The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP023490	Lactobacillus plantarum strain NCIMB 700965 chromosome, complete genome	3015495	37871	98354	3015495	transposase	unidentified_phage(12.5%)	56	NA	NA
AYE57715.1|37871_38801_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	29.5	5.0e-20
AYE57716.1|38909_39788_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AYE57717.1|40777_41857_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
AYE57718.1|41954_42443_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYE57719.1|42590_43934_+	glycosyl hydrolase family 25	NA	A0A1S5RCQ2	Lactobacillus_phage	32.2	1.4e-36
AYE57720.1|45294_46470_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AYE57721.1|47625_48378_+	hypothetical protein	NA	NA	NA	NA	NA
AYE57722.1|48377_49055_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	29.1	2.7e-07
AYE57723.1|49209_50289_-	hypothetical protein	NA	NA	NA	NA	NA
AYE57724.1|50544_51339_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYE57725.1|51496_52603_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AYE57726.1|52599_52986_-	ribonuclease HI	NA	NA	NA	NA	NA
AYE57727.1|53020_53407_+	hypothetical protein	NA	NA	NA	NA	NA
AYE57728.1|53500_55156_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
AYE57729.1|55488_55938_+	signal peptidase II	NA	NA	NA	NA	NA
AYE60308.1|55957_56881_+	pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.1	1.2e-10
AYE57730.1|57039_57564_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AYE57731.1|57598_58681_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
AYE57732.1|58677_61239_+	carbamoyl-phosphate-synthetase	NA	NA	NA	NA	NA
AYE57733.1|61563_63309_+	hypothetical protein	NA	NA	NA	NA	NA
AYE57734.1|63461_64061_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	39.3	3.3e-33
AYE57735.1|64171_64582_-	hypothetical protein	NA	NA	NA	NA	NA
AYE57736.1|65096_65765_-	chloramphenicol acetyltransferase CAT	NA	NA	NA	NA	NA
AYE57737.1|65765_66137_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AYE57738.1|66140_66866_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
AYE57739.1|67068_67563_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AYE57740.1|67957_68857_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.6	1.3e-36
AYE57741.1|68869_69631_+	ABC transporter permease	NA	NA	NA	NA	NA
AYE57742.1|69748_71455_-	fibronectin/fibrinogen-binding protein	NA	NA	NA	NA	NA
AYE57743.1|71938_72361_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYE57744.1|72445_73315_+	DegV family protein	NA	NA	NA	NA	NA
AYE57745.1|73316_73751_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYE57746.1|73865_74603_+	DUF975 domain-containing protein	NA	NA	NA	NA	NA
AYE57747.1|74718_75447_+	hypothetical protein	NA	NA	NA	NA	NA
AYE57748.1|75538_75829_+	RNA-binding protein	NA	NA	NA	NA	NA
AYE57749.1|75910_76699_+	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
AYE57750.1|76901_78089_-	MFS transporter	NA	NA	NA	NA	NA
AYE57751.1|78426_78759_+	hypothetical protein	NA	NA	NA	NA	NA
AYE57752.1|78786_79095_+	hypothetical protein	NA	NA	NA	NA	NA
AYE57753.1|79323_80061_+	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
AYE57754.1|80196_81054_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
AYE57755.1|81075_81261_+	hypothetical protein	NA	NA	NA	NA	NA
AYE57756.1|81278_82619_+	amino acid permease	NA	NA	NA	NA	NA
AYE57757.1|82811_83696_+	hypothetical protein	NA	NA	NA	NA	NA
AYE57758.1|83846_84197_-	hypothetical protein	NA	NA	NA	NA	NA
AYE57759.1|87200_87999_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AYE57760.1|88711_89413_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYE57761.1|89414_90440_+	ribitol-5-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYE57762.1|90427_91534_+	ribitolphosphotransferase	NA	NA	NA	NA	NA
AYE57763.1|91559_93455_+	CDP-glycerol--poly(glycerophosphate) glycerophosphotransferase	NA	NA	NA	NA	NA
AYE57764.1|93553_94081_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYE57765.1|94251_94689_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYE57766.1|94754_96104_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.6e-27
AYE57767.1|96182_96461_-	hypothetical protein	NA	NA	NA	NA	NA
AYE57768.1|96762_97470_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE57769.1|97517_98354_+|transposase	transposase	transposase	U5P429	Shigella_phage	28.5	2.2e-19
>prophage 2
CP023490	Lactobacillus plantarum strain NCIMB 700965 chromosome, complete genome	3015495	250664	348402	3015495	tail,capsid,tRNA,portal,integrase,terminase,transposase,holin,protease,head	Lactobacillus_phage(66.0%)	102	293575:293592	355335:355352
AYE57895.1|250664_252218_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.2	8.8e-54
AYE57896.1|252265_252625_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AYE57897.1|252614_252794_-	hypothetical protein	NA	NA	NA	NA	NA
AYE57898.1|252920_254198_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
AYE57899.1|254194_254437_-	D-alanine--poly(phosphoribitol) ligase subunit 2	NA	NA	NA	NA	NA
AYE57900.1|254460_255675_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	30.5	1.9e-27
AYE57901.1|257239_257389_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
AYE57902.1|257420_258596_-	peptidase S12	NA	NA	NA	NA	NA
AYE57903.1|259029_260172_-	molecular chaperone DnaJ	NA	A0A2K9L588	Tupanvirus	32.0	4.3e-21
AYE57904.1|260273_262142_-	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	47.2	5.0e-136
AYE57905.1|262185_262785_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYE57906.1|262805_263849_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AYE57907.1|264241_264952_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
AYE57908.1|264952_265954_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
AYE57909.1|265966_266890_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AYE57910.1|267361_267883_-	shikimate kinase	NA	NA	NA	NA	NA
AYE57911.1|267885_268983_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
AYE57912.1|268985_270284_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AYE57913.1|270297_270825_-	amino acid biosynthesis protein	NA	NA	NA	NA	NA
AYE57914.1|270833_272003_-	chorismate synthase	NA	NA	NA	NA	NA
AYE57915.1|271995_273450_-	MFS transporter	NA	NA	NA	NA	NA
AYE57916.1|273918_274848_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	31.8	1.1e-19
AYE57917.1|274857_275676_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AYE57918.1|276138_276492_-	ribosome-binding factor A	NA	NA	NA	NA	NA
AYE57919.1|276514_279091_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	9.6e-21
AYE57920.1|279105_279411_-	hypothetical protein	NA	NA	NA	NA	NA
AYE57921.1|279400_279700_-	DUF448 domain-containing protein	NA	NA	NA	NA	NA
AYE57922.1|279744_280962_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AYE57923.1|280982_281459_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AYE57924.1|281754_286068_-	PolC-type DNA polymerase III	NA	A0A1X9SH08	Bradyrhizobium_phage	34.0	7.7e-15
AYE57925.1|286561_288271_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AYE57926.1|288310_289588_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AYE57927.1|289625_290411_-	CDP-archaeol synthase	NA	NA	NA	NA	NA
AYE57928.1|290426_291206_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.8e-23
AYE57929.1|291325_291889_-	ribosome-recycling factor	NA	NA	NA	NA	NA
AYE57930.1|291890_292613_-	UMP kinase	NA	NA	NA	NA	NA
AYE57931.1|292812_293691_-	elongation factor Ts	NA	NA	NA	NA	NA
293575:293592	attL	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
