The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029458	Clostridium novyi strain 150557 chromosome, complete genome	2296219	472301	480394	2296219		Bacillus_phage(33.33%)	6	NA	NA
AYF53617.1|472301_473711_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.7	4.0e-21
AYF53618.1|473715_474402_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.7	1.1e-35
AYF53619.1|474661_475681_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	42.2	4.3e-65
AYF53620.1|475907_477206_-	hypothetical protein	NA	M1NSC5	Streptococcus_phage	24.6	3.4e-06
AYF53621.1|477216_478170_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	35.8	5.6e-43
AYF53622.1|479509_480394_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.6	9.3e-08
>prophage 2
CP029458	Clostridium novyi strain 150557 chromosome, complete genome	2296219	494285	502207	2296219		Moraxella_phage(16.67%)	9	NA	NA
AYF53633.1|494285_495542_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	26.5	1.2e-19
AYF53634.1|495680_496571_-	ABC transporter permease	NA	NA	NA	NA	NA
AYF53635.1|496560_497247_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	33.7	3.4e-26
AYF53636.1|497342_498206_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	33.0	3.3e-34
AYF53637.1|498402_499344_-	transketolase family protein	NA	NA	NA	NA	NA
AYF53638.1|499343_500168_-	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	33.3	4.7e-14
AYF53639.1|500267_500615_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5RCS0	Lactobacillus_phage	38.6	8.9e-15
AYF53640.1|500574_500901_-	hypothetical protein	NA	NA	NA	NA	NA
AYF53641.1|501043_502207_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.8	3.6e-36
>prophage 3
CP029458	Clostridium novyi strain 150557 chromosome, complete genome	2296219	808522	824372	2296219	protease	Streptococcus_phage(40.0%)	13	NA	NA
AYF53919.1|808522_809767_+	aminoacetone oxidase family FAD-binding enzyme	NA	A0A2H4PQX1	Staphylococcus_phage	35.7	9.7e-11
AYF53920.1|809821_810565_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
AYF53921.1|810651_810843_-	DUF1858 domain-containing protein	NA	NA	NA	NA	NA
AYF53922.1|810911_812195_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	33.8	1.1e-62
AYF53923.1|812279_813686_-	FAD-dependent oxidoreductase	NA	A0A218MMS0	uncultured_virus	25.6	4.6e-25
AYF53924.1|813946_814753_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	36.6	4.2e-39
AYF53925.1|814905_816045_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.9	1.3e-73
AYF53926.1|816057_817311_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	52.6	3.9e-108
AYF53927.1|817586_817799_-	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	50.0	1.4e-07
AYF53928.1|818883_819720_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	33.9	3.1e-37
AYF53929.1|819736_820594_-	DegV family protein	NA	NA	NA	NA	NA
AYF53930.1|821101_822436_-	replicative DNA helicase	NA	O80281	Escherichia_phage	47.4	6.5e-106
AYF53931.1|822464_824372_-|protease	ATP-dependent protease, Lon family	protease	A0A0R6PGP8	Moraxella_phage	28.5	5.4e-29
>prophage 5
CP029458	Clostridium novyi strain 150557 chromosome, complete genome	2296219	1543845	1605388	2296219	integrase,coat,protease,transposase	Bacillus_phage(20.0%)	54	1551031:1551061	1567152:1567182
AYF54522.1|1543845_1544949_-|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
AYF54523.1|1545274_1547062_+	DNA primase	NA	A0A1S5RH70	Helicobacter_phage	28.6	1.7e-40
AYF54524.1|1547067_1548174_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	37.4	7.0e-37
AYF54525.1|1548250_1549141_+	hypothetical protein	NA	NA	NA	NA	NA
AYF54526.1|1549151_1549841_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYF54527.1|1549831_1550647_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
1551031:1551061	attL	AATACAGAACTCGGCTTATAGACTTATCTCG	NA	NA	NA	NA
AYF54528.1|1551146_1552292_-|integrase	site-specific integrase	integrase	A0A0A8WIE1	Clostridium_phage	37.8	3.8e-62
AYF54529.1|1552336_1552879_-	XRE family transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	31.1	1.0e-09
AYF54530.1|1553155_1553338_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYF54531.1|1553353_1553563_+	DNA-binding protein	NA	A0A2I7SCU5	Paenibacillus_phage	60.3	1.8e-10
AYF54532.1|1553590_1553800_+	DNA-binding protein	NA	NA	NA	NA	NA
AYF55231.1|1553831_1554650_+	chromosomal replication initiator DnaA	NA	A6M985	Geobacillus_virus	39.4	6.7e-45
