA	NA	NA
AYE61529.1|967853_968309_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61530.1|968876_969485_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61531.1|969691_970048_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61532.1|970669_970972_-	gametolysin	NA	Q6SEB5	Lactobacillus_prophage	56.6	1.6e-23
AYE61533.1|971879_972089_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61534.1|972717_973017_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE61535.1|973139_973355_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE61536.1|973329_974667_+|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	26.7	1.0e-37
AYE61537.1|975681_976032_-	ABC superfamily ATP binding cassette transporter, ABC protein	NA	NA	NA	NA	NA
AYE61538.1|976712_977066_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYE61539.1|977094_977679_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0S9I2	Catovirus	44.6	6.3e-29
AYE61540.1|977763_978699_-	Inorganic diphosphatase PpaC	NA	NA	NA	NA	NA
AYE61541.1|978731_979694_-	Putative transcriptional regulator	NA	NA	NA	NA	NA
AYE61542.1|979844_982301_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.3	3.0e-96
AYE61543.1|982317_984279_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.0	2.7e-116
AYE61544.1|984360_984987_+	Glycerol-3-phosphate acyltransferase 2	NA	NA	NA	NA	NA
AYE61545.1|985292_987041_-	Snf2 family protein	NA	A0A0P0YMN2	Yellowstone_lake_phycodnavirus	25.8	4.7e-27
AYE61546.1|987284_987743_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61547.1|987976_988444_-	stress induced DNA-binding protein	NA	A0A291I9P0	Lactobacillus_phage	30.1	1.3e-13
AYE61548.1|988532_989051_-	acetyltransferase	NA	M1PSC3	Streptococcus_phage	38.4	5.1e-22
AYE61549.1|989265_990126_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61550.1|990118_990808_+	Sir2 silent information regulator family NAD-dependent deacetylase	NA	NA	NA	NA	NA
AYE61551.1|990862_991465_+	Sir2 silent information regulator family NAD-dependent deacetylase	NA	NA	NA	NA	NA
AYE61552.1|991687_991954_+	transcriptional regulator	NA	NA	NA	NA	NA
AYE61553.1|992178_992448_-	Transposase, IS4 family	NA	NA	NA	NA	NA
AYE61554.1|993391_994570_-|transposase	transposase IS1201	transposase	A0A220NQR7	Corynebacterium_phage	29.5	8.8e-38
AYE61555.1|994685_995171_-	Putative tyrosine family DNA recombinase	NA	NA	NA	NA	NA
AYE61556.1|995285_995924_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61557.1|996235_996796_-	DNA methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	44.9	2.2e-39
AYE61558.1|996860_997892_-|transposase	transposase	transposase	A0A0C5AC89	Paenibacillus_phage	39.2	1.8e-34
AYE61559.1|998129_998495_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE61560.1|998803_999151_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE61561.1|999205_999421_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE61562.1|999395_1000733_+|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	26.7	1.3e-37
1006788:1006803	attR	TTTTATCTGTTAACCA	NA	NA	NA	NA
>prophage 15
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	1005088	1120915	2082741	integrase,bacteriocin,transposase	Bacillus_phage(17.86%)	116	1069782:1069841	1094050:1095600
AYE61568.1|1005088_1005457_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE61569.1|1006134_1006302_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
AYE61570.1|1006335_1006872_-	NUDIX family hydrolase	NA	NA	NA	NA	NA
AYE61571.1|1006883_1007975_-	dihydropteroate synthase	NA	NA	NA	NA	NA
AYE61572.1|1007964_1009302_-	folylpolyglutamate synthase	NA	NA	NA	NA	NA
AYE61573.1|1009285_1010359_-	GTP cyclohydrolase	NA	A0A2I7S8W4	Vibrio_phage	40.7	5.4e-34
AYE61574.1|1010355_1010706_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AYE61575.1|1011145_1011799_+	deoxyribonuclease	NA	NA	NA	NA	NA
AYE61576.1|1012054_1013437_-|integrase	DNA integrase	integrase	A0A1B1P773	Bacillus_phage	46.7	2.4e-58
AYE61577.1|1013772_1014210_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61578.1|1014211_1014625_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61579.1|1014660_1015158_-	acetyltransferase	NA	NA	NA	NA	NA
AYE61580.1|1015287_1016466_-|transposase	transposase IS1201	transposase	A0A220NQR7	Corynebacterium_phage	29.5	8.8e-38
AYE61581.1|1016695_1017460_-	putative ATPase	NA	NA	NA	NA	NA
AYE61582.1|1017635_1017959_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61583.1|1018060_1018234_+	transcriptional regulator	NA	NA	NA	NA	NA
AYE61584.1|1018269_1021008_-	phosphoenolpyruvate carboxykinase	NA	NA	NA	NA	NA
AYE61585.1|1021621_1022260_-	penicillin-binding protein	NA	NA	NA	NA	NA
AYE61586.1|1022343_1023747_+	dipeptidase V PepV	NA	NA	NA	NA	NA
AYE61587.1|1023800_1025036_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	46.5	7.0e-54
AYE61588.1|1025084_1026464_-	branched-chain amino acid transporter II carrier protein	NA	NA	NA	NA	NA
AYE61589.1|1026846_1027182_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61590.1|1027199_1027700_+	PLP-dependent protein	NA	NA	NA	NA	NA
AYE61591.1|1027769_1028147_+	PLP-dependent aminotransferase	NA	NA	NA	NA	NA
AYE61592.1|1028211_1028451_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61593.1|1028562_1029114_-	membrane protein	NA	NA	NA	NA	NA
AYE61594.1|1029248_1029479_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61595.1|1029635_1030169_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	23.9	6.0e-10
AYE61596.1|1030654_1030972_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	70.7	4.4e-37
AYE61597.1|1031016_1031739_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	41.8	1.6e-37
AYE61598.1|1031794_1031992_-	pyridine mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	76.4	3.2e-17
AYE61599.1|1032058_1033306_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61600.1|1033658_1034387_-	Amino acid transport protein	NA	NA	NA	NA	NA
AYE61601.1|1034754_1035609_-	homocysteine methyltransferase	NA	NA	NA	NA	NA
AYE61602.1|1036019_1037402_+|integrase	DNA integrase	integrase	A0A1B1P773	Bacillus_phage	46.7	6.9e-58
AYE61603.1|1037448_1038636_-	amidohydrolase	NA	NA	NA	NA	NA
AYE61604.1|1038667_1039999_-	serine/threonine exchanger SteT	NA	NA	NA	NA	NA
AYE61605.1|1040294_1040660_-	pyridoxine 5'-phosphate oxidase V related favin-nucleotide-binding protein	NA	NA	NA	NA	NA
AYE61606.1|1040856_1042803_+	endopeptidase O2	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.3	8.8e-59
AYE61607.1|1043028_1045509_+	5-nucleotidase/2,3-cyclic phosphodiesterase related esterase	NA	NA	NA	NA	NA
AYE61608.1|1045739_1046825_-	putative type IV restriction endonuclease	NA	NA	NA	NA	NA
AYE61609.1|1047226_1048186_-	ATPase	NA	NA	NA	NA	NA
AYE61610.1|1049386_1049716_-|transposase	transposase	transposase	A0A286QMQ9	Streptococcus_phage	46.1	1.3e-18
AYE61611.1|1049740_1050109_-|transposase	transposase	transposase	A0A7E5	Microcystis_virus	47.6	1.8e-05
AYE61612.1|1050149_1050626_-|transposase	transposase	transposase	Q332I1	Clostridium_botulinum_C_phage	30.9	2.7e-06
AYE61613.1|1051124_1051616_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61614.1|1051608_1052427_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61615.1|1052429_1053695_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61616.1|1054133_1054289_+	putative DDE endonuclease	NA	NA	NA	NA	NA
AYE61617.1|1054251_1054554_+	DDE endonuclease	NA	NA	NA	NA	NA
AYE61618.1|1054982_1058006_-	Type I restriction-modification system, restriction subunit	NA	NA	NA	NA	NA
AYE61619.1|1058135_1059230_+	type IC specificity subunit	NA	NA	NA	NA	NA
AYE61620.1|1059260_1060190_-|integrase	Phage integrase	integrase	A8ATM2	Listeria_phage	51.0	1.4e-86
AYE61621.1|1060255_1061476_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61622.1|1061468_1063124_-	Type I restriction-modification system modification subunit	NA	A0A2H4PQP4	Staphylococcus_phage	46.2	6.9e-113
AYE61623.1|1063459_1064143_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	61.1	4.7e-68
AYE61624.1|1064129_1064672_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.6	1.0e-41
AYE61625.1|1064758_1065505_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61626.1|1065505_1066414_-	restriction endonuclease	NA	NA	NA	NA	NA
AYE61627.1|1066466_1066838_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61628.1|1066837_1067407_-	Peptide methionine sulfoxide reductase msrA	NA	NA	NA	NA	NA
AYE61629.1|1067569_1068007_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61630.1|1068155_1069751_+	hypothetical protein	NA	NA	NA	NA	NA
1069782:1069841	attL	ACTTAAACTTCCCACACCAAAAAGAACTATGAAGCCTTGAAAACTCAATAGTTTAGCCAG	NA	NA	NA	NA
AYE61631.1|1070234_1070663_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE61632.1|1070715_1071192_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61633.1|1071624_1073139_-	ABC transport protein ATP-binding component	NA	A0A2I4R674	Erysipelothrix_phage	24.5	6.7e-22
AYE61634.1|1073462_1073891_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61635.1|1073887_1074322_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61636.1|1074481_1075864_-|integrase	DNA integrase	integrase	A0A1B1P773	Bacillus_phage	46.7	6.9e-58
AYE61637.1|1076173_1076875_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.3	1.5e-69
AYE61638.1|1076990_1077503_-	nucleoside-triphosphatase	NA	NA	NA	NA	NA
AYE61639.1|1077793_1078006_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61640.1|1078089_1080594_-	excinuclease ABC subunit A-like protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.0	7.9e-137
AYE61641.1|1080609_1081122_-	Streptothricine-acetyl-transferase	NA	NA	NA	NA	NA
AYE61642.1|1081358_1081754_-	regulatory protein	NA	NA	NA	NA	NA
AYE61643.1|1082797_1083415_-|integrase	DNA integrase	integrase	A0A2I6AZV9	Macacine_betaherpesvirus	51.5	4.4e-49
AYE61644.1|1083540_1085730_-|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	5.9e-88