AYE57932.1|293793_294597_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AYE57933.1|294821_295544_+	HAD family hydrolase	NA	NA	NA	NA	NA
AYE57934.1|295832_296831_-	lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
AYE57935.1|296915_297221_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
AYE57936.1|297204_297963_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AYE57937.1|298074_298710_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AYE57938.1|298767_299004_-	hypothetical protein	NA	NA	NA	NA	NA
AYE57939.1|299101_299341_-	DUF896 family protein	NA	NA	NA	NA	NA
AYE57940.1|299492_300125_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	54.8	3.9e-16
AYE57941.1|300217_300865_-	hypothetical protein	NA	NA	NA	NA	NA
AYE57942.1|300964_301594_+	hypothetical protein	NA	NA	NA	NA	NA
AYE57943.1|301643_302813_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
AYE57944.1|302848_303241_-	hypothetical protein	NA	NA	NA	NA	NA
AYE57945.1|303404_303806_+	hypothetical protein	NA	NA	NA	NA	NA
AYE57946.1|304235_305177_+	glycosyltransferase	NA	V9QJB1	Oenococcus_phage	49.4	4.8e-79
AYE57947.1|306740_307004_-|holin	holin	holin	E9LUR9	Lactobacillus_phage	89.7	2.2e-34
AYE57948.1|307003_308185_-	endolysin	NA	E9LUR8	Lactobacillus_phage	85.8	9.3e-189
AYE57949.1|308196_308409_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	73.8	8.4e-16
AYE57950.1|308482_308710_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	67.1	1.4e-16
AYE57951.1|308706_309732_-	hypothetical protein	NA	A0A2P0ZLF6	Lactobacillus_phage	75.4	3.3e-49
AYE57952.1|310065_310305_-	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	89.6	5.7e-29
AYE57953.1|311672_314084_-	hypothetical protein	NA	A0A2P0ZLF8	Lactobacillus_phage	94.0	0.0e+00
AYE57954.1|314152_315925_-|tail	phage tail protein	tail	A0A2P0ZLH2	Lactobacillus_phage	90.7	1.1e-305
AYE57955.1|315999_320898_-	peptidase M23	NA	A0A2P0ZLG0	Lactobacillus_phage	69.5	0.0e+00
AYE57956.1|320928_321114_-	hypothetical protein	NA	NA	NA	NA	NA
AYE57957.1|321158_321533_-	hypothetical protein	NA	A0A2P0ZLH4	Lactobacillus_phage	91.9	2.3e-56
AYE57958.1|321608_322265_-|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	85.3	2.4e-101
AYE57959.1|322280_322661_-	DUF806 domain-containing protein	NA	A0A2P0ZLF4	Lactobacillus_phage	80.2	1.4e-48
AYE57960.1|322660_323068_-	hypothetical protein	NA	A0A2P0ZLE6	Lactobacillus_phage	93.2	1.7e-65
AYE57961.1|323070_323418_-|head,tail	head-tail adaptor protein	head,tail	A0A2P0ZLF0	Lactobacillus_phage	70.4	1.3e-42
AYE57962.1|323407_323740_-	DNA packaging protein	NA	E9LUQ4	Lactobacillus_phage	84.5	1.4e-44
AYE57963.1|323812_325018_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	87.1	4.0e-195
AYE57964.1|325017_325782_-	peptidase	NA	E9LUQ2	Lactobacillus_phage	92.5	1.4e-124
AYE57965.1|325759_326923_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	94.0	4.2e-210
AYE57966.1|326925_327120_-	DUF1056 domain-containing protein	NA	E9LUQ0	Lactobacillus_phage	93.8	2.8e-26
AYE57967.1|328958_329411_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	94.0	2.8e-77
AYE57968.1|329618_330131_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	91.7	5.3e-80
AYE57969.1|330272_330587_-	hypothetical protein	NA	NA	NA	NA	NA
AYE57970.1|330588_330891_-	hypothetical protein	NA	NA	NA	NA	NA
AYE57971.1|331562_331988_-	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	87.9	3.2e-67
AYE57972.1|333076_333295_-	hypothetical protein	NA	Q597W8	Lactobacillus_virus	79.2	1.0e-24
AYE57973.1|333287_333473_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	74.2	1.5e-05
AYE57974.1|333485_333695_-	hypothetical protein	NA	D6PSV2	Lactobacillus_phage	95.7	2.0e-30
AYE57975.1|333691_334069_-	hypothetical protein	NA	NA	NA	NA	NA
AYE57976.1|334065_334566_-	hypothetical protein	NA	O03915	Lactobacillus_phage	65.5	2.3e-56
AYE57977.1|334701_335487_-	DNA replication protein	NA	E9LUN6	Lactobacillus_phage	90.4	7.7e-131
AYE57978.1|335486_336245_-	replisome organizer	NA	E9LUM6	Lactobacillus_phage	56.6	3.0e-39
AYE57979.1|336294_336987_-	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	98.7	1.8e-131
AYE57980.1|337033_337693_-	DUF669 domain-containing protein	NA	E9LUU2	Lactobacillus_phage	78.5	6.6e-75
AYE57981.1|337695_338358_-	nucleotide-binding protein	NA	E9LUU1	Lactobacillus_phage	95.0	4.5e-116
AYE57982.1|338358_339219_-	DUF1351 domain-containing protein	NA	A0A2D1GPE4	Lactobacillus_phage	33.8	3.5e-36
AYE57983.1|339534_339789_-	hypothetical protein	NA	NA	NA	NA	NA
AYE57984.1|339931_340192_-	hypothetical protein	NA	NA	NA	NA	NA
AYE57985.1|340346_340529_-	hypothetical protein	NA	NA	NA	NA	NA
AYE57986.1|340542_340752_-	hypothetical protein	NA	NA	NA	NA	NA
AYE57987.1|340763_341480_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	58.5	5.7e-64
AYE57988.1|341536_341788_+	hypothetical protein	NA	NA	NA	NA	NA
AYE57989.1|341802_342578_-|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
AYE57990.1|342747_342963_-	transcriptional regulator	NA	A0A2H4JBV7	uncultured_Caudovirales_phage	71.0	5.9e-17
AYE60311.1|343155_343827_+	multidrug transporter	NA	D7RWL5	Brochothrix_phage	55.0	9.7e-42
AYE57991.1|343949_345224_+	DNA polymerase III subunit epsilon	NA	A0A0A7RWA3	Clostridium_phage	35.8	1.6e-24
AYE57992.1|345532_345721_+	hypothetical protein	NA	E9LUS5	Lactobacillus_phage	98.4	3.6e-26
AYE57993.1|345878_346193_+	hypothetical protein	NA	NA	NA	NA	NA
AYE57994.1|346383_346692_-	hypothetical protein	NA	NA	NA	NA	NA
AYE57995.1|347238_348402_+|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	36.5	1.2e-55
355335:355352	attR	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
>prophage 3
CP023490	Lactobacillus plantarum strain NCIMB 700965 chromosome, complete genome	3015495	639324	702688	3015495	tail,capsid,portal,integrase,terminase,transposase,holin,head	Lactobacillus_phage(41.03%)	80	687731:687752	701971:701992
AYE58249.1|639324_639852_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE58250.1|640036_641008_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58251.1|641022_642912_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	9.4e-58
AYE58252.1|642911_644642_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	2.0e-46
AYE58253.1|644864_645257_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58254.1|645479_646331_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AYE58255.1|646812_648135_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	35.1	1.4e-12
AYE60322.1|648441_648807_-|holin	holin	holin	A0A2P0ZLG6	Lactobacillus_phage	79.2	4.7e-14
AYE58256.1|648820_649084_-|holin	holin	holin	E9LUR9	Lactobacillus_phage	95.4	1.1e-36
AYE58257.1|649083_650241_-	endolysin	NA	E9LUR8	Lactobacillus_phage	85.1	1.4e-189
AYE58258.1|650559_650772_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	80.3	1.8e-18
AYE58259.1|650768_651794_-	hypothetical protein	NA	A0A2P0ZLF6	Lactobacillus_phage	75.5	9.9e-54
AYE58260.1|651875_652004_-	XkdX family protein	NA	NA	NA	NA	NA
AYE58261.1|653209_653791_-	DUF2479 domain-containing protein	NA	A0A1J0MFQ3	Staphylococcus_phage	47.4	1.5e-43
AYE58262.1|653805_654798_-	SGNH/GDSL hydrolase family protein	NA	A0A1S6L1H1	Staphylococcus_phage	35.0	1.8e-31
AYE58263.1|654802_656701_-	endolysin	NA	A0A1X9IGI5	Lactococcus_phage	34.3	5.7e-47
AYE58264.1|656700_657438_-|tail	phage tail protein	tail	A0A1S5SA63	Streptococcus_phage	35.3	1.7e-39
AYE58265.1|657431_661436_-	tape measure protein	NA	E9LUR1	Lactobacillus_phage	44.5	1.2e-81