AYF54533.1|1554918_1555137_-	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
AYF54534.1|1555150_1555366_-	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
AYF54535.1|1555438_1555666_-	hypothetical protein	NA	NA	NA	NA	NA
AYF54536.1|1556292_1556832_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AYF54537.1|1557152_1557347_+	hypothetical protein	NA	NA	NA	NA	NA
AYF54538.1|1557432_1558605_+	hypothetical protein	NA	R4TMW4	Halovirus	31.6	2.1e-39
AYF54539.1|1558616_1559603_+	DNA (cytosine-5-)-methyltransferase	NA	Q6DMX0	Streptococcus_phage	42.9	2.6e-59
AYF54540.1|1559615_1560425_-	hypothetical protein	NA	NA	NA	NA	NA
AYF54541.1|1560433_1561177_-	hypothetical protein	NA	NA	NA	NA	NA
AYF54542.1|1561808_1563302_+|transposase	transposase	transposase	A0A142F1Q5	Bacillus_phage	34.8	1.6e-36
AYF54543.1|1564473_1564740_+	hypothetical protein	NA	NA	NA	NA	NA
AYF54544.1|1565702_1565924_+	hypothetical protein	NA	A0A172JI00	Bacillus_phage	46.3	1.1e-13
AYF54545.1|1567721_1569716_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
1567152:1567182	attR	AATACAGAACTCGGCTTATAGACTTATCTCG	NA	NA	NA	NA
AYF54546.1|1570156_1571689_+	hypothetical protein	NA	NA	NA	NA	NA
AYF54547.1|1571810_1575362_-|protease	serine protease	protease	A0A217EQY2	Bacillus_phage	32.2	9.5e-11
AYF54548.1|1575589_1576816_-	sodium:proton antiporter	NA	NA	NA	NA	NA
AYF54549.1|1577079_1577679_+	hypothetical protein	NA	NA	NA	NA	NA
AYF54550.1|1577746_1578727_-	hypothetical protein	NA	NA	NA	NA	NA
AYF54551.1|1578851_1579796_-	hypothetical protein	NA	NA	NA	NA	NA
AYF54552.1|1579941_1580859_-	hypothetical protein	NA	NA	NA	NA	NA
AYF54553.1|1581082_1582411_+	DUF4300 domain-containing protein	NA	NA	NA	NA	NA
AYF54554.1|1582552_1583107_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYF54555.1|1583256_1584201_+	hypothetical protein	NA	NA	NA	NA	NA
AYF54556.1|1584272_1584890_-	hypothetical protein	NA	NA	NA	NA	NA
AYF54557.1|1585143_1585935_-	histidinol-phosphatase	NA	NA	NA	NA	NA
AYF54558.1|1586124_1586598_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
AYF54559.1|1586954_1587566_+	DUF3793 domain-containing protein	NA	NA	NA	NA	NA
AYF54560.1|1587732_1587957_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
AYF54561.1|1587971_1588214_+	iron transporter	NA	NA	NA	NA	NA
AYF54562.1|1588276_1590292_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
AYF54563.1|1590694_1591288_+	ECF transporter S component	NA	NA	NA	NA	NA
AYF55232.1|1591652_1592156_+	folate family ECF transporter S component	NA	NA	NA	NA	NA
AYF54564.1|1592603_1593995_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
AYF54565.1|1594191_1594887_+	YfcE family phosphodiesterase	NA	R4T9B5	Halovirus	27.2	9.8e-13
AYF54566.1|1594949_1595837_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYF54567.1|1596321_1596651_+	hypothetical protein	NA	NA	NA	NA	NA
AYF54568.1|1596669_1598022_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	M1NMR0	Moumouvirus	29.5	4.4e-33
AYF54569.1|1598250_1598706_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.7	4.0e-15
AYF54570.1|1600750_1600996_+	hypothetical protein	NA	NA	NA	NA	NA
AYF54571.1|1601363_1602167_+	hypothetical protein	NA	NA	NA	NA	NA
AYF54572.1|1602156_1602615_+	hypothetical protein	NA	NA	NA	NA	NA
AYF54573.1|1603975_1605388_-|transposase	transposase	transposase	G3MB42	Bacillus_virus	41.9	1.0e-88
>prophage 6
CP029458	Clostridium novyi strain 150557 chromosome, complete genome	2296219	2129206	2138944	2296219	tRNA	uncultured_Mediterranean_phage(83.33%)	10	NA	NA
AYF55071.1|2129206_2131399_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	37.6	8.2e-13
AYF55072.1|2131499_2132018_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.7	3.4e-26
AYF55073.1|2132098_2133010_-	delta(24)-sterol C-methyltransferase	NA	NA	NA	NA	NA
AYF55074.1|2133173_2134043_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.5	4.5e-39
AYF55075.1|2134043_2135315_-	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	27.9	6.2e-05
AYF55076.1|2135406_2136777_-	thioether cross-link-forming SCIFF peptide maturase	NA	NA	NA	NA	NA
AYF55077.1|2136847_2136985_-	six-cysteine peptide SCIFF	NA	NA	NA	NA	NA
AYF55078.1|2137059_2137428_-	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
AYF55079.1|2137486_2137765_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	37.5	1.1e-07
AYF55080.1|2137813_2138944_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.7	5.0e-91