AYE61645.1|1086342_1086834_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61646.1|1086943_1087303_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61647.1|1087693_1088317_-	MutT/NUDIX family protein	NA	NA	NA	NA	NA
AYE61648.1|1088319_1089081_-	uridine phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	45.3	1.1e-36
AYE61649.1|1089096_1089516_-	cytidine deaminase	NA	NA	NA	NA	NA
AYE61650.1|1089780_1090242_-	GNAT family acetyltraansferase	NA	NA	NA	NA	NA
AYE61651.1|1090429_1090747_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61652.1|1090807_1091518_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61653.1|1091607_1091931_+	putative permease	NA	NA	NA	NA	NA
AYE61654.1|1092698_1093175_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61655.1|1093227_1093656_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE61656.1|1094139_1094721_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61657.1|1094850_1095168_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61658.1|1095684_1096131_-	hypothetical protein	NA	NA	NA	NA	NA
1094050:1095600	attR	CTGGCTAAACTATTGAGTTTTCAAGGCTTCATAGTTCTTTTTGGTGTGGGAAGTTTAAGTTGAGATTAAATTTAAGAAAAGAGAATAAATATGAAAAAAGCGATTGTTTTAATCAGTGTAATGGCTGCTGCGCTATTGACGGGATGCAATAAGCAAACAGCAAAATCAAATTTAAGTTCACAATCATCAAGTAGTTCAAAAATTGTACGTCATGAGACTAAATCATCTAGTGAAGCTCCTCGCATTAATATTCATAAAAAATATAAGGGCTTTAAACTTGCAACTGTACCTAGCCAGTACCGTGGTACCTGGTATCGCGGCGATCCTTATTCTAAAAAGGCTAGAAAACTCGTGATTACTGAGCACACGGTTAACGGCAATGTCACTTATCAAAAAGTTGATCCAAATTTAAAATTGAATCGTCACTCTGAAAAACAAAATAAAAAATACTCTGGCAATATTGTTCTAATTGATACTCAAGGTAATTCGTTAAAAGTGCGCGGCTTCTTGGATCTGGTGAACTTAGATTATCAACCTGGTCAATTTAAGAACCATGATTGTCTCTTCTTAAGCTATGGGACTGATCCTAGTGTCATCAACGGTGCGATTTTTATGGATAAAAATGTTGCACTTAAATATAGAAAGTATGATTTTACTAAGGTAAAGAAATAGTAAACTATTTTACCAATAAACGGCTGGACAAATCATTTAATTTCTTTAGCTATTTCACGATACTAACAAATAAAAGGTCTCTTAGAAAGTTAATGTCTTTCTGGGAGACCTTTATATTTGCTATACATTTTATTCGTAGTCTTCAGGATTAATATCAGGTTTCGGTAAATTTTGCTTATGATCAAAAGTCACACCTTGGATCCCATTCACATAAGTCCAATCCTTAAGTGTCTTCATGTCGCCAGACAAATAATATTTACTGATCAAATCATTCCAAACATCCCACTTATCCAATGGTACGTTAATCAAATCTGCACCATGATCTATCATCAACTTATTCGCTGCTAATATCGCCGTTCTTTTATTTCCATCCCCAAAAAGTTGATTGCGCATATTATGATACATTAACGTCATTGCTTTATCTGTAATAGAAGTATCTTTTTGCATCAAATTATTAAAAAATCCACTTCAGATTGATAATCTAATTCTTGAGGCTTCCATTTACCTTTATCATTACCAAGTTCTACAGTAACTGAGCCTGTTCTAAAACTGCCCGGATTTAACGAATCATACCTCGCAACCAACAGATTAATATTCTGCTCAATTTTTAACGATAGTTCTTTATTTTCTTTAATAACATACTGCCAGCCCCGCTTCAATTGAACAATTACGTTCAAATTATTAATAGATACACCAGCCGGACTCACGCCATCAATAATCGTTTGCGGTAATATAGTATTTACGCCTTCAAAACGTCAATTTGTAAAAACTAATCTAACTAAATTCTTTTTTGCGAAACATCTATTTTGTTCTCTGGTTAAGTGAAATTTATCAGGATACATCGATAACTCCTTGTTTATATTCTACTAAAAAGAATAC	NA	NA	NA	NA
AYE61659.1|1096142_1096694_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61660.1|1096814_1097192_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61661.1|1097448_1097946_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61662.1|1097952_1099536_-	ABC transporter permease	NA	W8CYL7	Bacillus_phage	22.9	1.4e-14
AYE61663.1|1100182_1100944_-|bacteriocin	bacteriocin ABC transporter	bacteriocin	NA	NA	NA	NA
AYE61664.1|1101301_1101652_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61665.1|1101876_1102428_-	cell division protein	NA	NA	NA	NA	NA
AYE61666.1|1102490_1102652_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61667.1|1102645_1103932_-	Peptidase T	NA	NA	NA	NA	NA
AYE61668.1|1104090_1105425_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61669.1|1105473_1106493_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61670.1|1106756_1107314_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61671.1|1107320_1108202_-	pyridoxal kinase	NA	NA	NA	NA	NA
AYE61672.1|1108208_1109306_-	penicillin-binding protein	NA	NA	NA	NA	NA
AYE61673.1|1109430_1110045_-	transferase	NA	NA	NA	NA	NA
AYE61674.1|1110146_1110779_+	phospholipid phosphatase	NA	NA	NA	NA	NA
AYE61675.1|1111007_1111457_-	putative trp repressor binding protein	NA	NA	NA	NA	NA
AYE61676.1|1111565_1113365_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.3	1.7e-77
AYE61677.1|1113698_1114076_+	Na+-transporting ATP synthase	NA	NA	NA	NA	NA
AYE61678.1|1114543_1114894_+	NAD+ binding protein for K+transport	NA	NA	NA	NA	NA
AYE61679.1|1114959_1116219_-	aluminum resistance protein	NA	NA	NA	NA	NA
AYE61680.1|1116235_1118332_-	ornithine decarboxylase	NA	NA	NA	NA	NA
AYE61681.1|1118534_1119392_-|transposase	transposase, IS4 family protein	transposase	NA	NA	NA	NA
AYE61682.1|1119494_1119941_-	putative resolvase	NA	A0A1V0E035	Clostridioides_phage	33.3	1.3e-10
AYE61683.1|1120207_1120915_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.8	1.1e-22
>prophage 16
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	1128617	1168293	2082741	integrase,tRNA,transposase,protease	Bacillus_phage(17.65%)	40	1143429:1143444	1177985:1178000
AYE61691.1|1128617_1130000_-|integrase	DNA integrase	integrase	A0A1B1P773	Bacillus_phage	46.7	6.9e-58
AYE61692.1|1130533_1131712_-|transposase	transposase IS1201	transposase	A0A220NQR7	Corynebacterium_phage	29.2	1.5e-37
AYE61693.1|1131931_1132789_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AYE61694.1|1132927_1133818_+	amino acid transporter	NA	NA	NA	NA	NA
AYE61695.1|1134417_1134711_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61696.1|1135026_1135404_-	Membrane protein	NA	A0A2H4PQR0	Staphylococcus_phage	32.8	3.6e-09
AYE61697.1|1135405_1135789_-	hypothetical protein	NA	A0A2H4PQR0	Staphylococcus_phage	35.7	8.9e-08
AYE61698.1|1135999_1137301_-	Transposase ISLhe15	NA	NA	NA	NA	NA
AYE61699.1|1137474_1138290_+|integrase	putative integrase-recombinase	integrase	NA	NA	NA	NA
AYE61700.1|1138270_1138438_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61701.1|1138494_1139265_+|transposase	transposase	transposase	H7BWC8	unidentified_phage	37.5	4.3e-17
AYE61702.1|1139355_1140255_-	Aldose epimerase	NA	NA	NA	NA	NA
AYE61703.1|1140407_1141811_-|protease	ATP-dependent protease ATP-binding subunit HslU	protease	A0A1B2IB03	Erwinia_phage	24.9	5.8e-28
AYE61704.1|1141821_1142346_-|protease	ATP-dependent protease peptidase subunit	protease	NA	NA	NA	NA
AYE61705.1|1142354_1143263_-|integrase	integrase/recombinase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	36.1	3.4e-21
AYE61706.1|1143262_1144579_-|tRNA	tRNA (uracil-5-)-methyltransferase	tRNA	NA	NA	NA	NA
1143429:1143444	attL	TAATTTGCCATTGAAC	NA	NA	NA	NA
AYE61707.1|1144600_1146715_-	DNA topoisomerase I	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.2	6.7e-97
AYE61708.1|1146786_1147635_-	DNA processing protein chain A	NA	NA	NA	NA	NA
AYE61709.1|1147695_1148448_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	38.1	1.7e-26
AYE61710.1|1148437_1149289_-	GTP binding protein	NA	NA	NA	NA	NA
AYE61711.1|1149312_1150905_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
AYE61712.1|1150952_1151183_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61713.1|1151185_1152028_-	hypothetical protein	NA	A0A0N9SI50	Staphylococcus_phage	46.3	1.8e-21
AYE61714.1|1152141_1152825_+	hemolysin III	NA	NA	NA	NA	NA
AYE61715.1|1152862_1154062_-|tRNA	tRNA CCA-pyrophosphorylase	tRNA	G3MAR3	Bacillus_virus	44.8	2.9e-36
AYE61716.1|1154146_1155034_+	hypothetical protein	NA	M1Q1P6	Streptococcus_phage	37.2	5.8e-50
AYE61717.1|1155019_1156729_-|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	2.1e-88
AYE61718.1|1156848_1158231_-|integrase	DNA integrase	integrase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AYE61719.1|1158334_1159582_-	putative O-linked transferase	NA	NA	NA	NA	NA
AYE61720.1|1159665_1159941_-	DNA-binding protein II HB	NA	A7KV42	Bacillus_phage	65.2	1.7e-24
AYE61721.1|1160116_1161424_-	GTP-binding protein EngA	NA	NA	NA	NA	NA
AYE61722.1|1161492_1162704_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AYE61723.1|1162775_1163450_-	cytidylate kinase	NA	NA	NA	NA	NA
AYE61724.1|1163502_1163970_-	putative N-acetylmuramidase	NA	NA	NA	NA	NA
AYE61725.1|1164075_1164765_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61726.1|1164987_1165704_-	ribosomal large subunit pseudouridine synthase B	NA	NA	NA	NA	NA
AYE61727.1|1165704_1166298_-	hypothetical protein	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.7	7.8e-19
AYE61728.1|1166287_1166839_-	segregation and condensation protein A	NA	NA	NA	NA	NA
AYE61729.1|1167032_1167338_-	putative reductase	NA	NA	NA	NA	NA
AYE61730.1|1167387_1168293_-|integrase	integrase/recombinase	integrase	A0A0K2CP59	Brevibacillus_phage	31.6	4.0e-38
1177985:1178000	attR	GTTCAATGGCAAATTA	NA	NA	NA	NA
>prophage 17
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	1189502	1310116	2082741	integrase,tRNA,transposase,protease	Bacillus_virus(15.38%)	113	1190269:1190294	1247671:1247696
AYE61752.1|1189502_1190141_-|transposase	putative transposase	transposase	NA	NA	NA	NA
1190269:1190294	attL	AACGATTTAACTAGCACCACGCGTAT	NA	NA	NA	NA
AYE61753.1|1190349_1190949_+	alkaline phosphatase	NA	NA	NA	NA	NA
AYE61754.1|1191055_1192441_+	amino acid transporter	NA	NA	NA	NA	NA
AYE61755.1|1192780_1193350_-	glyoxylate reductase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.8	4.0e-12
AYE61756.1|1193826_1194345_-	haloacid dehalogenase	NA	NA	NA	NA	NA
AYE61757.1|1194391_1195228_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
AYE61758.1|1195399_1196593_-	DNA/pantothenate metabolism flavoprotein	NA	Q9HH70	Methanothermobacter_phage	32.2	1.1e-40
AYE61759.1|1197025_1198210_+	amino acid aminotransferase	NA	NA	NA	NA	NA
AYE61760.1|1198299_1200153_-|tRNA	aspartyl-tRNA synthase	tRNA	A0A1V0SFI4	Hokovirus	34.5	3.1e-05
AYE61761.1|1200158_1201445_-|tRNA	histidyl-tRNA synthetase	tRNA	A0A1V0SLE3	Klosneuvirus	26.6	1.4e-28
AYE61762.1|1201735_1202173_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AYE61763.1|1202172_1204413_-	ppGpp synthetase	NA	A0A2I2L310	Orpheovirus	38.0	1.3e-10
AYE61764.1|1204844_1205792_-	ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AYE61765.1|1205852_1206362_+	transcriptional regulator	NA	NA	NA	NA	NA