AYE58266.1|661435_661672_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58267.1|661764_662253_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58268.1|662270_662831_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYE58269.1|662842_663229_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AYE58270.1|663230_663785_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYE60323.1|663774_664098_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58271.1|664102_664468_-	hypothetical protein	NA	A0A1W6JNH7	Staphylococcus_phage	39.6	2.3e-05
AYE58272.1|664482_665535_-|capsid	phage capsid protein	capsid	A0A0S0N2Q7	Pseudomonas_phage	31.0	2.0e-33
AYE58273.1|665551_666199_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
AYE58274.1|666305_667250_-|head	phage head morphogenesis protein	head	NA	NA	NA	NA
AYE58275.1|667249_668908_-|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	32.7	1.3e-63
AYE58276.1|668897_670184_-|terminase	PBSX family phage terminase large subunit	terminase	B7T0C6	Staphylococcus_virus	49.6	9.1e-113
AYE58277.1|670167_670725_-|terminase	terminase small subunit	terminase	H9A0M8	Staphylococcus_phage	46.5	1.0e-12
AYE60324.1|670765_671098_-	DUF2829 domain-containing protein	NA	A0A0K2FLC4	Brevibacillus_phage	44.3	1.5e-11
AYE58278.1|671187_671421_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58279.1|671488_672370_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58280.1|672980_673442_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	56.3	2.0e-38
AYE58281.1|673682_673823_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58282.1|673834_674152_-	hypothetical protein	NA	A0A2K9VC43	Lactobacillus_phage	43.8	8.2e-15
AYE58283.1|674155_674548_-	hypothetical protein	NA	E9LUP3	Lactobacillus_phage	65.9	8.8e-43
AYE58284.1|674544_674985_-	hypothetical protein	NA	A0A1S5RCV6	Lactobacillus_phage	53.4	2.3e-36
AYE58285.1|674968_675166_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58286.1|675169_675481_-	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	90.3	3.2e-48
AYE58287.1|675483_675858_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58288.1|675854_676373_-	hypothetical protein	NA	O03915	Lactobacillus_phage	52.3	9.5e-37
AYE58289.1|676377_677100_-	oxidoreductase	NA	Q8SDM9	Staphylococcus_phage	44.7	2.8e-50
AYE58290.1|677096_677384_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58291.1|677380_678346_-	DNA replication protein DnaD	NA	NA	NA	NA	NA
AYE58292.1|678371_679232_-	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	49.4	3.6e-73
AYE58293.1|679155_680043_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	46.7	2.8e-60
AYE58294.1|680039_680426_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58295.1|680558_680729_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58296.1|680796_681309_-	XRE family transcriptional regulator	NA	D6PST4	Lactobacillus_phage	42.9	2.3e-27
AYE58297.1|681376_681682_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
AYE60325.1|681860_682115_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYE58298.1|682260_682764_+	XRE family transcriptional regulator	NA	S6C481	Thermus_phage	41.4	1.1e-21
AYE58299.1|682778_683201_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	34.4	1.0e-12
AYE58300.1|683304_684024_+	hypothetical protein	NA	NA	NA	NA	NA
AYE58301.1|684597_684957_+	hypothetical protein	NA	NA	NA	NA	NA
AYE58302.1|684987_685269_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AYE58303.1|687217_687424_-	hypothetical protein	NA	NA	NA	NA	NA
687731:687752	attL	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
AYE58304.1|687837_688149_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58305.1|688231_688612_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58306.1|688761_689031_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
AYE58307.1|689123_690689_-|capsid	phage major capsid protein	capsid	A0A1J0MFW8	Staphylococcus_phage	34.4	1.1e-40
AYE58308.1|690678_691785_-|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	34.2	1.8e-48
AYE58309.1|691785_691986_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58310.1|691939_693643_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.1	4.1e-121
AYE58311.1|693639_694113_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
AYE58312.1|695044_695311_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58313.1|695351_695732_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	43.9	1.9e-18
AYE58314.1|695724_696063_-|head,tail	head-tail adaptor protein	head,tail	A0A2P0ZLF0	Lactobacillus_phage	35.6	4.6e-08
AYE58315.1|696049_696241_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58316.1|696256_696736_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58317.1|696881_698276_-	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	41.4	2.2e-67
AYE58318.1|698275_699076_-	DNA replication protein	NA	NA	NA	NA	NA
AYE58319.1|699072_699291_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58320.1|699422_699530_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58321.1|699572_699755_-	DNA-binding protein	NA	NA	NA	NA	NA
AYE58322.1|699933_700584_+	XRE family transcriptional regulator	NA	A0A1W6JQE6	Staphylococcus_phage	46.5	3.6e-09
AYE58323.1|700634_701792_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.5	2.5e-53
AYE58324.1|702160_702688_+|transposase	transposase	transposase	NA	NA	NA	NA
701971:701992	attR	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
>prophage 4
CP023490	Lactobacillus plantarum strain NCIMB 700965 chromosome, complete genome	3015495	898291	906805	3015495		Synechococcus_phage(33.33%)	9	NA	NA
AYE58491.1|898291_898870_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.5e-22
AYE58492.1|898862_899888_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	3.2e-60
AYE58493.1|899884_901339_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	3.3e-50
AYE58494.1|901323_903543_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	39.3	2.7e-144
AYE58495.1|903535_904216_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AYE58496.1|904215_904470_-	phosphoribosylformylglycinamidine synthase	NA	NA	NA	NA	NA
AYE58497.1|904471_905203_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
AYE58498.1|905205_906336_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AYE58499.1|906319_906805_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.4	3.9e-16
>prophage 5
CP023490	Lactobacillus plantarum strain NCIMB 700965 chromosome, complete genome	3015495	1038083	1078708	3015495	transposase,protease	Bacillus_phage(37.5%)	40	NA	NA
AYE58616.1|1038083_1039007_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	1.3e-31
AYE58617.1|1039682_1040279_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYE58618.1|1040288_1041329_-	Zn-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
AYE58619.1|1041349_1042207_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AYE58620.1|1042646_1042868_-	antitoxin MazE	NA	NA	NA	NA	NA
AYE58621.1|1043123_1043567_-	universal stress protein	NA	NA	NA	NA	NA
AYE58622.1|1043638_1044208_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
AYE58623.1|1044304_1044988_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
AYE58624.1|1045129_1045645_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58625.1|1046066_1046414_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5SAB3	Streptococcus_phage	43.0	1.1e-15
AYE58626.1|1046413_1046632_-	transcription elongation factor GreAB	NA	NA	NA	NA	NA
AYE58627.1|1047395_1047935_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58628.1|1048103_1048871_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58629.1|1048949_1050272_-	glycosyl hydrolase, family 25 (GH25)	NA	NA	NA	NA	NA
AYE58630.1|1050359_1051535_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AYE58631.1|1051818_1052445_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58632.1|1052434_1053091_-	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.3	1.5e-31
