The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032667	Escherichia coli str. K-12 substr. MG1655 chromosome, complete genome	4639694	1019143	1026282	4639694		Escherichia_phage(83.33%)	6	NA	NA
AYG18275.1|1019143_1019782_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AYG18276.1|1019873_1021040_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
AYG18277.1|1021036_1021945_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
AYG18278.1|1022140_1022908_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AYG18279.1|1022958_1023615_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
AYG18280.1|1023720_1026282_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
CP032667	Escherichia coli str. K-12 substr. MG1655 chromosome, complete genome	4639694	1406863	1418073	4639694	tail	Enterobacteria_phage(56.25%)	16	NA	NA
AYG18617.1|1406863_1407064_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AYG18618.1|1407195_1407501_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
AYG18619.1|1407500_1407863_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
AYG18620.1|1407853_1408390_-	HD family hydrolase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
AYG18621.1|1408517_1409342_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
AYG18622.1|1409407_1409770_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
AYG18623.1|1410492_1410987_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
AYG18624.1|1410986_1411262_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
AYG21527.1|1411311_1411830_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
AYG18625.1|1411856_1412297_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
AYG18626.1|1412268_1412613_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	86.2	3.1e-44
AYG18627.1|1412911_1414243_-	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
AYG18628.1|1414239_1415160_-	glycosyltransferase	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
AYG18629.1|1415156_1415519_-	glucose translocase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
AYG18630.1|1415671_1416829_-	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	100.0	5.7e-223
AYG18631.1|1417140_1418073_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
>prophage 3
CP032667	Escherichia coli str. K-12 substr. MG1655 chromosome, complete genome	4639694	1665966	1675407	4639694		Enterobacteria_phage(85.71%)	10	NA	NA
AYG18845.1|1665966_1666893_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
AYG18846.1|1666897_1667629_+	ABC transporter permease	NA	NA	NA	NA	NA
AYG18847.1|1667609_1667717_-	protein YohO	NA	NA	NA	NA	NA
AYG18848.1|1667776_1668508_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AYG18849.1|1668729_1670415_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AYG18850.1|1670411_1671131_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYG18851.1|1671177_1671648_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AYG18852.1|1671687_1672149_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AYG18853.1|1672429_1674274_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.9	0.0e+00
AYG18854.1|1674270_1675407_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 4
CP032667	Escherichia coli str. K-12 substr. MG1655 chromosome, complete genome	4639694	1767475	1776146	4639694		Enterobacteria_phage(28.57%)	8	NA	NA
AYG18928.1|1767475_1768870_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
AYG18929.1|1769044_1769938_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AYG18930.1|1770310_1771396_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
AYG18931.1|1771395_1772295_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
AYG18932.1|1772352_1773234_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
AYG18933.1|1773233_1773791_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
AYG18934.1|1773787_1775035_+	O16 family O-antigen flippase	NA	NA	NA	NA	NA
AYG18935.1|1775042_1776146_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
>prophage 5
CP032667	Escherichia coli str. K-12 substr. MG1655 chromosome, complete genome	4639694	2209815	2253144	4639694	terminase,integrase,lysis,tail,protease	Enterobacteria_phage(34.48%)	57	2217391:2217406	2243539:2243554
AYG19348.1|2209815_2210637_-|protease	serine protease	protease	NA	NA	NA	NA
AYG19349.1|2210736_2210820_-	hypothetical protein	NA	NA	NA	NA	NA
AYG19350.1|2210912_2211248_-	acid shock protein	NA	NA	NA	NA	NA
AYG19351.1|2211644_2212898_-	MFS transporter	NA	NA	NA	NA	NA
AYG19352.1|2213004_2213898_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYG19353.1|2214032_2215253_+	protein mlc	NA	NA	NA	NA	NA
AYG19354.1|2215377_2216073_+	dethiobiotin synthase	NA	NA	NA	NA	NA
AYG21555.1|2216025_2217318_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2217391:2217406	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
AYG19355.1|2217476_2218091_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AYG19356.1|2218133_2218988_-	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AYG19357.1|2218989_2219607_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AYG21556.1|2219617_2222041_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
AYG19358.1|2222101_2224528_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
AYG19359.1|2224726_2225032_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AYG21557.1|2225139_2225850_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AYG19360.1|2225852_2226413_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AYG19361.1|2226447_2226789_-	DUF1283 family protein	NA	NA	NA	NA	NA