AYE61766.1|1206625_1207783_-	hypothetical protein	NA	A0A1S5SBP9	Streptococcus_phage	31.3	1.6e-44
AYE61767.1|1208054_1208561_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61768.1|1208663_1210010_-	membrane protein	NA	NA	NA	NA	NA
AYE61769.1|1210179_1211133_+	putative transcription regulator	NA	NA	NA	NA	NA
AYE61770.1|1211134_1211467_+	putative transporter protein	NA	A0A0P0I7G8	Lactobacillus_phage	44.4	3.4e-19
AYE61771.1|1211722_1212103_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61772.1|1212234_1212792_+	ABC-type cobalt transport protein substrate-binding component	NA	NA	NA	NA	NA
AYE61773.1|1212804_1214514_+	ABC transporter ATP binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.0	2.6e-14
AYE61774.1|1214506_1215340_+	ABC-type cobalt transport protein permease component	NA	NA	NA	NA	NA
AYE61775.1|1215391_1216774_-|integrase	DNA integrase	integrase	A0A1B1P773	Bacillus_phage	46.3	5.8e-57
AYE61776.1|1216816_1216975_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61777.1|1217005_1217461_-	membrane protein	NA	NA	NA	NA	NA
AYE61778.1|1217719_1218898_+|transposase	transposase IS1201	transposase	A0A220NQR7	Corynebacterium_phage	27.7	1.8e-35
AYE61779.1|1218919_1219552_-	putative surface protein	NA	NA	NA	NA	NA
AYE61780.1|1220142_1221684_-	citrate lyase alpha chain	NA	NA	NA	NA	NA
AYE61781.1|1221673_1222588_-	Citrate lyase beta chain	NA	NA	NA	NA	NA
AYE61782.1|1222588_1222882_-	Citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
AYE61783.1|1222871_1223924_-	Citrate lyase ligase	NA	NA	NA	NA	NA
AYE61784.1|1224014_1224806_-	Alpha/beta superfamily hydrolase	NA	NA	NA	NA	NA
AYE61785.1|1224884_1226351_-	cation transport protein	NA	NA	NA	NA	NA
AYE61786.1|1226669_1227983_-	peptidase CE PepCE	NA	NA	NA	NA	NA
AYE61787.1|1228080_1228560_-	Putative surface protein	NA	NA	NA	NA	NA
AYE61788.1|1228582_1229110_-	putative surface protein	NA	NA	NA	NA	NA
AYE61789.1|1229490_1231248_-	Surface protein	NA	NA	NA	NA	NA
AYE61790.1|1232248_1232692_+|transposase	transposase	transposase	H7BVY4	unidentified_phage	38.2	2.5e-22
AYE61791.1|1232888_1233815_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AYE61792.1|1234432_1234834_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61793.1|1234955_1235153_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61794.1|1235294_1236833_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61795.1|1236801_1236954_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61796.1|1236981_1237557_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61797.1|1237593_1237788_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61798.1|1237842_1238862_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	48.4	3.1e-92
AYE61799.1|1238934_1239279_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61800.1|1239285_1239786_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61801.1|1239855_1241373_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61802.1|1241912_1242599_-	mucus-binding protein	NA	NA	NA	NA	NA
AYE61803.1|1243211_1244588_-	fumarate reductase	NA	A0A2P0ZL82	Lactobacillus_phage	32.3	5.8e-57
AYE61804.1|1244599_1246003_-	fumarate hydratase	NA	NA	NA	NA	NA
AYE61805.1|1246189_1246414_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61806.1|1246520_1247606_-	AAA ATPase	NA	NA	NA	NA	NA
AYE61807.1|1247682_1248540_-|transposase	transposase	transposase	NA	NA	NA	NA
1247671:1247696	attR	ATACGCGTGGTGCTAGTTAAATCGTT	NA	NA	NA	NA
AYE61808.1|1248694_1249600_-	peptidyl-prolyl isomerase	NA	NA	NA	NA	NA
AYE61809.1|1249860_1250832_-|transposase	transposase	transposase	H7BUM7	unidentified_phage	32.9	3.0e-44
AYE61810.1|1251154_1256674_+	lactocepin H proteinase PrtH	NA	NA	NA	NA	NA
AYE61811.1|1256862_1257819_-	thermostable pullulanase	NA	NA	NA	NA	NA
AYE61812.1|1257858_1258170_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE61813.1|1258382_1258715_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61814.1|1258781_1258898_-	AAA ATPase	NA	NA	NA	NA	NA
AYE61815.1|1259038_1259740_-	ABC transporter permease	NA	NA	NA	NA	NA
AYE61816.1|1259732_1260794_-	methionine ABC transport protein ATP-binding component	NA	G9BWD6	Planktothrix_phage	35.6	3.6e-30
AYE61817.1|1260806_1261667_-	Outer membrane lipoprotein precursor	NA	NA	NA	NA	NA
AYE61818.1|1262017_1264435_-	cation transporting ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	25.0	1.1e-37
AYE61819.1|1264750_1265653_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE61820.1|1265642_1265945_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61821.1|1266307_1266511_-	xre family toxin-antitoxin system	NA	Q9AZG0	Lactococcus_phage	50.0	2.5e-09
AYE61822.1|1266630_1267149_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	40.1	7.6e-26
AYE61823.1|1267163_1268120_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.5	3.6e-114
AYE61824.1|1269074_1269788_+	choloylglycine hydrolase	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	30.7	5.7e-16
AYE61825.1|1269775_1269973_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61826.1|1270068_1270644_+	membrane-associated phospholipid phosphatase	NA	NA	NA	NA	NA
AYE61827.1|1270851_1271172_-	DegV family protein	NA	NA	NA	NA	NA
AYE61828.1|1271660_1272947_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.7	2.3e-108
AYE61829.1|1273022_1273538_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61830.1|1273689_1274178_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61831.1|1274309_1274540_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61832.1|1274533_1275442_-|transposase	transposase ISLhe15	transposase	NA	NA	NA	NA
AYE61833.1|1276279_1276771_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AYE61834.1|1277154_1278330_+	Beta-glucosidase	NA	NA	NA	NA	NA
AYE61835.1|1278329_1279268_+	PTS beta-glucoside transporter subunit IIC	NA	NA	NA	NA	NA
AYE61836.1|1279427_1280669_-	Transposase IS607 family	NA	A0A0P0IJS6	Lactobacillus_phage	56.8	1.7e-119
AYE61837.1|1280846_1281275_+	PTS N-acetylgalactosamine transporter subunit IID	NA	NA	NA	NA	NA
AYE61838.1|1281424_1282147_+	transcriptional regulator	NA	NA	NA	NA	NA
AYE61839.1|1282156_1282876_+	family 1 glycosyl hydrolase	NA	NA	NA	NA	NA
AYE61840.1|1282845_1283313_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE61841.1|1284217_1285645_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	41.2	6.1e-94
AYE61842.1|1285653_1286208_+	pyrazinamidase/nicotinamidase	NA	G3MA16	Bacillus_virus	42.4	1.6e-34
AYE61843.1|1286279_1286690_-	glycolate oxidase	NA	NA	NA	NA	NA
AYE61844.1|1286746_1287679_-	glycolate oxidase	NA	NA	NA	NA	NA
AYE61845.1|1287761_1287935_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE61846.1|1288116_1289037_-	oxidoreductase	NA	NA	NA	NA	NA
AYE61847.1|1289175_1290105_+	inosine-uridine preferring nucleoside hydrolase	NA	NA	NA	NA	NA
AYE61848.1|1290167_1290686_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61849.1|1290805_1290928_-	polyferredoxin	NA	NA	NA	NA	NA
AYE61850.1|1291294_1292905_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61851.1|1293210_1293519_-	nudix family hydrolase	NA	NA	NA	NA	NA
AYE61852.1|1293590_1294712_-	penicillin-binding protein	NA	NA	NA	NA	NA
AYE61853.1|1294761_1295820_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYE61854.1|1295831_1296998_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AYE61855.1|1297018_1297798_-	dihydrodipicolinate reductase DapB	NA	NA	NA	NA	NA
AYE61856.1|1297790_1298726_-	dihydrodipicolinate synthase DapA	NA	NA	NA	NA	NA
AYE61857.1|1298727_1299882_-	amino acid amidohydrolase	NA	NA	NA	NA	NA
AYE61858.1|1299884_1300595_-	tetrahydrodipicolinate succinylase	NA	NA	NA	NA	NA
AYE61859.1|1300614_1301931_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
AYE61860.1|1303049_1303781_+	aspartate kinase	NA	NA	NA	NA	NA
AYE61861.1|1303773_1304778_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
AYE61862.1|1304818_1305862_-	amino acid permease	NA	NA	NA	NA	NA
AYE61863.1|1306561_1308349_+|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	2.2e-88
AYE61864.1|1308841_1310116_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.6	2.3e-132
>prophage 18
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	1334046	1429170	2082741	integrase,tRNA,transposase	Lactobacillus_virus(25.0%)	99	1410072:1410089	1431153:1431170
AYE61887.1|1334046_1335174_-|tRNA	tRNA methyltransferase	tRNA	NA	NA	NA	NA
AYE61888.1|1335181_1335523_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61889.1|1335569_1336727_-	cysteine desulfurase	NA	NA	NA	NA	NA
AYE61890.1|1336728_1337424_-	Nucleosidase phosphorylase	NA	NA	NA	NA	NA
AYE61891.1|1337441_1337750_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61892.1|1337752_1338322_-	ADP-ribose pyrophosphatase	NA	NA	NA	NA	NA
AYE61893.1|1338341_1338545_-	cold shock protein	NA	NA	NA	NA	NA
AYE61894.1|1338544_1341328_-|tRNA	isoleucyl-tRNA synthetase	tRNA	A0A2K9L260	Tupanvirus	27.9	3.4e-88
AYE61895.1|1341549_1342317_-	cell division initiation protein DivIVA	NA	NA	NA	NA	NA
AYE61896.1|1342322_1343123_-	RNA-binding domain-containing protein	NA	NA	NA	NA	NA
AYE61897.1|1343122_1343326_-	cell division membrane protein	NA	NA	NA	NA	NA
AYE61898.1|1343424_1343862_-	FtsZ-interacting cell division protein	NA	NA	NA	NA	NA
AYE61899.1|1343879_1345199_-	cell division protein FtsZ	NA	NA	NA	NA	NA
AYE61900.1|1345213_1346551_-	cell division protein	NA	NA	NA	NA	NA
AYE61901.1|1346634_1347492_-	cell division protein FtsQ	NA	NA	NA	NA	NA
AYE61902.1|1347508_1348615_-	UDP-diphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AYE61903.1|1348616_1349996_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate synthetase	NA	NA	NA	NA	NA
AYE61904.1|1350005_1350974_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AYE61905.1|1351311_1353045_-	penicillin-binding protein 2B	NA	NA	NA	NA	NA
AYE61906.1|1353128_1353491_-	cell division protein	NA	NA	NA	NA	NA
AYE61907.1|1353504_1354467_-	Ribosomal RNA small subunit methyltransferase H	NA	NA	NA	NA	NA