AYE58633.1|1053087_1053687_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58634.1|1053736_1053832_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYE58635.1|1053858_1054788_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	29.5	5.5e-19
AYE58636.1|1054834_1055497_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58637.1|1055545_1056313_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	3.5e-35
AYE58638.1|1056351_1056615_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	37.5	6.8e-07
AYE58639.1|1056657_1057290_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58640.1|1057362_1057824_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58641.1|1058419_1059013_-	NADP oxidoreductase	NA	NA	NA	NA	NA
AYE58642.1|1060316_1061183_-	DUF3737 domain-containing protein	NA	NA	NA	NA	NA
AYE58643.1|1061285_1062314_-	aldo/keto reductase	NA	NA	NA	NA	NA
AYE58644.1|1062951_1064739_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.0	9.5e-44
AYE58645.1|1064738_1066490_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	1.7e-53
AYE58646.1|1066758_1068153_+	MFS transporter	NA	NA	NA	NA	NA
AYE58647.1|1068321_1068549_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58648.1|1068642_1069194_+	hypothetical protein	NA	NA	NA	NA	NA
AYE58649.1|1069347_1073055_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58650.1|1073079_1073727_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYE58651.1|1073732_1074062_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYE58652.1|1074550_1075495_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
AYE58653.1|1075571_1076117_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYE58654.1|1076379_1076907_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYE58655.1|1077502_1078708_-|protease	CPBP family intramembrane metalloprotease domain-containing protein	protease	NA	NA	NA	NA
>prophage 6
CP023490	Lactobacillus plantarum strain NCIMB 700965 chromosome, complete genome	3015495	1174731	1240464	3015495	transposase	unidentified_phage(25.0%)	54	NA	NA
AYE58734.1|1174731_1175661_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	29.9	5.0e-20
AYE58735.1|1175687_1175786_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYE58736.1|1176217_1176544_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AYE58737.1|1176567_1178040_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
AYE58738.1|1178039_1179422_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
AYE58739.1|1179618_1180638_-	aldehyde reductase	NA	NA	NA	NA	NA
AYE58740.1|1180743_1181187_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AYE58741.1|1181570_1182185_+	peptidoglycan-binding protein	NA	A0A2K9V574	Lactobacillus_phage	60.0	1.3e-11
AYE58742.1|1182375_1183305_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
AYE58743.1|1183671_1184334_+	peptidoglycan-binding protein	NA	A0A2K9V574	Lactobacillus_phage	48.9	7.7e-15
AYE58744.1|1185245_1185593_+	RNA-binding protein	NA	NA	NA	NA	NA
AYE58745.1|1185578_1186472_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYE58746.1|1187232_1187877_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
AYE58747.1|1189281_1189707_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58748.1|1189706_1191227_-	LytTR family transcriptional regulator	NA	D0R0A3	Streptococcus_phage	28.0	6.5e-25
AYE58749.1|1191567_1192479_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYE60335.1|1193060_1193804_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYE58750.1|1193851_1195258_+	hypothetical protein	NA	NA	NA	NA	NA
AYE58751.1|1195274_1195913_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
AYE58752.1|1196386_1196797_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AYE58753.1|1196810_1197164_+	hypothetical protein	NA	NA	NA	NA	NA
AYE58754.1|1197180_1197936_+	oxidoreductase	NA	NA	NA	NA	NA
AYE58755.1|1197952_1198609_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AYE58756.1|1198772_1199963_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58757.1|1199984_1201766_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	5.6e-44
AYE58758.1|1204774_1205974_+	amidohydrolase	NA	NA	NA	NA	NA
AYE58759.1|1206065_1206956_-	NAD(P)-dependent dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	47.1	1.7e-57
AYE58760.1|1207756_1208932_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AYE58761.1|1209150_1209972_-	transcriptional regulator	NA	NA	NA	NA	NA
AYE58762.1|1210098_1211583_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
AYE58763.1|1211879_1212275_+	transglycosylase	NA	A0A249XZV3	Enterococcus_phage	60.0	2.1e-15
AYE58764.1|1212570_1213743_+	1,3-propanediol dehydrogenase	NA	NA	NA	NA	NA
AYE58765.1|1214064_1214280_+	hypothetical protein	NA	NA	NA	NA	NA
AYE58766.1|1214973_1216095_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	27.8	4.2e-13
AYE58767.1|1216459_1218385_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.3	1.2e-81
AYE58768.1|1218384_1218654_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
AYE58769.1|1218668_1219043_-	copper-binding protein	NA	NA	NA	NA	NA
AYE58770.1|1223653_1224415_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYE58771.1|1224553_1224688_+	4-hydroxybenzoyl-CoA thioesterase	NA	NA	NA	NA	NA
AYE60336.1|1224871_1226140_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
AYE58772.1|1226230_1226314_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYE58773.1|1226340_1227270_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	31.4	1.6e-18
AYE58774.1|1228288_1229464_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AYE58775.1|1229499_1229775_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58776.1|1229789_1230089_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
AYE58777.1|1230101_1230572_-	PTS lactose transporter subunit IIBC	NA	NA	NA	NA	NA
AYE58778.1|1230601_1232638_-	transcription antiterminator BglG	NA	NA	NA	NA	NA
AYE58779.1|1233742_1233970_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58780.1|1235002_1235245_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58781.1|1235278_1236016_-	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	37.2	4.5e-40
AYE58782.1|1236431_1237124_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AYE58783.1|1237199_1238282_-	AI-2E family transporter	NA	NA	NA	NA	NA
AYE58784.1|1238428_1239583_-	ROK family protein	NA	NA	NA	NA	NA
AYE58785.1|1239936_1240464_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
CP023490	Lactobacillus plantarum strain NCIMB 700965 chromosome, complete genome	3015495	1286772	1342238	3015495	tRNA,holin,bacteriocin,transposase	Erysipelothrix_phage(18.18%)	49	NA	NA
AYE58830.1|1286772_1288218_+|tRNA	tRNA (uracil-5-)-methyltransferase	tRNA	A0A2K5B251	Erysipelothrix_phage	37.7	4.9e-83
AYE58831.1|1288256_1288700_+	hypothetical protein	NA	NA	NA	NA	NA
AYE58832.1|1289012_1289864_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYE58833.1|1289978_1290803_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AYE58834.1|1290874_1291324_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AYE58835.1|1294765_1295434_-	endonuclease III	NA	NA	NA	NA	NA
AYE58836.1|1295549_1295807_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58837.1|1295841_1296393_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	41.5	1.2e-34
AYE58838.1|1296774_1298049_+	hypothetical protein	NA	NA	NA	NA	NA
AYE58839.1|1298184_1298781_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58840.1|1298970_1299453_+	transcriptional repressor	NA	NA	NA	NA	NA