AYG19362.1|2226923_2227250_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AYG19363.1|2227455_2228670_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AYG19364.1|2228681_2229701_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AYG19365.1|2229758_2229869_+	transporter	NA	NA	NA	NA	NA
AYG19366.1|2229888_2231085_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	59.0	1.8e-134
AYG19367.1|2232611_2232803_-	DUF1482 family protein	NA	NA	NA	NA	NA
AYG19368.1|2232799_2232988_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AYG19369.1|2233555_2233774_-	hypothetical protein	NA	NA	NA	NA	NA
AYG19370.1|2233803_2233974_-	hypothetical protein	NA	NA	NA	NA	NA
AYG19371.1|2233933_2234089_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AYG19372.1|2234255_2234663_-	transcriptional regulator	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
AYG19373.1|2234746_2234977_+	division inhibition gene dicB repressor	NA	NA	NA	NA	NA
AYG19374.1|2235859_2236192_-	protein FlxA	NA	NA	NA	NA	NA
AYG19375.1|2236394_2236700_-	hypothetical protein	NA	NA	NA	NA	NA
AYG19376.1|2236724_2236964_+	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AYG19377.1|2236963_2237251_+	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AYG19378.1|2237322_2237478_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AYG19379.1|2237694_2237946_+	hypothetical protein	NA	NA	NA	NA	NA
AYG19380.1|2238012_2238291_+	hypothetical protein	NA	NA	NA	NA	NA
AYG19381.1|2238292_2239342_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	5.7e-113
AYG19382.1|2239355_2240108_+	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AYG19383.1|2240529_2240742_-	cold-shock protein CspF	NA	NA	NA	NA	NA
AYG19384.1|2241042_2241258_+	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AYG19385.1|2242011_2242227_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AYG19386.1|2242231_2242543_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AYG19387.1|2242539_2243073_+	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AYG19388.1|2243069_2243567_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2243539:2243554	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
AYG19389.1|2243929_2244142_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AYG19390.1|2244152_2244341_+	cold-shock protein	NA	NA	NA	NA	NA
AYG19391.1|2244487_2244643_+	hypothetical protein	NA	NA	NA	NA	NA
AYG19392.1|2244814_2244988_+	protein GnsB	NA	NA	NA	NA	NA
AYG19393.1|2245139_2245550_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AYG19394.1|2245607_2245841_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AYG19395.1|2246229_2246799_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
AYG19396.1|2246749_2247712_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
AYG19397.1|2247711_2248287_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
AYG19398.1|2248384_2248975_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AYG19399.1|2249291_2249525_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AYG19400.1|2250311_2251595_+	MFS transporter	NA	NA	NA	NA	NA
AYG19401.1|2251683_2253144_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
>prophage 6
CP032667	Escherichia coli str. K-12 substr. MG1655 chromosome, complete genome	4639694	2445705	2476036	4639694	tail,transposase,tRNA	Escherichia_phage(42.86%)	34	NA	NA
AYG19552.1|2445705_2446839_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
AYG19553.1|2446979_2447414_+	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
AYG19554.1|2448374_2448608_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
AYG19555.1|2448924_2449515_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AYG19556.1|2449612_2450188_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
AYG19557.1|2450187_2453550_-|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
AYG21565.1|2453614_2453830_-	hypothetical protein	NA	Q687E7	Enterobacteria_phage	98.4	1.4e-29
AYG19558.1|2453872_2454853_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
AYG19559.1|2456310_2456511_-	hypothetical protein	NA	NA	NA	NA	NA
AYG19560.1|2456618_2456978_-	hypothetical protein	NA	NA	NA	NA	NA
AYG19561.1|2456958_2457222_-	hypothetical protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
AYG19562.1|2457359_2458817_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
AYG19563.1|2459013_2459199_-	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
AYG19564.1|2459869_2460616_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
AYG19565.1|2460622_2461480_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
AYG19566.1|2461492_2461915_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
AYG19567.1|2461937_2462234_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
AYG19568.1|2462357_2462834_+	Rac prophage repressor	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
AYG19569.1|2463097_2463277_+	hypothetical protein	NA	NA	NA	NA	NA
AYG19570.1|2463287_2463443_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AYG21566.1|2463439_2463928_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
AYG19571.1|2464369_2464591_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
AYG21567.1|2464590_2464761_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AYG19572.1|2464835_2465111_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AYG19573.1|2465212_2467813_+	exodeoxyribonuclease 8	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
AYG19574.1|2467805_2468615_+	DNA recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
AYG19575.1|2468671_2468866_+	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AYG19576.1|2468858_2469068_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