AYE61908.1|1354456_1354888_-	cell division protein MraZ	NA	NA	NA	NA	NA
AYE61909.1|1355081_1355414_-	membrane protein	NA	NA	NA	NA	NA
AYE61910.1|1355682_1356222_-	MreD-like cell shape-determining protein	NA	NA	NA	NA	NA
AYE61911.1|1356221_1357073_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AYE61912.1|1357118_1358123_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
AYE61913.1|1358218_1358842_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AYE61914.1|1358880_1359558_-	HAD superfamily hydrolase	NA	NA	NA	NA	NA
AYE61915.1|1359547_1360822_-	folylpolyglutamate synthase	NA	NA	NA	NA	NA
AYE61916.1|1360822_1363462_-|tRNA	valyl-tRNA synthase	tRNA	A0A1V0S951	Catovirus	43.1	3.1e-160
AYE61917.1|1364182_1365412_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.4	1.4e-123
AYE61918.1|1365500_1365722_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61919.1|1365885_1367202_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	39.1	1.1e-65
AYE61920.1|1367472_1368399_-	glycosyltransferase	NA	V5USA4	Oenococcus_phage	49.0	4.9e-76
AYE61921.1|1368395_1368812_-	dolichyl-phosphate beta-D-mannosyltransferase	NA	NA	NA	NA	NA
AYE61922.1|1368955_1369696_-	glycerophosphodiester phosphodiesterase family protein	NA	NA	NA	NA	NA
AYE61923.1|1370140_1370311_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61924.1|1370495_1370678_-	Transposase, Mutator family	NA	NA	NA	NA	NA
AYE61925.1|1370832_1371318_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE61926.1|1371338_1371677_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	34.1	2.1e-05
AYE61927.1|1371957_1372680_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61928.1|1372672_1374277_-	ABC transport protein ATP-binding permease component	NA	W8CYL7	Bacillus_phage	23.2	7.3e-11
AYE61929.1|1374251_1374539_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61930.1|1375590_1375962_-	Transposase IS1201	NA	NA	NA	NA	NA
AYE61931.1|1375958_1376522_-|transposase	mutator family transposase	transposase	NA	NA	NA	NA
AYE61932.1|1376995_1377331_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61933.1|1377810_1378521_-	pseudouridine synthase	NA	NA	NA	NA	NA
AYE61934.1|1378698_1379013_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE61935.1|1379704_1379959_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE61936.1|1380146_1380947_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61937.1|1381186_1382050_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61938.1|1382288_1383626_-|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	26.7	1.3e-37
AYE61939.1|1383600_1383816_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE61940.1|1383870_1384218_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE61941.1|1384469_1385276_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61942.1|1385460_1385997_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61943.1|1386177_1386351_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61944.1|1386485_1387703_-|tRNA	tRNA sulfurtransferase	tRNA	NA	NA	NA	NA
AYE61945.1|1387702_1388863_-	aminotransferase	NA	NA	NA	NA	NA
AYE61946.1|1388954_1390664_-	Septation ring formation regulator	NA	NA	NA	NA	NA
AYE61947.1|1390946_1391558_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
AYE61948.1|1391725_1393453_+|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	2.7e-88
AYE61949.1|1393457_1393925_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61950.1|1393924_1395238_+	putative recombination factor ATPase	NA	A0A127AWE7	Bacillus_phage	49.3	4.8e-101
AYE61951.1|1395537_1395819_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61952.1|1395886_1396351_+	hypothetical protein	NA	NA	NA	NA	NA
AYE61953.1|1396416_1397610_-	cell shape-determining protein	NA	NA	NA	NA	NA
AYE61954.1|1397631_1397859_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61955.1|1398192_1399164_-	MreB-like cell shape-determining protein	NA	NA	NA	NA	NA
AYE61956.1|1399247_1399478_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61957.1|1399541_1399982_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
AYE61958.1|1399993_1401433_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
AYE61959.1|1401455_1402418_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
AYE61960.1|1402428_1403940_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
AYE61961.1|1403954_1404503_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
AYE61962.1|1404502_1405012_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
AYE61963.1|1405063_1405297_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
AYE61964.1|1405316_1406030_-	ATP synthase A chain	NA	NA	NA	NA	NA
AYE61965.1|1406154_1406784_-	Uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AYE61966.1|1406867_1407869_-	Sua5 family protein	NA	S4VW33	Pandoravirus	38.1	1.2e-48
AYE61967.1|1407874_1408717_-	methylase of polypeptide chain release factor	NA	NA	NA	NA	NA
AYE61968.1|1408709_1409798_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	44.6	1.4e-05
AYE61969.1|1409814_1410414_-	thymidine kinase	NA	C1KFH3	Lactobacillus_virus	50.8	2.4e-47
1410072:1410089	attL	TATTAAATTCATCTACAA	NA	NA	NA	NA
AYE61970.1|1410563_1411916_+	UDP-N-acetylmuramyl peptide synthase	NA	NA	NA	NA	NA
AYE61971.1|1412233_1413247_+	penicillin binding protein	NA	NA	NA	NA	NA
AYE61972.1|1413300_1414299_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.9	1.7e-34
AYE61973.1|1415184_1416153_-	multi-drug-type permease	NA	NA	NA	NA	NA
AYE61974.1|1416298_1417639_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYE61975.1|1417714_1418329_-	Glycopeptide antibiotics resistance protein	NA	NA	NA	NA	NA
AYE61976.1|1418471_1420625_+	alkaline phosphatase	NA	W6LM83	Streptococcus_phage	43.5	4.1e-150
AYE61977.1|1420804_1421086_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	54.9	2.9e-16
AYE61978.1|1421048_1422029_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.9	1.3e-95
AYE61979.1|1422121_1423579_-	sensor histidine kinase	NA	A0A1X9VNV7	Mimivirus	25.9	3.8e-06
AYE61980.1|1423578_1424283_-	response regulator	NA	W8CYM9	Bacillus_phage	36.5	2.2e-36
AYE61981.1|1424303_1424666_-	Integral membrane protein	NA	NA	NA	NA	NA
AYE61982.1|1424727_1425693_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYE61983.1|1425785_1426943_-	plastocyanin	NA	NA	NA	NA	NA
AYE61984.1|1427326_1427683_-	hypothetical protein	NA	NA	NA	NA	NA
AYE61985.1|1428018_1429170_-|integrase	integrase	integrase	Q6SEA7	Lactobacillus_prophage	35.3	2.7e-55
1431153:1431170	attR	TTGTAGATGAATTTAATA	NA	NA	NA	NA
>prophage 19
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	1440570	1484582	2082741	integrase,transposase,protease	Streptococcus_phage(30.77%)	47	1445182:1445241	1495528:1495987
AYE62000.1|1440570_1441818_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.1	2.5e-43
AYE62001.1|1442055_1443285_+|transposase	transposase	transposase	A0A1X9I619	Streptococcus_phage	38.4	1.8e-65
AYE62002.1|1443566_1444295_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62003.1|1444385_1444856_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62004.1|1444995_1445181_-	30S ribosomal protein S14A	NA	NA	NA	NA	NA
1445182:1445241	attL	ATATGAACTACACCGGCACTGAAGTGCCGGGTTTCTGGGAACATTGAGTAGTGTTTAGGA	NA	NA	NA	NA
AYE62005.1|1445279_1445597_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	71.7	3.4e-37
AYE62006.1|1445641_1446376_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	48.0	3.1e-49
AYE62007.1|1446376_1446511_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	74.2	4.5e-07
AYE62008.1|1447079_1448057_+	amino acid permease	NA	NA	NA	NA	NA
AYE62009.1|1448269_1449652_+|integrase	DNA integrase	integrase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AYE62010.1|1449728_1450685_-	hydrolase	NA	NA	NA	NA	NA
AYE62011.1|1450837_1451470_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AYE62012.1|1452358_1454380_-	PTS system enzyme IIABC	NA	NA	NA	NA	NA
AYE62013.1|1454509_1454782_-	transcription antiterminator	NA	NA	NA	NA	NA
AYE62014.1|1455559_1456714_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.4	3.4e-42
AYE62015.1|1456718_1457186_-	protein-tyrosine phosphatase	NA	NA	NA	NA	NA
AYE62016.1|1457203_1457788_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62017.1|1457918_1458734_-	HAD family hydrolase	NA	NA	NA	NA	NA
AYE62018.1|1458743_1459571_-	HAD family hydrolase	NA	NA	NA	NA	NA
AYE62019.1|1459665_1461018_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AYE62020.1|1461048_1462008_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62021.1|1462004_1462847_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62022.1|1462904_1463978_-	spermidine putrescine ABC transport substrate-binding protein PotD	NA	NA	NA	NA	NA
AYE62023.1|1463974_1464682_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AYE62024.1|1464786_1465599_-	spermidine putrescine ABC transport permease PotB	NA	Q6GZ02	Mycoplasma_phage	30.5	6.7e-13
AYE62025.1|1465588_1466692_-	spermidine putrescine transport ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	41.1	5.5e-34
AYE62026.1|1466751_1467648_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AYE62027.1|1467745_1468279_+	DNA polymerase III alpha chain	NA	M1PFD8	Streptococcus_phage	36.6	6.8e-22
AYE62028.1|1468285_1468786_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62029.1|1468785_1469775_-	Phosphate acetyltransferase	NA	NA	NA	NA	NA
AYE62030.1|1469786_1470485_-	uracil-DNA glycosylase	NA	A0A0Y0A6W9	Macropodid_alphaherpesvirus	40.1	4.0e-38
AYE62031.1|1470553_1471132_+	HAD family hydrolase	NA	NA	NA	NA	NA
AYE62032.1|1471442_1471964_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62033.1|1472300_1473059_-	triosephosphate isomerase	NA	NA	NA	NA	NA
AYE62034.1|1473084_1474296_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYE62035.1|1474408_1475425_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYE62036.1|1475480_1476395_-	putative transcription regulator	NA	NA	NA	NA	NA