AYE58841.1|1299697_1300054_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYE58842.1|1300248_1300476_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58843.1|1300530_1301385_-	3',5'-cyclic-nucleotide phosphodiesterase	NA	NA	NA	NA	NA
AYE58844.1|1301826_1302378_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYE58845.1|1302790_1303210_-	effector of murein hydrolase LrgA	NA	NA	NA	NA	NA
AYE58846.1|1303229_1303958_-|holin	antiholin LrgB	holin	NA	NA	NA	NA
AYE58847.1|1304132_1304972_-	DegV family protein	NA	NA	NA	NA	NA
AYE58848.1|1305496_1305664_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58849.1|1305831_1306530_+	peptidase	NA	NA	NA	NA	NA
AYE58850.1|1308612_1309494_+	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
AYE58851.1|1309855_1310797_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYE58852.1|1310863_1311976_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.3	1.3e-35
AYE58853.1|1312111_1313446_+	glutathione reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.4	2.5e-25
AYE58854.1|1313640_1313970_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYE58855.1|1314191_1315490_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	3.8e-18
AYE58856.1|1315806_1317096_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.0	6.0e-72
AYE58857.1|1317138_1318116_+	guanosine monophosphate reductase	NA	Q4ZCY7	Staphylococcus_virus	71.2	1.4e-137
AYE58858.1|1318271_1319057_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AYE58859.1|1319136_1320594_-	cardiolipin synthase	NA	NA	NA	NA	NA
AYE58860.1|1321276_1321996_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYE58861.1|1322105_1323980_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
AYE58862.1|1324037_1324631_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
AYE58863.1|1325277_1326453_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AYE58864.1|1327576_1329001_+	amino acid permease	NA	NA	NA	NA	NA
AYE58865.1|1329262_1331305_+	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.7	8.0e-63
AYE58866.1|1331377_1332322_-	cation efflux family transporter	NA	NA	NA	NA	NA
AYE58867.1|1332650_1333697_-	AI-2E family transporter	NA	NA	NA	NA	NA
AYE58868.1|1334158_1335277_+	hypothetical protein	NA	A0A218MNE0	uncultured_virus	43.5	4.1e-69
AYE58869.1|1335364_1335748_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AYE58870.1|1335762_1336071_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AYE58871.1|1336420_1337059_-	hemolysin III	NA	NA	NA	NA	NA
AYE58872.1|1337335_1337680_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYE58873.1|1337818_1338706_+	cation transporter	NA	NA	NA	NA	NA
AYE58874.1|1338891_1339530_-	XRE family transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	49.2	1.4e-05
AYE58875.1|1339607_1339841_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58876.1|1340350_1340521_+	hypothetical protein	NA	NA	NA	NA	NA
AYE58877.1|1340646_1341354_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE58878.1|1341401_1342238_+|transposase	transposase	transposase	U5P429	Shigella_phage	28.5	2.2e-19
>prophage 8
CP023490	Lactobacillus plantarum strain NCIMB 700965 chromosome, complete genome	3015495	1432139	1493664	3015495	transposase	unidentified_phage(10.0%)	58	NA	NA
AYE58955.1|1432139_1433315_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AYE58956.1|1434015_1434825_-	WxL domain-containing protein	NA	NA	NA	NA	NA
AYE58957.1|1434950_1435880_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
AYE58958.1|1436425_1436929_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYE58959.1|1437089_1437758_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYE58960.1|1438064_1439726_+	phosphoenolpyruvate carboxykinase (ATP)	NA	NA	NA	NA	NA
AYE58961.1|1439827_1440025_+	hypothetical protein	NA	NA	NA	NA	NA
AYE58962.1|1440191_1441601_+	glutamate decarboxylase	NA	NA	NA	NA	NA
AYE58963.1|1441732_1442899_-	gamma-D-glutamyl-meso-diaminopimelate peptidase	NA	NA	NA	NA	NA
AYE58964.1|1443179_1443524_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58965.1|1443630_1444002_+	hypothetical protein	NA	NA	NA	NA	NA
AYE58966.1|1444448_1444676_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58967.1|1444809_1445985_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AYE58968.1|1446092_1446632_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58969.1|1447126_1447657_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYE58970.1|1447824_1448418_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58971.1|1448439_1448751_-	DUF2316 domain-containing protein	NA	NA	NA	NA	NA
AYE58972.1|1448764_1449766_-	amidohydrolase	NA	NA	NA	NA	NA
AYE58973.1|1449885_1450464_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYE58974.1|1450624_1451578_+	peroxidase	NA	S4VXK8	Pandoravirus	28.7	5.7e-19
AYE58975.1|1451845_1452559_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
AYE58976.1|1452559_1453255_+	S-adenosyl-L-methionine-binding protein	NA	NA	NA	NA	NA
AYE60341.1|1454444_1454690_+	hypothetical protein	NA	NA	NA	NA	NA
AYE58977.1|1454682_1454856_+	hypothetical protein	NA	NA	NA	NA	NA
AYE58978.1|1454992_1455178_+	hypothetical protein	NA	NA	NA	NA	NA
AYE58979.1|1455323_1457228_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.2	2.6e-95
AYE58980.1|1457381_1458134_-	aquaporin family protein	NA	M1HQW3	Paramecium_bursaria_Chlorella_virus	31.0	3.8e-26
AYE58981.1|1458518_1458839_+	thioredoxin	NA	A0A2K9L3H4	Tupanvirus	39.1	5.2e-09
AYE58982.1|1458862_1459132_+	hypothetical protein	NA	NA	NA	NA	NA
AYE58983.1|1459231_1459435_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58984.1|1459563_1460118_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
AYE58985.1|1460121_1460355_-	copper chaperone	NA	NA	NA	NA	NA
AYE58986.1|1460552_1461218_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AYE58987.1|1461528_1463445_+	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.6	2.8e-73
AYE60342.1|1464277_1464484_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58988.1|1464597_1465071_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYE58989.1|1465129_1466482_-	NADH oxidase	NA	NA	NA	NA	NA
AYE58990.1|1466798_1468949_-	cell surface protein	NA	NA	NA	NA	NA
AYE58991.1|1468970_1469984_-	cell surface protein	NA	NA	NA	NA	NA
AYE58992.1|1470081_1470774_-	WxL domain-containing protein	NA	NA	NA	NA	NA
AYE58993.1|1470811_1471384_-	WxL domain-containing protein	NA	NA	NA	NA	NA
AYE58994.1|1471380_1471659_-	cell surface protein	NA	NA	NA	NA	NA
AYE58995.1|1472320_1472908_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYE58996.1|1473035_1473335_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58997.1|1473336_1474674_-	hypothetical protein	NA	NA	NA	NA	NA
AYE58998.1|1474691_1475885_-	ATPase	NA	A0MZB4	Enterobacteria_phage	24.8	7.6e-05
AYE58999.1|1476256_1476907_+	aquaporin	NA	A0A1V0SCL5	Indivirus	41.6	1.9e-05
AYE59000.1|1477118_1478855_-	2-octaprenylphenol hydroxylase	NA	G8DDN0	Micromonas_pusilla_virus	27.7	2.5e-41
AYE59001.1|1479350_1480742_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AYE59002.1|1480885_1482832_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AYE59003.1|1482850_1484902_-	beta-galactosidase	NA	NA	NA	NA	NA
AYE60343.1|1485855_1485981_+	DNA methyltransferase	NA	NA	NA	NA	NA
AYE59004.1|1485935_1486722_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AYE59005.1|1488136_1488532_-	PASTA domain-containing protein	NA	NA	NA	NA	NA
AYE59006.1|1488654_1489442_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AYE60344.1|1489396_1489516_-	DNA methyltransferase	NA	NA	NA	NA	NA
AYE59007.1|1489885_1491844_-	alpha-rhamnosidase	NA	NA	NA	NA	NA