AYG19577.1|2469146_2469362_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AYG19578.1|2469363_2470599_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
AYG19579.1|2470650_2471586_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AYG19580.1|2471714_2473088_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AYG19581.1|2473565_2474549_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AYG21568.1|2474803_2476036_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 7
CP032667	Escherichia coli str. K-12 substr. MG1655 chromosome, complete genome	4639694	2667340	2681721	4639694	tail,portal,integrase,plate	Shigella_phage(33.33%)	23	2664716:2664729	2682747:2682760
2664716:2664729	attL	AAAATAAGATGAAT	NA	NA	NA	NA
AYG19750.1|2667340_2668072_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
AYG19751.1|2668292_2668697_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AYG19752.1|2669396_2669720_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
AYG19753.1|2669822_2669987_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
AYG19754.1|2670220_2671054_-	5-methylcytosine-specific restriction enzyme A	NA	NA	NA	NA	NA
AYG19755.1|2671160_2671715_-	DNA-invertase from lambdoid prophage e14	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
AYG19756.1|2672123_2672537_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
AYG19757.1|2672508_2673111_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
AYG19758.1|2673110_2673899_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
AYG19759.1|2673902_2674487_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	98.5	2.0e-112
AYG19760.1|2674477_2675269_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
AYG19761.1|2675195_2675669_-|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
AYG19762.1|2675668_2675851_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
AYG19763.1|2675862_2677230_-	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
AYG19764.1|2677219_2677399_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AYG19765.1|2677574_2678132_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
AYG19766.1|2678175_2678376_-	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
AYG19767.1|2678466_2679141_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
AYG19768.1|2679315_2679624_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
AYG19769.1|2679561_2679903_-	hypothetical protein	NA	NA	NA	NA	NA
AYG19770.1|2680019_2680331_+	hypothetical protein	NA	NA	NA	NA	NA
AYG19771.1|2680367_2680613_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
AYG19772.1|2680593_2681721_+|integrase	integrase	integrase	O21925	Phage_21	61.5	7.2e-122
2682747:2682760	attR	AAAATAAGATGAAT	NA	NA	NA	NA
>prophage 8
CP032667	Escherichia coli str. K-12 substr. MG1655 chromosome, complete genome	4639694	3272403	3316766	4639694	transposase,terminase,integrase,lysis,capsid,protease	Enterobacteria_phage(57.69%)	50	3295478:3295524	3316780:3316826
AYG20290.1|3272403_3273516_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AYG20291.1|3273592_3273745_-	protein HokE	NA	NA	NA	NA	NA
AYG20292.1|3274036_3274186_-	hypothetical protein	NA	NA	NA	NA	NA
AYG20293.1|3274197_3275316_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AYG20294.1|3275381_3275630_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
AYG20295.1|3275694_3276063_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AYG20296.1|3276156_3276810_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AYG20297.1|3276917_3278165_+	miniconductance mechanosensitive channel YbdG	NA	NA	NA	NA	NA
AYG20298.1|3278245_3279622_-	phenylalanine-specific permease	NA	NA	NA	NA	NA
AYG20299.1|3279723_3282867_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
AYG20300.1|3282878_3284102_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
AYG20301.1|3284117_3284450_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone	NA	NA	NA	NA	NA
AYG20302.1|3284607_3285981_-	cation efflux system protein CusC	NA	NA	NA	NA	NA
AYG20303.1|3286137_3286821_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
AYG20304.1|3286810_3288253_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
AYG20305.1|3288402_3290640_+	bacteriophage N4 adsorption protein B	NA	NA	NA	NA	NA
AYG20306.1|3290626_3293599_+	bacteriophage N4 adsorption protein A	NA	NA	NA	NA	NA
AYG20307.1|3293599_3294490_+	DUF4434 family protein	NA	NA	NA	NA	NA
AYG20308.1|3294672_3295434_+	porin thermoregulatory protein EnvY	NA	NA	NA	NA	NA
3295478:3295524	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
AYG20309.1|3295947_3296901_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
AYG20310.1|3297150_3297900_-	transcriptional regulator	NA	NA	NA	NA	NA
AYG20311.1|3298802_3299429_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYG20312.1|3299373_3299511_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AYG20313.1|3299483_3300227_-|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
AYG20314.1|3300201_3300747_-	DNA-packaging protein NU1	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
AYG20315.1|3301135_3301330_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
AYG20316.1|3301494_3301701_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
AYG20317.1|3301986_3302397_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
AYG20318.1|3302687_3302981_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
AYG20319.1|3303012_3303474_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	97.4	3.9e-74
AYG20320.1|3303470_3303968_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
AYG20321.1|3303967_3304183_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AYG20322.1|3304755_3305823_+	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