AYE62037.1|1476838_1477366_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE62038.1|1477740_1478061_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE62039.1|1478456_1478690_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE62040.1|1478850_1479411_+|transposase	transposase	transposase	A0A146ICT8	Staphylococcus_phage	51.0	4.8e-18
AYE62041.1|1479567_1479717_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE62042.1|1479855_1479996_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE62043.1|1479985_1481230_+	amino acid permease	NA	NA	NA	NA	NA
AYE62044.1|1481555_1482131_+	HAD family hydrolase	NA	NA	NA	NA	NA
AYE62045.1|1482185_1483811_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62046.1|1483997_1484582_+|protease	ATP-dependent Clp protease proteolytic subunit ClpP	protease	A0A223W000	Agrobacterium_phage	54.4	6.3e-53
1495528:1495987	attR	ATATGAACTACACCGGCACTGAAGTGCCGGGTTTCTGGGAACATTGAGTAGTGTTTAGGATCTTACATTGAACTAGTCAAATACCTAACTCACAGAACTCAGCTTGTTACCATGGCCAGTCCCTGACCATTTAGCTTTGTACTTCCTTTATGCAAGATATTAACTGCCGCATTAATATCTCGATCATGCTTGGTTTGACACTTAGAACAGGTCCATTCACGAATCTCTAATGGCTTAGCGCCACTGTTATAGCCACATTTTGAACAAATTCTGGAAGTGTTCTTGGGATCAACTGCAATTAGTTTCTTGCCATACCATTCGCATTTGTATTCTAGCATTTGTCTAAACATTCGCCATGAAGCATTGGCAATTGACTTAGCCAAATGATGATTTTTCTGAAGATTCTTGGTTTTCAAATCTTCAATGACAATTACATCATATTGTTTAACTAAATGCGTAG	NA	NA	NA	NA
>prophage 20
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	1495625	1541365	2082741	transposase,protease	Lactobacillus_virus(25.0%)	44	NA	NA
AYE62055.1|1495625_1495943_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	71.7	3.4e-37
AYE62056.1|1495987_1496722_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	48.0	3.1e-49
AYE62057.1|1496722_1496857_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	74.2	4.5e-07
AYE62058.1|1497143_1498163_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYE62059.1|1498204_1499044_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AYE62060.1|1499036_1500005_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
AYE62061.1|1500021_1500213_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62062.1|1500307_1501306_-	peptide chain release factor 2	NA	NA	NA	NA	NA
AYE62063.1|1501491_1503891_-	helicase	NA	NA	NA	NA	NA
AYE62064.1|1504030_1504576_-	sigma-54 modulation protein	NA	NA	NA	NA	NA
AYE62065.1|1504652_1505348_-	competence protein	NA	NA	NA	NA	NA
AYE62066.1|1505344_1506631_-	superfamily II DNA/RNA helicase protein ComFA	NA	A0A1X9I5S6	Streptococcus_phage	44.0	2.0e-83
AYE62067.1|1506675_1507338_+	hypothetical protein	NA	A0A1X9I5T8	Streptococcus_phage	43.8	5.8e-39
AYE62068.1|1507365_1508523_-	Glycosyl transferase, group 4 family protein	NA	NA	NA	NA	NA
AYE62069.1|1508629_1510261_-	HAD family hydrolase	NA	NA	NA	NA	NA
AYE62070.1|1510380_1511478_-	recombinase A RecA	NA	A0A0S2MVG1	Bacillus_phage	62.1	3.2e-119
AYE62071.1|1511661_1512222_-	CDP-diacylglycerol- phosphatephosphatidyltransferase	NA	NA	NA	NA	NA
AYE62072.1|1512244_1513369_-	transcriptional regulator	NA	NA	NA	NA	NA
AYE62073.1|1513436_1514165_-	3-oxoacyl-(acyl-carrier protein) reductase	NA	NA	NA	NA	NA
AYE62074.1|1514165_1515422_-|protease	protease	protease	L7RBE7	Acanthamoeba_polyphaga_moumouvirus	29.1	1.5e-14
AYE62075.1|1515418_1516633_-|protease	putative protease	protease	NA	NA	NA	NA
AYE62076.1|1516619_1519037_-	DNA translocase ftsK	NA	Q853W3	Mycobacterium_phage	47.8	2.2e-83
AYE62077.1|1519057_1519447_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62078.1|1519446_1520007_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62079.1|1520057_1521257_-	permease	NA	NA	NA	NA	NA
AYE62080.1|1521462_1521654_-	Glucitol/sorbitol-specific PTS system, IIA component	NA	NA	NA	NA	NA
AYE62081.1|1521724_1524481_-	haloacid dehalogenase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.3	7.2e-75
AYE62082.1|1524634_1525663_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AYE62083.1|1525769_1526462_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62084.1|1526496_1527996_-	oxidoreductase	NA	NA	NA	NA	NA
AYE62085.1|1528391_1529288_-	ribosomal large subunit pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.1	2.3e-06
AYE62086.1|1529271_1530084_-	NAD kinase	NA	NA	NA	NA	NA
AYE62087.1|1530080_1530713_-	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AYE62088.1|1530836_1531451_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62089.1|1531529_1532147_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYE62090.1|1532155_1533004_-	competence protein	NA	NA	NA	NA	NA
AYE62091.1|1533081_1533822_-	putative competence regulatory protein	NA	NA	NA	NA	NA
AYE62092.1|1533913_1534312_-	arsenate reductase domain-containing protein	NA	NA	NA	NA	NA
AYE62093.1|1534543_1536277_-	PTS system phosphoenolpyruvate-protein phosphotransferase	NA	NA	NA	NA	NA
AYE62094.1|1536276_1536543_-	PTS system phosphocarrier protein	NA	NA	NA	NA	NA
AYE62095.1|1536657_1536840_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62096.1|1537030_1539220_+|protease	ATP-dependent Clp protease ClpE	protease	A0A1C3S747	Escherichia_phage	40.6	2.3e-124
AYE62097.1|1539371_1539653_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62098.1|1540165_1541365_-|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.5	6.2e-63
>prophage 21
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	1555832	1600030	2082741	transposase	Lactobacillus_virus(23.08%)	47	NA	NA
AYE62115.1|1555832_1557170_-|transposase	transposase, IS605 OrfB family protein	transposase	A0A286QMQ9	Streptococcus_phage	41.3	7.9e-59
AYE62116.1|1557225_1558125_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	48.1	6.4e-73
AYE62117.1|1558186_1559110_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62118.1|1559118_1559946_-	methionine aminopeptidase	NA	NA	NA	NA	NA
AYE62119.1|1560088_1560535_+	flavodoxin	NA	NA	NA	NA	NA
AYE62120.1|1560527_1561067_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62121.1|1561090_1562233_-	UDP-N-acetylglucosamine 2-epimerase	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.3	5.5e-29
AYE62122.1|1562340_1562529_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62123.1|1562697_1564026_-	PTS system cellobiose-specific IIC component	NA	NA	NA	NA	NA
AYE62124.1|1564022_1565255_-	ATP-dependent RNA helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	28.5	1.2e-34
AYE62125.1|1565254_1565959_-	lysozyme	NA	NA	NA	NA	NA
AYE62126.1|1566331_1567372_+	APC family amino acid-polyamine-organocation transporter	NA	NA	NA	NA	NA
AYE62127.1|1567389_1567959_-	Hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	27.1	1.3e-07
AYE62128.1|1568067_1569429_-	CBS domain-containing protein	NA	NA	NA	NA	NA
AYE62129.1|1569521_1569737_-	nitroreductase	NA	NA	NA	NA	NA
AYE62130.1|1570837_1571128_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE62131.1|1571149_1571953_+	hypothetical protein	NA	A0A2D1GQC1	Lysinibacillus_phage	22.2	1.1e-07
AYE62132.1|1572002_1572851_-	patatin family phospholipase	NA	NA	NA	NA	NA
AYE62133.1|1572919_1575319_-	putative phosphoketolase	NA	NA	NA	NA	NA
AYE62134.1|1575615_1576380_+	transcriptional regulator	NA	NA	NA	NA	NA
AYE62135.1|1576385_1576751_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62136.1|1576836_1577160_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62137.1|1577159_1578563_-	Iron-sulfur cluster assembly protein SufB	NA	NA	NA	NA	NA
AYE62138.1|1578555_1579017_-	Iron-sulfur cluster assembly scaffold protein IscU	NA	NA	NA	NA	NA
AYE62139.1|1579003_1580242_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.8	1.0e-97
AYE62140.1|1580216_1581494_-	iron-sulfur cluster assembly protein SufD	NA	NA	NA	NA	NA
AYE62141.1|1581505_1582300_-	ABC transporter ATPase component	NA	A0A1M7XV31	Cedratvirus	27.2	1.2e-11
AYE62142.1|1582386_1583088_-	Transposase, IS4 family	NA	NA	NA	NA	NA
AYE62143.1|1583423_1584242_+	HAD family hydrolase	NA	NA	NA	NA	NA
AYE62144.1|1584306_1584630_-	aminoglycoside N3-acetyltransferase	NA	NA	NA	NA	NA
AYE62145.1|1584869_1585370_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.6	1.0e-48
AYE62146.1|1585762_1586002_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYE62147.1|1586253_1587180_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AYE62148.1|1587297_1589313_-	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	36.0	5.0e-65
AYE62149.1|1589373_1590066_-	ribose 5-phosphate isomerase	NA	NA	NA	NA	NA
AYE62150.1|1590065_1590992_-	ribokinase	NA	NA	NA	NA	NA
AYE62151.1|1591075_1591879_-	putative galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
AYE62152.1|1592099_1592402_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE62153.1|1592391_1593513_+	Transposase ISLhe15	NA	NA	NA	NA	NA
AYE62154.1|1593667_1593937_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62155.1|1593949_1595293_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62156.1|1595442_1596744_+	glycerol-3-phosphate ABC transporter	NA	NA	NA	NA	NA
AYE62157.1|1597033_1597201_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE62158.1|1597197_1598106_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.2	8.0e-31
AYE62159.1|1598159_1598450_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62160.1|1598800_1599895_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.4	1.2e-108
AYE62161.1|1599895_1600030_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	74.2	4.5e-07
>prophage 22
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	1613542	1667471	2082741	integrase,tRNA,transposase,protease	Bacillus_virus(17.65%)	46	1614081:1614097	1623909:1623925
AYE62176.1|1613542_1614625_-|protease	Aminopeptidase I zinc metalloprotease	protease	NA	NA	NA	NA
1614081:1614097	attL	AAGTCTTTACCAAAGAA	NA	NA	NA	NA
AYE62177.1|1614751_1615957_+	MFS transporter permease	NA	NA	NA	NA	NA
AYE62178.1|1615980_1617450_-	multidrug ABC transporter	NA	NA	NA	NA	NA