AYE59008.1|1492743_1493664_-|transposase	IS30 family transposase ISLsa1	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
>prophage 9
CP023490	Lactobacillus plantarum strain NCIMB 700965 chromosome, complete genome	3015495	1832521	1889813	3015495	transposase,protease	unidentified_phage(30.0%)	57	NA	NA
AYE59298.1|1832521_1833283_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYE59299.1|1834219_1835014_-	transglycosylase	NA	K4ID66	Lactobacillus_phage	47.1	5.6e-12
AYE59300.1|1835563_1835665_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYE59301.1|1835691_1836621_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	34.5	6.5e-20
AYE59302.1|1837112_1837736_-	peptidase M23	NA	NA	NA	NA	NA
AYE59303.1|1838140_1838515_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
AYE59304.1|1838524_1839442_-	hypothetical protein	NA	NA	NA	NA	NA
AYE59305.1|1839438_1840155_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	37.1	1.9e-19
AYE59306.1|1840154_1842524_-	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AYE59307.1|1842942_1843305_-	hypothetical protein	NA	NA	NA	NA	NA
AYE59308.1|1843493_1844690_+	acetate kinase	NA	NA	NA	NA	NA
AYE59309.1|1844819_1845263_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYE59310.1|1845336_1845759_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYE59311.1|1845947_1847150_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AYE59312.1|1847281_1847614_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59313.1|1847713_1848784_-	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYE59314.1|1848780_1849596_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
AYE59315.1|1849595_1850429_-	spermidine/putrescine ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	22.5	3.8e-11
AYE59316.1|1850440_1851538_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	41.6	1.5e-36
AYE59317.1|1851608_1852151_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYE59318.1|1852618_1853086_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
AYE59319.1|1853271_1853757_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYE59320.1|1853760_1854288_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYE59321.1|1854381_1854567_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59322.1|1854827_1855181_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYE59323.1|1855180_1856074_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYE59324.1|1856369_1857299_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
AYE59325.1|1857325_1858147_+	acetoin ABC transporter permease	NA	NA	NA	NA	NA
AYE59326.1|1858252_1859620_-	acetaldehyde dehydrogenase	NA	NA	NA	NA	NA
AYE59327.1|1860046_1860910_+	fructose-1,6-bisphosphate aldolase, class II	NA	NA	NA	NA	NA
AYE59328.1|1861202_1862519_-	MFS transporter	NA	NA	NA	NA	NA
AYE59329.1|1862688_1863591_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AYE59330.1|1863603_1863804_-	hypothetical protein	NA	NA	NA	NA	NA
AYE59331.1|1865970_1866216_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59332.1|1866344_1866908_+	BioY family transporter	NA	NA	NA	NA	NA
AYE59333.1|1866945_1867917_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
AYE59334.1|1867913_1868234_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59335.1|1868387_1869563_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AYE59336.1|1869737_1870904_-	hypothetical protein	NA	NA	NA	NA	NA
AYE59337.1|1871499_1872315_+	Teichoic acid translocation permease TagG	NA	NA	NA	NA	NA
AYE59338.1|1872327_1873419_+	teichoic acids export ATP-binding protein TagH	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	7.2e-18
AYE59339.1|1874790_1875063_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59340.1|1875289_1875832_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AYE59341.1|1875828_1877274_+	MFS transporter	NA	NA	NA	NA	NA
AYE59342.1|1877378_1878086_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE59343.1|1878133_1878970_+|transposase	transposase	transposase	U5P429	Shigella_phage	28.5	2.2e-19
AYE59344.1|1879307_1880624_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.6	1.9e-33
AYE59345.1|1881119_1882079_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AYE59346.1|1882181_1882451_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59347.1|1882680_1883244_-	peptidase M10	NA	NA	NA	NA	NA
AYE59348.1|1883437_1884106_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
AYE59349.1|1884263_1885769_+	copper oxidase	NA	NA	NA	NA	NA
AYE59350.1|1886033_1886402_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
AYE59351.1|1886506_1887016_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AYE59352.1|1887046_1888243_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
AYE59353.1|1888352_1888823_+	transcriptional regulator	NA	NA	NA	NA	NA
AYE59354.1|1888883_1889813_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
>prophage 10
CP023490	Lactobacillus plantarum strain NCIMB 700965 chromosome, complete genome	3015495	1906462	1940498	3015495	tRNA,transposase,bacteriocin,protease	Bacillus_phage(25.0%)	31	NA	NA
AYE59367.1|1906462_1907392_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
AYE59368.1|1907616_1907775_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
AYE59369.1|1907799_1907970_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
AYE59370.1|1908236_1910387_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	28.2	2.1e-45
AYE59371.1|1910402_1911779_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AYE59372.1|1912422_1913190_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	4.5e-35
AYE59373.1|1913228_1913492_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	37.5	6.8e-07
AYE59374.1|1913932_1914613_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYE59375.1|1914706_1915393_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYE60353.1|1915543_1915831_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59376.1|1915841_1916135_+	addiction module antidote protein, HigA family	NA	M9MUN2	Rhodococcus_phage	48.3	9.9e-07
AYE59377.1|1916424_1918734_-	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AYE59378.1|1918992_1919769_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
AYE59379.1|1920208_1921225_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AYE59380.1|1921632_1922343_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYE59381.1|1923784_1923973_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59382.1|1923962_1924385_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
AYE60354.1|1924607_1925963_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
AYE59383.1|1925980_1927417_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	9.7e-31
AYE59384.1|1927537_1928434_+	ROK family protein	NA	NA	NA	NA	NA
AYE59385.1|1928583_1929330_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AYE60355.1|1929442_1930456_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AYE59386.1|1930897_1931815_+	exopolyphosphatase	NA	NA	NA	NA	NA
AYE59387.1|1931860_1933135_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
AYE59388.1|1933127_1934087_+	IpaB/EvcA family protein	NA	NA	NA	NA	NA
AYE59389.1|1934108_1934813_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
AYE59390.1|1934812_1935655_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
AYE59391.1|1936251_1936641_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AYE59392.1|1936962_1939014_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
AYE59393.1|1939089_1939716_-	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	44.7	1.4e-37
AYE59394.1|1939970_1940498_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