AYG20323.1|3305827_3306844_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AYG20324.1|3306881_3307100_-	hypothetical protein	NA	Q38586	Enterobacteria_phage	70.2	1.1e-13
AYG20325.1|3307241_3307625_-	antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
AYG20326.1|3307710_3307851_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
AYG20327.1|3307847_3308210_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AYG20328.1|3308206_3308497_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
AYG20329.1|3308489_3308660_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AYG20330.1|3308659_3309115_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
AYG20331.1|3309111_3309213_-	hypothetical protein	NA	NA	NA	NA	NA
AYG20332.1|3309329_3310127_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYG20333.1|3310136_3310688_-	kinase inhibitor	NA	NA	NA	NA	NA
AYG20334.1|3311152_3312679_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
AYG20335.1|3312933_3313266_-	multidrug SMR transporter	NA	NA	NA	NA	NA
AYG20336.1|3313576_3314739_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AYG20337.1|3314801_3314897_-	protein ren	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
AYG20338.1|3315219_3315483_+	hypothetical protein	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
AYG20339.1|3315602_3316766_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
3316780:3316826	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 9
CP032667	Escherichia coli str. K-12 substr. MG1655 chromosome, complete genome	4639694	3550805	3611699	4639694	transposase,holin	Acinetobacter_phage(22.22%)	52	NA	NA
AYG20546.1|3550805_3552839_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
AYG20547.1|3552967_3553555_+	transcriptional regulator	NA	NA	NA	NA	NA
AYG20548.1|3553568_3555041_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AYG20549.1|3555054_3556725_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
AYG20550.1|3556937_3557606_+	hypothetical protein	NA	NA	NA	NA	NA
AYG20551.1|3557681_3557894_+	hypothetical protein	NA	NA	NA	NA	NA
AYG20552.1|3557848_3558544_-	lactate utilization protein C	NA	NA	NA	NA	NA
AYG20553.1|3558536_3559964_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AYG20554.1|3559974_3560694_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
AYG20555.1|3561220_3562075_-	transcriptional regulator	NA	NA	NA	NA	NA
AYG20556.1|3562300_3563626_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
AYG20557.1|3563734_3563971_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYG20558.1|3563982_3564576_+	protein RclC	NA	NA	NA	NA	NA
AYG20559.1|3565848_3567011_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AYG20560.1|3567057_3567945_-	attaching and effacing-like protein	NA	NA	NA	NA	NA
AYG20561.1|3569059_3569161_+	hypothetical protein	NA	NA	NA	NA	NA
AYG20562.1|3569524_3569788_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AYG20563.1|3569787_3569928_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AYG20564.1|3569962_3570190_-	hypothetical protein	NA	NA	NA	NA	NA
AYG20565.1|3570965_3571556_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AYG20566.1|3571630_3572218_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
AYG20567.1|3572275_3572944_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
AYG20568.1|3572969_3575495_+	usher protein EcpC	NA	NA	NA	NA	NA
AYG20569.1|3575484_3577128_+	fimbria adhesin EcpD	NA	NA	NA	NA	NA
AYG20570.1|3577096_3577807_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
AYG20571.1|3578119_3578449_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AYG20572.1|3578696_3579311_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AYG20573.1|3579728_3580418_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AYG20574.1|3580414_3581371_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
AYG20575.1|3581367_3583566_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
AYG20576.1|3583575_3584532_+	XdhC family protein	NA	NA	NA	NA	NA
AYG20577.1|3584510_3584921_+	hypothetical protein	NA	NA	NA	NA	NA
AYG20578.1|3585205_3586606_+	DUF4102 domain-containing protein	NA	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
AYG20579.1|3586722_3587163_+	hypothetical protein	NA	NA	NA	NA	NA
AYG20580.1|3587159_3587384_+	DNA-binding protein	NA	NA	NA	NA	NA
AYG20581.1|3587502_3588357_+	hypothetical protein	NA	NA	NA	NA	NA
AYG20582.1|3588383_3589082_+	recombinase family protein	NA	NA	NA	NA	NA
AYG20583.1|3589353_3589980_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AYG20584.1|3590070_3590802_-	hypothetical protein	NA	NA	NA	NA	NA
AYG20585.1|3591996_3593001_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AYG20586.1|3593139_3593898_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AYG20587.1|3593902_3595513_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
AYG20588.1|3595524_3596907_-	MFS transporter	NA	NA	NA	NA	NA
AYG20589.1|3597133_3599101_-	YjhG/YagF family D-xylonate dehydratase	NA	NA	NA	NA	NA
AYG20590.1|3599115_3600024_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AYG20591.1|3600318_3601473_+|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
AYG20592.1|3601566_3601917_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AYG20593.1|3603499_3604546_+	Fe(3+) ions import ATP-binding protein FbpC	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
AYG20594.1|3604654_3605587_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AYG21608.1|3605573_3606977_-	S-methylmethionine permease	NA	NA	NA	NA	NA
AYG20595.1|3607184_3608201_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AYG20596.1|3610547_3611699_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