AYE62179.1|1617740_1618271_+	bifunctional pyrimidine regulatory protein PyrR uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AYE62180.1|1618283_1619612_+	Uracil permease	NA	Q9KX94	Enterobacteria_phage	35.6	1.3e-61
AYE62181.1|1619679_1621062_-|integrase	DNA integrase	integrase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AYE62182.1|1621149_1621650_+	putative transcriptional regulator	NA	NA	NA	NA	NA
AYE62183.1|1621714_1622185_-	acetyltransferase	NA	NA	NA	NA	NA
AYE62184.1|1622416_1622641_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62185.1|1622813_1624151_-	myosin-cross-reactive antigen	NA	NA	NA	NA	NA
1623909:1623925	attR	TTCTTTGGTAAAGACTT	NA	NA	NA	NA
AYE62186.1|1624252_1625482_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.9	8.4e-124
AYE62187.1|1625570_1625993_-	permease of the major facilitator superfamily protein	NA	NA	NA	NA	NA
AYE62188.1|1627126_1628452_-|transposase	transposase	transposase	G3MB42	Bacillus_virus	36.3	1.2e-56
AYE62189.1|1628481_1629090_-|transposase	transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.2e-33
AYE62190.1|1629192_1629693_-	acetyltransferase	NA	NA	NA	NA	NA
AYE62191.1|1631622_1631823_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	2.4e-20
AYE62192.1|1631917_1633249_-|transposase	IS204/IS1001/IS1096/IS1165 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	2.1e-51
AYE62193.1|1633344_1633494_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE62194.1|1633603_1634257_-|transposase	transposase	transposase	H7BVY4	unidentified_phage	29.1	7.6e-15
AYE62195.1|1634734_1636087_-	RNA methyltransferase	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	48.0	7.1e-116
AYE62196.1|1636451_1637828_+	Na+-H+-exchanging protein	NA	NA	NA	NA	NA
AYE62197.1|1637864_1638206_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62198.1|1638387_1639092_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62199.1|1639135_1639828_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62200.1|1639894_1640815_-	putative transcription regulator	NA	A0A1V0SBJ0	Catovirus	25.8	2.7e-18
AYE62201.1|1640839_1642270_-|tRNA	aspartyl/glutamyl-tRNA amidotransferase subunit B	tRNA	NA	NA	NA	NA
AYE62202.1|1642274_1643714_-|tRNA	aspartyl/glutamyl-tRNA amidotransferase subunit A	tRNA	NA	NA	NA	NA
AYE62203.1|1643713_1644022_-|tRNA	aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C	tRNA	NA	NA	NA	NA
AYE62204.1|1644035_1645184_-	Lipoprotein	NA	NA	NA	NA	NA
AYE62205.1|1645196_1647203_-	DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.4	4.1e-104
AYE62206.1|1647243_1649490_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	41.4	5.3e-132
AYE62207.1|1649575_1650214_-	N-acetylmuramidase	NA	S5M633	Brevibacillus_phage	48.3	1.2e-28
AYE62208.1|1650451_1650922_-	putative SprT family metallopeptidase	NA	NA	NA	NA	NA
AYE62209.1|1650909_1651608_-	putative mannosyltransferase	NA	NA	NA	NA	NA
AYE62210.1|1651610_1653041_-	putative membrane protein	NA	NA	NA	NA	NA
AYE62211.1|1653045_1654137_-	CDP-glycerol:glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
AYE62212.1|1655221_1656382_-	cation-transporting P-type ATPase	NA	NA	NA	NA	NA
AYE62213.1|1657195_1658437_-	Transposase IS607 family	NA	A0A0P0IJS6	Lactobacillus_phage	57.4	6.9e-118
AYE62214.1|1658876_1660064_-	Transposase ISLhe15	NA	NA	NA	NA	NA
AYE62215.1|1660201_1661032_-	NH(3)-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	51.4	5.7e-68
AYE62216.1|1661028_1662507_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.6	3.5e-116
AYE62217.1|1662592_1663696_-	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
AYE62218.1|1663700_1664429_-	UDP-N-acetyl-D-mannosamine transferase	NA	NA	NA	NA	NA
AYE62219.1|1664617_1665493_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE62220.1|1665523_1666000_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62221.1|1666241_1667471_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.4	4.2e-123
>prophage 23
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	1685185	1740629	2082741	integrase,tRNA,transposase	Bacillus_virus(18.18%)	48	1678633:1678647	1739095:1739109
1678633:1678647	attL	ATCATGAAGGCTATG	NA	NA	NA	NA
AYE62240.1|1685185_1686511_-|transposase	transposase	transposase	G3MB42	Bacillus_virus	36.3	1.2e-56
AYE62241.1|1686540_1687149_-|transposase	transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
AYE62242.1|1688173_1688722_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62243.1|1688920_1689670_+	hypothetical protein	NA	G3MBH6	Bacillus_virus	32.1	5.6e-14
AYE62244.1|1689687_1690059_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62245.1|1690051_1690273_-	ATP-dependent helicase	NA	NA	NA	NA	NA
AYE62246.1|1690327_1690639_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	71.1	8.5e-33
AYE62247.1|1690747_1691449_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	51.1	6.6e-57
AYE62248.1|1692007_1692799_+	phosphoenolpyruvate carboxykinase	NA	NA	NA	NA	NA
AYE62249.1|1693428_1693842_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62250.1|1693966_1694194_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62251.1|1694280_1694580_-	Carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AYE62252.1|1695104_1696289_-	acetate kinase	NA	NA	NA	NA	NA
AYE62253.1|1696620_1697754_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62254.1|1697707_1698130_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62255.1|1698159_1698759_+	amino acid permease-associated region	NA	NA	NA	NA	NA
AYE62256.1|1699269_1699563_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62257.1|1699636_1701448_-	Glutamine-fructose-6-phosphate transaminase	NA	M1I1B8	Acanthocystis_turfacea_Chlorella_virus	34.5	3.3e-84
AYE62258.1|1701643_1704268_-	acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
AYE62259.1|1704581_1705955_+	amino acid permease	NA	NA	NA	NA	NA
AYE62260.1|1705992_1706160_-	Maltose o-acetyltransferase	NA	NA	NA	NA	NA
AYE62261.1|1706171_1706507_-	maltose o-acetyltransferase	NA	NA	NA	NA	NA
AYE62262.1|1706667_1707498_+	LysR family transcription regulator	NA	NA	NA	NA	NA
AYE62263.1|1707542_1707911_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62264.1|1707914_1708835_-	PTS system mannose-specific IID component ManN	NA	NA	NA	NA	NA
AYE62265.1|1708863_1709676_-	PTS system mannose-specific IIC component ManM	NA	NA	NA	NA	NA
AYE62266.1|1709712_1710723_-	Phosphotransferase system, mannose/fructose-specific component IIA	NA	NA	NA	NA	NA
AYE62267.1|1711312_1711891_-	alpha-galactosidase	NA	NA	NA	NA	NA
AYE62268.1|1711920_1712475_-	alpha-galactosidase	NA	NA	NA	NA	NA
AYE62269.1|1712996_1713503_-	PTS system sucrose-specific IIABC component	NA	NA	NA	NA	NA
AYE62270.1|1713592_1714033_-	putative PTS system sucrose-specific IIABC component	NA	NA	NA	NA	NA
AYE62271.1|1714209_1714854_-	PTS system sucrose-specific IIABC component	NA	NA	NA	NA	NA
AYE62272.1|1714936_1715743_-	Sucrase	NA	NA	NA	NA	NA
AYE62273.1|1716306_1717158_+	msm operon regulatory protein	NA	NA	NA	NA	NA
AYE62274.1|1717208_1718354_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.8	4.8e-41
AYE62275.1|1724212_1725520_-|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.1	1.1e-92
AYE62276.1|1725743_1726295_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYE62277.1|1726294_1726903_-	hypothetical protein	NA	M1Q152	Streptococcus_phage	38.5	4.7e-35
AYE62278.1|1727032_1727830_+	putative esterase	NA	NA	NA	NA	NA
AYE62279.1|1727985_1728687_+	putative Cro/CI-like transcription regulator	NA	NA	NA	NA	NA
AYE62280.1|1728770_1730153_+	NAD-dependent aldehyde	NA	NA	NA	NA	NA
AYE62281.1|1730198_1731275_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62282.1|1731431_1734800_-	RND superfamily resistance-nodulation-cell division:proton (H+) antiporter	NA	NA	NA	NA	NA
AYE62283.1|1734804_1735377_-	putative transcription regulator	NA	NA	NA	NA	NA
AYE62284.1|1735522_1736905_-|integrase	DNA integrase	integrase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AYE62285.1|1736967_1737918_-	penicillin-binding protein	NA	NA	NA	NA	NA
AYE62286.1|1737930_1738764_-	putative cation transporter	NA	NA	NA	NA	NA
AYE62287.1|1738931_1740629_-|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	2.3e-87
1739095:1739109	attR	ATCATGAAGGCTATG	NA	NA	NA	NA
>prophage 24
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	1753889	1861674	2082741	integrase,transposase	Bacillus_phage(21.21%)	112	1827316:1827375	1838425:1838493
AYE62301.1|1753889_1754186_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE62302.1|1754680_1756315_-	ABC transporter ATP-binding protein/permease	NA	A0A285PWH2	Cedratvirus	24.9	1.2e-05
AYE62303.1|1756406_1757321_+	Proline iminopeptidase	NA	NA	NA	NA	NA
AYE62304.1|1757410_1758412_+	adenosine deaminase	NA	NA	NA	NA	NA
AYE62305.1|1758459_1758963_+	Nucleoside deoxyribosyltransferase	NA	K4I206	Lactobacillus_phage	29.9	3.8e-14
AYE62306.1|1759113_1759290_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62307.1|1759422_1759791_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62308.1|1759961_1761263_+	glycerol-3-phosphate ABC transporter	NA	NA	NA	NA	NA
AYE62309.1|1761315_1761888_-	elongation factor P	NA	NA	NA	NA	NA
AYE62310.1|1761922_1762849_-	pantothenate kinase	NA	NA	NA	NA	NA
AYE62311.1|1762915_1764094_-|transposase	transposase IS1201	transposase	A0A220NQR7	Corynebacterium_phage	29.5	8.8e-38
AYE62312.1|1764273_1764834_+	arylesterase	NA	NA	NA	NA	NA
AYE62313.1|1764830_1764956_-	acetyltransferase	NA	NA	NA	NA	NA
AYE62314.1|1765140_1765359_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	60.4	2.6e-12
AYE62315.1|1765499_1767806_-	putative ATP-dependent helicase	NA	NA	NA	NA	NA
AYE62316.1|1768242_1768641_+	Peptidase M10A and M12B matrixin and adamalysin	NA	NA	NA	NA	NA
AYE62317.1|1768701_1769352_+	phosphoglycerate mutase	NA	A0A1X9IGJ2	Lactococcus_phage	31.3	1.4e-08
AYE62318.1|1769567_1771367_-	ABC transporter	NA	NA	NA	NA	NA
AYE62319.1|1771379_1772129_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	39.5	3.7e-34