CP023490	Lactobacillus plantarum strain NCIMB 700965 chromosome, complete genome	3015495	2109620	2118233	3015495		Streptococcus_phage(66.67%)	11	NA	NA
AYE59533.1|2109620_2111318_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
AYE59534.1|2111339_2111648_+	nucleoid-associated protein, YbaB/EbfC family	NA	NA	NA	NA	NA
AYE59535.1|2111663_2112263_+	recombination protein RecR	NA	NA	NA	NA	NA
AYE59536.1|2112277_2112529_+	DUF2508 domain-containing protein	NA	NA	NA	NA	NA
AYE59537.1|2112914_2113580_+	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
AYE59538.1|2113576_2113906_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59539.1|2113922_2114942_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
AYE59540.1|2114967_2115315_+	initiation-control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
AYE59541.1|2115413_2116310_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	9.9e-82
AYE59542.1|2116313_2117099_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
AYE59543.1|2117237_2118233_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.2	2.6e-51
>prophage 12
CP023490	Lactobacillus plantarum strain NCIMB 700965 chromosome, complete genome	3015495	2198216	2248957	3015495	tRNA,transposase,protease	Staphylococcus_phage(16.67%)	43	NA	NA
AYE59608.1|2198216_2198807_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	56.0	3.0e-55
AYE59609.1|2199779_2201117_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
AYE59610.1|2201333_2202365_+	SorC family transcriptional regulator	NA	NA	NA	NA	NA
AYE59611.1|2202431_2203454_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYE59612.1|2203574_2204777_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYE59613.1|2204803_2205562_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
AYE59614.1|2205643_2206972_+	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	71.1	7.3e-174
AYE59615.1|2207263_2207995_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59616.1|2208011_2209565_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
AYE59617.1|2209664_2209901_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AYE59618.1|2209949_2210699_+	carboxylesterase	NA	NA	NA	NA	NA
AYE59619.1|2210707_2213122_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.6	7.2e-87
AYE59620.1|2213147_2213618_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	61.0	8.6e-45
AYE59621.1|2213913_2214792_-|transposase	IS982 family transposase ISLpl4	transposase	NA	NA	NA	NA
AYE59622.1|2221703_2223140_+	glutamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYE59623.1|2223142_2223877_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	2.6e-32
AYE59624.1|2224151_2224715_-	hypothetical protein	NA	NA	NA	NA	NA
AYE59625.1|2224738_2225608_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AYE59626.1|2225723_2226416_+	uracil-DNA glycosylase	NA	A0A1R3T3N6	Sphenicid_alphaherpesvirus	41.1	2.0e-42
AYE59627.1|2226439_2227417_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
AYE59628.1|2227526_2227988_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AYE59629.1|2227993_2228509_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYE59630.1|2228732_2229269_-	exonuclease	NA	A0A2I6PEZ7	Staphylococcus_phage	32.5	8.9e-22
AYE59631.1|2229331_2230096_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	45.8	3.0e-55
AYE59632.1|2230416_2231319_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AYE59633.1|2231490_2232399_+	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AYE59634.1|2232432_2234562_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AYE59635.1|2234701_2235214_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYE59636.1|2235289_2235955_-	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
AYE59637.1|2236139_2236982_+	TIGR00159 family protein	NA	NA	NA	NA	NA
AYE59638.1|2236978_2237956_+	cell surface protein	NA	NA	NA	NA	NA
AYE59639.1|2237987_2239343_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AYE59640.1|2241181_2241697_-	hypothetical protein	NA	NA	NA	NA	NA
AYE59641.1|2241668_2242358_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.1	4.8e-20
AYE59642.1|2242718_2243894_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AYE59643.1|2243929_2244253_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
AYE59644.1|2244242_2244563_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AYE59645.1|2244725_2244926_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59646.1|2245221_2246145_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-32
AYE59647.1|2246243_2247143_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59648.1|2247132_2247816_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59649.1|2247887_2248655_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	4.5e-35
AYE59650.1|2248693_2248957_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	37.5	6.8e-07
>prophage 13
CP023490	Lactobacillus plantarum strain NCIMB 700965 chromosome, complete genome	3015495	2315053	2370239	3015495	transposase,protease	unidentified_phage(40.0%)	39	NA	NA
AYE59705.1|2315053_2315983_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	29.9	1.5e-19
AYE59706.1|2316333_2317011_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AYE59707.1|2317025_2317682_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AYE59708.1|2317752_2319609_-	potassium transporter	NA	NA	NA	NA	NA
AYE59709.1|2319630_2320698_-	phosphohydrolase	NA	NA	NA	NA	NA
AYE59710.1|2320716_2321364_-	cytochrome O ubiquinol oxidase	NA	NA	NA	NA	NA
AYE59711.1|2321595_2323902_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AYE59712.1|2324194_2325124_+	enoyl-[acyl-carrier-protein] reductase FabK	NA	NA	NA	NA	NA
AYE59713.1|2325292_2326222_+	type I pantothenate kinase	NA	NA	NA	NA	NA
AYE59714.1|2326315_2327872_+	GMP synthase (glutamine-hydrolyzing)	NA	A0A1V0SH76	Hokovirus	29.2	5.6e-16
AYE59715.1|2330034_2330796_-	hypothetical protein	NA	NA	NA	NA	NA
AYE59716.1|2331038_2331737_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYE59717.1|2331956_2332301_+	transcriptional regulator	NA	NA	NA	NA	NA
AYE59718.1|2332432_2333731_-	MFS transporter	NA	NA	NA	NA	NA
AYE59719.1|2336577_2336892_-	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	36.0	3.3e-08
AYE59720.1|2339799_2340390_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59721.1|2342473_2342857_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59722.1|2342846_2344694_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	23.3	3.4e-20
AYE59723.1|2344934_2345189_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AYE59724.1|2345200_2345746_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
AYE59725.1|2345758_2345941_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59726.1|2345955_2346378_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AYE59727.1|2346438_2346879_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AYE59728.1|2346928_2347408_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYE59729.1|2348484_2349495_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
AYE59730.1|2349587_2350511_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-32
AYE59731.1|2350914_2351247_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AYE59732.1|2353314_2354241_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	31.4	8.5e-20
AYE59733.1|2354241_2356413_+	TIGR02687 family protein	NA	NA	NA	NA	NA
AYE59734.1|2356535_2359070_+	peptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.3	1.2e-68
AYE59735.1|2360441_2360651_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59736.1|2360647_2361196_+	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	39.8	1.6e-29