AYE62320.1|1772275_1773547_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62321.1|1773635_1774307_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62322.1|1774723_1775308_-|transposase	transposase	transposase	A0A146ICT8	Staphylococcus_phage	39.0	1.1e-33
AYE62323.1|1775683_1776688_-	L-asparaginase	NA	NA	NA	NA	NA
AYE62324.1|1777025_1777394_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62325.1|1778172_1778307_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE62326.1|1778306_1778945_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AYE62327.1|1779167_1779674_+	transcriptional regulator	NA	NA	NA	NA	NA
AYE62328.1|1779654_1779816_-	penicillin-binding protein	NA	NA	NA	NA	NA
AYE62329.1|1779897_1780779_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	49.8	2.0e-74
AYE62330.1|1780951_1783057_-	arginine/lysine/ornithine decarboxylase	NA	NA	NA	NA	NA
AYE62331.1|1783282_1784734_+	amino acid permease	NA	NA	NA	NA	NA
AYE62332.1|1784989_1785955_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62333.1|1786059_1786191_-|transposase	transposase, Mutator family	transposase	NA	NA	NA	NA
AYE62334.1|1786540_1787770_+|transposase	transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	4.4e-64
AYE62335.1|1788062_1788221_-	transferase hexapeptide domain protein	NA	A0A191KBJ5	Streptococcus_virus	63.3	3.5e-11
AYE62336.1|1788503_1789955_-	EpsN protein	NA	NA	NA	NA	NA
AYE62337.1|1789951_1791082_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62338.1|1791099_1791651_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62339.1|1791806_1792535_-	glycosyltransferase in exopolysaccharide biosynthesis	NA	A0A2K9L639	Tupanvirus	28.7	4.5e-08
AYE62340.1|1792535_1793561_-	family 2 glycosyl transferase	NA	A0A1V0SAH6	Catovirus	36.8	2.7e-11
AYE62341.1|1793547_1794612_-	glycosyl transferase family 1	NA	A0A1V0SL50	Klosneuvirus	30.1	6.3e-11
AYE62342.1|1794656_1796621_-	Glycosyl transferase	NA	NA	NA	NA	NA
AYE62343.1|1796629_1797130_-	glycosyl transferase family protein	NA	NA	NA	NA	NA
AYE62344.1|1797129_1797579_-	UDP-N-acetylglucosamine:LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
AYE62345.1|1797593_1798247_-	Phospho-glucosyltransferase	NA	NA	NA	NA	NA
AYE62346.1|1798363_1799134_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYE62347.1|1799133_1799928_-	putative exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYE62348.1|1799938_1800826_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYE62349.1|1800837_1801899_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYE62350.1|1802769_1803273_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62351.1|1803250_1803445_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62352.1|1803818_1805084_+	GTP-binding protein	NA	NA	NA	NA	NA
AYE62353.1|1805410_1805584_+|transposase	transposase IS66	transposase	NA	NA	NA	NA
AYE62354.1|1805634_1806384_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62355.1|1806575_1807508_-	hydrolase	NA	A0A0A8WIF2	Clostridium_phage	39.8	8.8e-17
AYE62356.1|1807666_1809049_-|integrase	DNA integrase	integrase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AYE62357.1|1809116_1809842_-	hydrolase	NA	A0A1J0GW44	Streptomyces_phage	41.9	8.4e-15
AYE62358.1|1810014_1810413_-	ATPase	NA	NA	NA	NA	NA
AYE62359.1|1810439_1810688_-	ATPase	NA	NA	NA	NA	NA
AYE62360.1|1810804_1811356_-	glycosidase	NA	M9MUG9	Rhodococcus_phage	42.1	2.6e-16
AYE62361.1|1811562_1812108_-	guanylate kinase	NA	NA	NA	NA	NA
AYE62362.1|1812202_1812502_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62363.1|1812594_1814100_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62364.1|1814114_1814756_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62365.1|1815001_1816231_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.2	4.4e-125
AYE62366.1|1816670_1816844_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62367.1|1816956_1817493_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62368.1|1818339_1818882_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.0	3.5e-42
AYE62369.1|1819191_1819677_-	putative membrane protein	NA	NA	NA	NA	NA
AYE62370.1|1819679_1820450_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62371.1|1820460_1822002_-	ABC transporter	NA	A0A2K9L0W2	Tupanvirus	27.6	1.8e-43
AYE62372.1|1822010_1822388_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62373.1|1822588_1823077_+	putative ribosomal-protein-L7-serine acetyltransferase	NA	NA	NA	NA	NA
AYE62374.1|1823101_1823275_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62375.1|1823832_1825074_-	transcription regulator	NA	NA	NA	NA	NA
AYE62376.1|1825235_1827032_+	oligopeptidase PepB	NA	NA	NA	NA	NA
1827316:1827375	attL	AATGTAAGATCCTAAACACTACTCAGTGTTCCCAGAAACCCGGCACTTCAGTGCCGGTGT	NA	NA	NA	NA
AYE62377.1|1827504_1827777_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62378.1|1828191_1828818_-	lactate permease	NA	NA	NA	NA	NA
AYE62379.1|1829382_1829694_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE62380.1|1829937_1831320_-	sodium:dicarboxylate symporter	NA	NA	NA	NA	NA
AYE62381.1|1831782_1833165_+|integrase	DNA integrase	integrase	A0A1B1P773	Bacillus_phage	46.3	3.4e-57
AYE62382.1|1833210_1834005_-	ABC transporter	NA	NA	NA	NA	NA
AYE62383.1|1834004_1834565_-	ABC transport protein ATP-binding component	NA	A0A2K9L3Z8	Tupanvirus	30.3	1.2e-13
AYE62384.1|1834683_1835646_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYE62385.1|1836036_1836192_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62386.1|1836395_1838402_-	phosphotransferase system	NA	NA	NA	NA	NA
AYE62387.1|1838513_1838825_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	73.3	9.1e-35
1838425:1838493	attR	ACACCGGCACTGAAGTGCCGGGTTTCTGGGAACACTGAGTAGTGTTTAGGATCTTACATTGAACTAGTC	NA	NA	NA	NA
AYE62388.1|1838927_1839737_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	52.0	1.2e-65
AYE62389.1|1839841_1840756_-	1-phosphofructokinase	NA	NA	NA	NA	NA
AYE62390.1|1840755_1841511_-	repressor of fructose operon	NA	NA	NA	NA	NA
AYE62391.1|1841864_1842032_-	Toxin-antitoxin system	NA	NA	NA	NA	NA
AYE62392.1|1842012_1842321_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62393.1|1842591_1842786_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62394.1|1843081_1843303_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62395.1|1843292_1843520_-	XRE family transcriptional regulator	NA	A0A2K9V490	Faecalibacterium_phage	41.7	1.5e-07
AYE62396.1|1843668_1844067_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62397.1|1844069_1844933_-	ATPase	NA	NA	NA	NA	NA
AYE62398.1|1845575_1846325_-	aspartate racemase	NA	NA	NA	NA	NA
AYE62399.1|1846333_1847905_-	UDP-N-acetylmuramoylalanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AYE62400.1|1847955_1849104_-	two-component system histidine kinase	NA	W8CYF6	Bacillus_phage	32.3	4.3e-29
AYE62401.1|1849107_1849794_-	two-component system response regulator	NA	W8CYM9	Bacillus_phage	37.6	9.6e-37
AYE62402.1|1849969_1851829_-	ABC transporter	NA	W8CYL7	Bacillus_phage	25.8	6.9e-45
AYE62403.1|1851838_1853563_-	ABC transport protein ATPase and permease component	NA	W8CYL7	Bacillus_phage	27.1	1.5e-38
AYE62404.1|1853678_1854461_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62405.1|1854469_1855570_-	GTP-dependent nucleic acid-binding protein EngD	NA	NA	NA	NA	NA
AYE62406.1|1855629_1855893_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62407.1|1855885_1856770_-	chromosome partitioning protein	NA	I3NLC2	Bifidobacterium_phage	31.7	7.1e-16
AYE62408.1|1856747_1857527_-	hypothetical protein	NA	Q8JL10	Natrialba_phage	31.5	4.3e-25
AYE62409.1|1857542_1858382_-	chromosome partitioning protein	NA	S5VSZ7	Leptospira_phage	41.8	6.1e-17
AYE62410.1|1858396_1859119_-	16S rRNA methyltransferase GidB	NA	NA	NA	NA	NA
AYE62411.1|1859280_1859817_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62412.1|1859967_1861674_+|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.6e-88
>prophage 25
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	1865639	1908263	2082741	transposase	Lactobacillus_virus(20.0%)	41	NA	NA
AYE62418.1|1865639_1866965_-|transposase	transposase	transposase	G3MB42	Bacillus_virus	36.3	2.8e-56
AYE62419.1|1867043_1867604_-|transposase	transposase	transposase	A0A1V0SJI5	Klosneuvirus	41.8	7.6e-32
AYE62420.1|1867781_1868024_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62421.1|1868126_1869539_+	dipeptidase	NA	NA	NA	NA	NA
AYE62422.1|1869583_1870258_-	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.7e-33
AYE62423.1|1870259_1871321_-	putative ABC transporter	NA	NA	NA	NA	NA
AYE62424.1|1871321_1871849_-	putative transcription regulator	NA	NA	NA	NA	NA
AYE62425.1|1871959_1872559_-	putative phosphoglycerate mutase	NA	NA	NA	NA	NA
AYE62426.1|1872702_1873458_+	alpha/beta fold family hydrolase	NA	NA	NA	NA	NA
AYE62427.1|1873454_1874216_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62428.1|1874274_1874919_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62429.1|1874950_1875490_-	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
AYE62430.1|1875473_1875707_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	64.5	2.4e-16
AYE62431.1|1875703_1876585_-	di-tripeptide transport protein	NA	A0A0P0IY73	Acinetobacter_phage	46.2	4.4e-42
AYE62432.1|1876694_1879229_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	26.3	3.4e-71
AYE62433.1|1879454_1879814_+	putative aggregation promoting protein	NA	A0A0E3XCL7	Enterococcus_phage	67.1	1.5e-20
AYE62434.1|1879877_1880858_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62435.1|1881007_1882255_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62436.1|1882386_1882704_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	70.7	1.3e-36
AYE62437.1|1882812_1883616_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	52.4	1.0e-66
AYE62438.1|1883747_1884110_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62439.1|1884264_1885968_+|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	2.1e-88