AYE59737.1|2361773_2362694_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	37.4	2.9e-28
AYE59738.1|2363165_2363354_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59739.1|2364040_2364571_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AYE59740.1|2364685_2368459_-	mucus-binding protein	NA	NA	NA	NA	NA
AYE59741.1|2368664_2368787_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59742.1|2368830_2369457_-	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	44.7	1.4e-37
AYE59743.1|2369711_2370239_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
CP023490	Lactobacillus plantarum strain NCIMB 700965 chromosome, complete genome	3015495	2511430	2572894	3015495	tRNA,transposase	Bacillus_phage(23.53%)	50	NA	NA
AYE59872.1|2511430_2512354_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.3e-32
AYE59873.1|2512454_2513882_+	amino acid permease	NA	NA	NA	NA	NA
AYE59874.1|2514002_2514584_+	ECF transporter S component	NA	NA	NA	NA	NA
AYE59875.1|2514676_2514853_-	hypothetical protein	NA	NA	NA	NA	NA
AYE59876.1|2518054_2519494_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AYE59877.1|2519486_2520482_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AYE59878.1|2520610_2522344_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	22.5	2.1e-19
AYE59879.1|2522343_2524104_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.3	3.7e-24
AYE59880.1|2524200_2524305_+	ribosome recycling factor	NA	NA	NA	NA	NA
AYE59881.1|2524309_2525287_-	hypothetical protein	NA	NA	NA	NA	NA
AYE59882.1|2525477_2526455_-	heptaprenyl diphosphate synthase	NA	NA	NA	NA	NA
AYE59883.1|2526599_2527514_+	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
AYE59884.1|2527739_2528267_+|transposase	transposase	transposase	NA	NA	NA	NA
AYE60367.1|2528521_2529148_+	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	44.7	1.4e-37
AYE59885.1|2529220_2530195_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AYE59886.1|2530641_2531283_+	cell wall hydrolase	NA	S5M633	Brevibacillus_phage	42.0	6.7e-24
AYE59887.1|2531333_2531921_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AYE59888.1|2531943_2532492_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59889.1|2532604_2533774_+	phosphoribosylaminoimidazole carboxylase	NA	NA	NA	NA	NA
AYE59890.1|2534214_2536482_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.7	4.8e-133
AYE59891.1|2536498_2538538_+	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	33.3	4.7e-95
AYE59892.1|2538534_2539710_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
AYE59893.1|2539750_2540071_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit C	tRNA	NA	NA	NA	NA
AYE59894.1|2540070_2541534_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A	tRNA	NA	NA	NA	NA
AYE59895.1|2541533_2542958_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit B	tRNA	NA	NA	NA	NA
AYE59896.1|2543062_2544085_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	26.5	2.6e-17
AYE59897.1|2544418_2545792_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	49.8	5.5e-124
AYE59898.1|2546247_2546823_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYE59899.1|2547089_2549429_+	magnesium-transporting ATPase	NA	M1HI01	Paramecium_bursaria_Chlorella_virus	24.8	1.6e-38
AYE59900.1|2551993_2552872_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AYE59901.1|2552896_2553673_+	lysozyme	NA	A0A141HSE6	Bacillus_phage	31.1	2.6e-06
AYE59902.1|2553828_2554194_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
AYE59903.1|2554537_2554738_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	3.1e-20
AYE59904.1|2554924_2555932_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AYE59905.1|2555944_2557279_+	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.9	2.2e-37
AYE59906.1|2557561_2558002_-	universal stress protein	NA	NA	NA	NA	NA
AYE59907.1|2558135_2559443_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
AYE59908.1|2559435_2560302_+	acyltransferase	NA	NA	NA	NA	NA
AYE59909.1|2560451_2560652_-	hypothetical protein	NA	NA	NA	NA	NA
AYE59910.1|2560850_2561291_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59911.1|2561724_2562288_+	hypothetical protein	NA	NA	NA	NA	NA
AYE59912.1|2562370_2563207_-|transposase	transposase	transposase	U5P429	Shigella_phage	28.5	2.2e-19
AYE59913.1|2563254_2563962_-|transposase	transposase	transposase	NA	NA	NA	NA
AYE59914.1|2564077_2565424_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
AYE59915.1|2565691_2566867_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
AYE59916.1|2567055_2568174_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	31.3	7.1e-21
AYE59917.1|2568551_2569481_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
AYE59918.1|2569670_2570387_+	aquaporin family protein	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	33.1	2.5e-19
AYE59919.1|2570455_2571604_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AYE59920.1|2571964_2572894_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
>prophage 1
CP023491	Lactobacillus plantarum strain NCIMB 700965 plasmid unamed1, complete sequence	66439	19546	54955	66439	transposase,holin,protease	Streptococcus_phage(20.0%)	31	NA	NA
AYE60393.1|19546_20182_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYE60394.1|20462_20567_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AYE60395.1|21007_21145_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AYE60396.1|23989_24292_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60397.1|24322_24952_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60398.1|25027_25993_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60399.1|25989_26184_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60400.1|26186_26792_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60401.1|26794_28579_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	33.7	6.8e-82
AYE60402.1|28645_28960_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60403.1|29055_31170_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60404.1|31179_31968_+	sortase	NA	NA	NA	NA	NA
AYE60405.1|31996_34939_+	cell surface protein	NA	NA	NA	NA	NA
AYE60406.1|35015_35312_+	hypothetical protein	NA	NA	NA	NA	NA
AYE60407.1|35624_36554_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	27.4	4.1e-22
AYE60408.1|36870_38046_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	5.3e-27
AYE60409.1|38243_39023_+	chain-length determining protein	NA	NA	NA	NA	NA
AYE60410.1|39034_39763_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYE60411.1|39749_40523_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
AYE60412.1|40765_41335_+	resolvase	NA	A0A1J1J8Z4	Escherichia_phage	45.7	7.0e-33
AYE60413.1|41822_42254_-	universal stress protein	NA	NA	NA	NA	NA
AYE60414.1|42253_43846_-	divalent metal cation transporter	NA	NA	NA	NA	NA
AYE60415.1|43969_44623_+	Mn-dependent transcriptional regulator	NA	NA	NA	NA	NA
AYE60416.1|45963_48093_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	91.0	0.0e+00
AYE60417.1|48085_48454_-	transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	77.9	4.5e-49
AYE60418.1|48659_49676_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	32.2	3.3e-33
AYE60419.1|49914_51222_-	Uric acid permease PucJ	NA	NA	NA	NA	NA
AYE60420.1|51644_52559_-	hypothetical protein	NA	S5VTD3	Leptospira_phage	37.3	3.4e-37
AYE60421.1|52552_53352_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AYE60422.1|53807_54698_-	hypothetical protein	NA	Q6J1X2	Lactobacillus_phage	99.3	4.2e-157
AYE60423.1|54703_54955_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