AYE62440.1|1885969_1888138_-	ribonucleoside-diphosphate reductase	NA	A0A0D3MSW9	Lactococcus_phage	47.5	1.9e-171
AYE62441.1|1888130_1888556_-	ribonucleotide reductase	NA	A0A217ER62	Bacillus_phage	33.3	3.3e-11
AYE62442.1|1888536_1889544_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	53.7	2.7e-96
AYE62443.1|1890009_1890222_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AYE62444.1|1890469_1891027_-	Serine acetyltransferase	NA	NA	NA	NA	NA
AYE62445.1|1890992_1892177_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
AYE62446.1|1892198_1893110_-	cystathionine beta synthase	NA	A0A1W6JIM2	Lactococcus_phage	42.0	5.7e-61
AYE62447.1|1893909_1894317_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE62448.1|1894635_1895193_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62449.1|1895370_1896222_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62450.1|1896354_1897629_-	major facilitator permease	NA	NA	NA	NA	NA
AYE62451.1|1897873_1898563_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62452.1|1900124_1900598_+	LuxS family protein	NA	NA	NA	NA	NA
AYE62453.1|1900751_1903037_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AYE62454.1|1903254_1903920_+	5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AYE62455.1|1904347_1904941_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AYE62456.1|1905156_1906233_+	Integral membrane protein	NA	NA	NA	NA	NA
AYE62457.1|1906235_1906793_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
AYE62458.1|1906985_1908263_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.1	5.2e-44
>prophage 26
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	1922770	1977815	2082741	integrase,tRNA,transposase	Streptococcus_phage(23.08%)	49	1916422:1916439	1943504:1943521
1916422:1916439	attL	GCAAATAAATTCTTCAAA	NA	NA	NA	NA
AYE62476.1|1922770_1924153_+|integrase	DNA integrase	integrase	A0A1B1P773	Bacillus_phage	46.3	5.8e-57
AYE62477.1|1924182_1924764_+	serine recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	42.3	3.9e-23
AYE62478.1|1924983_1925796_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE62479.1|1925792_1926176_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE62480.1|1926408_1927296_+	putative glucose uptake protein	NA	NA	NA	NA	NA
AYE62481.1|1927348_1928161_-	hypothetical protein	NA	A0A2D1GQC1	Lysinibacillus_phage	20.7	2.1e-06
AYE62482.1|1928715_1929996_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	6.0e-48
AYE62483.1|1930592_1931006_+	Multidrug efflux pump protein	NA	NA	NA	NA	NA
AYE62484.1|1931080_1933327_-	ATPase	NA	E4ZFI9	Streptococcus_phage	30.1	2.4e-60
AYE62485.1|1933812_1934331_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYE62486.1|1934674_1935913_-|transposase	transposase	transposase	A0A0A8WEF4	Clostridium_phage	24.6	3.4e-08
AYE62487.1|1936549_1937299_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62488.1|1937727_1938774_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62489.1|1938861_1941300_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62490.1|1941768_1943178_-	Transposase ISLhe15	NA	NA	NA	NA	NA
AYE62491.1|1943996_1944893_+	ABC transporter	NA	NA	NA	NA	NA
1943504:1943521	attR	GCAAATAAATTCTTCAAA	NA	NA	NA	NA
AYE62492.1|1944880_1946545_+	ABC transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	9.0e-20
AYE62493.1|1946552_1947263_+	putative metal ion ABC transporter	NA	NA	NA	NA	NA
AYE62494.1|1947443_1948331_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62495.1|1948368_1948704_+	ethanolamine utilization protein	NA	NA	NA	NA	NA
AYE62496.1|1949286_1950432_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.0	1.6e-39
AYE62497.1|1950573_1951923_-	oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	50.3	1.4e-124
AYE62498.1|1952575_1952989_-	LtrC	NA	NA	NA	NA	NA
AYE62499.1|1953536_1953689_-	LtrC-like protein	NA	NA	NA	NA	NA
AYE62500.1|1954029_1954224_-	DNA topoisomerase	NA	NA	NA	NA	NA
AYE62501.1|1954343_1954901_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE62502.1|1955113_1955449_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62503.1|1955631_1956522_-	sugar kinase	NA	NA	NA	NA	NA
AYE62504.1|1956522_1957881_-	purine-cytosine permease	NA	NA	NA	NA	NA
AYE62505.1|1957886_1958897_-	ADP-ribosylglycohydrolase	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	23.0	9.0e-07
AYE62506.1|1959066_1959243_+	HsdS specificity protein of type I restriction-modification system	NA	NA	NA	NA	NA
AYE62507.1|1959431_1959674_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE62508.1|1959953_1961195_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62509.1|1962212_1962338_-	acetate kinase	NA	NA	NA	NA	NA
AYE62510.1|1962635_1963325_-	putative transcription regulator	NA	NA	NA	NA	NA
AYE62511.1|1963532_1964471_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE62512.1|1964467_1964797_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE62513.1|1965035_1965908_+|transposase	transposase	transposase	H7BWC8	unidentified_phage	33.2	1.4e-37
AYE62514.1|1966435_1966555_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
AYE62515.1|1967008_1967644_-	carbonate dehydratase	NA	NA	NA	NA	NA
AYE62516.1|1967897_1968695_-	putative restriction endonuclease	NA	NA	NA	NA	NA
AYE62517.1|1968938_1970297_-|tRNA	tRNA (uracil-5-)-methyltransferase related enzyme	tRNA	F5CA72	Streptococcus_phi-m46.1-like_phage	46.8	4.6e-107
AYE62518.1|1970299_1971037_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62519.1|1971306_1972698_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE62520.1|1972782_1973556_-	Phosphatase	NA	NA	NA	NA	NA
AYE62521.1|1973611_1974544_-	glycerol kinase	NA	NA	NA	NA	NA
AYE62522.1|1975236_1976049_+	phosphomethylpyrimidine kinase ThiD	NA	NA	NA	NA	NA
AYE62523.1|1976330_1977017_+	cobyric acid	NA	NA	NA	NA	NA
AYE62524.1|1977077_1977815_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	45.9	2.5e-51
>prophage 27
CP017982	Lactobacillus helveticus strain LH99 chromosome, complete genome	2082741	1992483	2033915	2082741	transposase,protease	Staphylococcus_phage(22.22%)	45	NA	NA
AYE62538.1|1992483_1992795_+|transposase	transposase, IS4 family protein	transposase	NA	NA	NA	NA
AYE62539.1|1992812_1993343_-	amino acid permease	NA	NA	NA	NA	NA
AYE62540.1|1993416_1993638_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62541.1|1993947_1995321_-	Proline-specific permease ProY	NA	NA	NA	NA	NA
AYE62542.1|1995356_1996718_-	alanine glycine permease	NA	NA	NA	NA	NA
AYE62543.1|1996808_1997573_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62544.1|1997666_1998308_-	Signal peptidase	NA	NA	NA	NA	NA
AYE62545.1|1998414_2000538_-|protease	ATP-dependent Clp protease, ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.7	7.7e-117
AYE62546.1|2000903_2001749_-	Alpha/beta hydrolase superfamily protein	NA	NA	NA	NA	NA
AYE62547.1|2001723_2002971_-	cellobiose-specific PTS	NA	NA	NA	NA	NA
AYE62548.1|2003152_2003839_+	ABC transport protein ATPase component	NA	G9BWD6	Planktothrix_phage	36.9	2.1e-31
AYE62549.1|2003848_2006194_+	ABC transporter permease	NA	NA	NA	NA	NA
AYE62550.1|2006239_2006398_+	ABC transporter permease protein	NA	NA	NA	NA	NA
AYE62551.1|2006413_2006650_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62552.1|2006805_2008509_+|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	2.7e-88
AYE62553.1|2008605_2008761_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE62554.1|2008760_2009462_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AYE62555.1|2009541_2010414_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62556.1|2010513_2011416_+	major facilitator superfamily permease	NA	NA	NA	NA	NA
AYE62557.1|2011564_2011738_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62558.1|2011976_2012834_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AYE62559.1|2013360_2013972_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62560.1|2014436_2015042_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62561.1|2015117_2015732_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYE62562.1|2015770_2016628_-	hypothetical protein	NA	A0A2H4PQR8	Staphylococcus_phage	38.5	2.1e-49
AYE62563.1|2016647_2017505_-	2,5-didehydrogluconate reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.0	7.1e-45
AYE62564.1|2017523_2017904_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62565.1|2018220_2018637_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62566.1|2018711_2020043_-	MOP superfamily multidrug/oligosaccharidyl-lipid/polysaccharide flippase transporter	NA	NA	NA	NA	NA
AYE62567.1|2020601_2021432_+	lysin	NA	Q6SE63	Lactobacillus_prophage	55.1	2.7e-65
AYE62568.1|2021604_2022135_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62569.1|2022786_2022945_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62570.1|2022996_2023377_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62571.1|2023390_2023597_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62572.1|2023794_2024502_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62573.1|2024961_2025714_-	penicillin-binding protein	NA	NA	NA	NA	NA
AYE62574.1|2025867_2027154_-	extramembranal transfer protein	NA	NA	NA	NA	NA
AYE62575.1|2027146_2027386_-	D-alanine--poly(phosphoribitol) ligase subunit	NA	NA	NA	NA	NA
AYE62576.1|2027444_2028683_-	D-alanyl transfer protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.4	1.5e-24
AYE62577.1|2028682_2030197_-	D-alanine-poly(phosphoribitol) ligase subunit	NA	A0A2K9KZV5	Tupanvirus	28.4	4.4e-34
AYE62578.1|2030212_2030365_-	cytochrome C554	NA	NA	NA	NA	NA
AYE62579.1|2030478_2030757_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62580.1|2030776_2031913_-	hypothetical protein	NA	NA	NA	NA	NA
AYE62581.1|2032489_2032663_+	hypothetical protein	NA	NA	NA	NA	NA
AYE62582.1|2032739_2033915_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.9	1.6e-119
