The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032684	Rhizobium sp. CCGE531 chromosome, complete genome	4041163	1705914	1719490	4041163	tRNA	uncultured_Mediterranean_phage(90.0%)	14	NA	NA
AYG68150.1|1705914_1706928_+	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	44.3	3.5e-27
AYG68151.1|1706998_1707796_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	36.4	1.3e-32
AYG68152.1|1707833_1708526_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.9	1.8e-38
AYG66015.1|1708559_1708751_+	hypothetical protein	NA	NA	NA	NA	NA
AYG66016.1|1708806_1709022_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	55.6	3.8e-08
AYG66017.1|1709077_1709779_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AYG66018.1|1709775_1710603_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	46.5	4.9e-51
AYG66019.1|1710702_1711986_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.3	1.0e-95
AYG66020.1|1712001_1712766_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	31.3	2.5e-25
AYG66021.1|1712770_1713424_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.8	1.4e-16
AYG66022.1|1713593_1715282_+	LysM peptidoglycan-binding domain-containing protein	NA	I3PV24	Clostridium_phage	35.4	3.3e-14
AYG68153.1|1715360_1716233_-	ATP-binding protein	NA	NA	NA	NA	NA
AYG66023.1|1716439_1716787_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AYG66024.1|1716946_1719490_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	48.2	7.4e-58
>prophage 2
CP032684	Rhizobium sp. CCGE531 chromosome, complete genome	4041163	1796977	1846339	4041163	transposase,tRNA,integrase	Leptospira_phage(12.5%)	40	1797019:1797033	1851547:1851561
AYG66085.1|1796977_1797361_+|transposase	transposase	transposase	NA	NA	NA	NA
1797019:1797033	attL	GACGGCGGAGCCGGT	NA	NA	NA	NA
AYG66086.1|1797357_1797702_+|transposase	transposase	transposase	S5WJH4	Leptospira_phage	36.8	2.1e-08
AYG66087.1|1797777_1799376_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	32.6	2.7e-50
AYG66088.1|1799858_1800650_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYG66089.1|1800775_1802395_-	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	29.2	1.3e-20
AYG66090.1|1802418_1803300_-	GHMP kinase	NA	NA	NA	NA	NA
AYG66091.1|1803853_1804861_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
AYG66092.1|1804857_1805202_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
AYG66093.1|1805201_1805483_+	conjugal transfer protein	NA	NA	NA	NA	NA
AYG66094.1|1805492_1807997_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
AYG66095.1|1807993_1808764_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
AYG66096.1|1808777_1809095_+	hypothetical protein	NA	NA	NA	NA	NA
AYG66097.1|1809091_1810447_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
AYG66098.1|1810443_1811133_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
AYG68162.1|1811153_1812194_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
AYG66099.1|1812190_1813387_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
AYG66100.1|1813383_1813638_+	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
AYG68163.1|1813708_1816831_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
AYG66101.1|1816827_1818690_-	hypothetical protein	NA	NA	NA	NA	NA
AYG68164.1|1818679_1819846_-	hypothetical protein	NA	NA	NA	NA	NA
AYG66102.1|1819957_1823356_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AYG68165.1|1823355_1826010_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
AYG66103.1|1826176_1826620_-	hypothetical protein	NA	NA	NA	NA	NA
AYG66104.1|1826616_1827789_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
AYG66105.1|1827763_1828519_-	hypothetical protein	NA	NA	NA	NA	NA
AYG66106.1|1828600_1832002_-	ImmA/IrrE family metallo-endopeptidase	NA	A7KV33	Bacillus_phage	26.6	4.6e-47
AYG66107.1|1832003_1832588_-	hypothetical protein	NA	NA	NA	NA	NA
AYG66108.1|1832584_1833436_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYG66109.1|1833567_1834101_-|tRNA	methionyl-tRNA formyltransferase-like protein	tRNA	NA	NA	NA	NA
AYG66110.1|1834401_1838469_+	restriction endonuclease	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	24.5	3.2e-47
AYG66111.1|1838834_1840487_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.4	1.5e-80
AYG66112.1|1840549_1840903_-|transposase	transposase	transposase	NA	NA	NA	NA
AYG66113.1|1840899_1841343_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AYG66114.1|1841604_1841784_+	hypothetical protein	NA	NA	NA	NA	NA
AYG68166.1|1841795_1843043_-	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
AYG68167.1|1843068_1843851_-	DUF5131 family protein	NA	A0A2P1A0W3	Gordonia_phage	45.1	3.3e-49
AYG66115.1|1843901_1844279_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYG66116.1|1844283_1844649_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AYG66117.1|1844645_1845089_-	nuclease	NA	NA	NA	NA	NA
AYG66118.1|1845085_1846339_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	65.1	5.3e-158
1851547:1851561	attR	ACCGGCTCCGCCGTC	NA	NA	NA	NA
>prophage 3
CP032684	Rhizobium sp. CCGE531 chromosome, complete genome	4041163	1871334	1923416	4041163	transposase,integrase,protease	uncultured_Mediterranean_phage(21.43%)	49	1852386:1852402	1912919:1912935
1852386:1852402	attL	CGGCCTGACGCTCGCGT	NA	NA	NA	NA
AYG66128.1|1871334_1871754_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	47.8	2.4e-06
AYG66129.1|1871734_1872043_+	hypothetical protein	NA	NA	NA	NA	NA
AYG66130.1|1871963_1872380_+	hypothetical protein	NA	NA	NA	NA	NA
AYG66131.1|1872376_1874467_+	recombinase family protein	NA	NA	NA	NA	NA
AYG66132.1|1874420_1874699_+	hypothetical protein	NA	S5VXZ8	Leptospira_phage	41.5	2.1e-06
AYG66133.1|1874752_1876339_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	38.1	6.1e-26
AYG66134.1|1876862_1878104_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	67.1	3.5e-162
AYG66135.1|1879008_1879845_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AYG66136.1|1879847_1880597_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AYG66137.1|1880609_1882457_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
AYG66138.1|1882617_1883070_+	hypothetical protein	NA	NA	NA	NA	NA
AYG66139.1|1883292_1884510_+	LL-diaminopimelate aminotransferase	NA	NA	NA	NA	NA
AYG66140.1|1884567_1885887_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AYG68169.1|1885944_1887747_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.8	2.1e-54
AYG66141.1|1888534_1889329_-	hypothetical protein	NA	NA	NA	NA	NA
AYG66142.1|1889533_1889974_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
AYG66143.1|1890172_1890751_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	36.9	1.5e-06
AYG66144.1|1890752_1891271_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	31.7	3.5e-07
AYG66145.1|1891692_1891998_+	NADH-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AYG66146.1|1893079_1893853_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	2.3e-31
AYG66147.1|1893872_1895027_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYG66148.1|1895028_1896222_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYG66149.1|1896317_1897343_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	43.1	1.9e-81
AYG66150.1|1897715_1898906_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
AYG66151.1|1898906_1900070_-	salicylate hydroxylase	NA	NA	NA	NA	NA
AYG66152.1|1900098_1900344_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AYG68170.1|1900564_1901365_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYG68171.1|1901577_1902378_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AYG66153.1|1902454_1903318_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
AYG66154.1|1903443_1903647_+	DUF3126 family protein	NA	NA	NA	NA	NA
AYG66155.1|1903998_1904364_+	phasin family protein	NA	NA	NA	NA	NA
AYG66156.1|1904652_1905006_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.1	7.7e-14
AYG66157.1|1905016_1907548_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	2.8e-174
AYG66158.1|1907657_1908086_-	HIT family protein	NA	NA	NA	NA	NA
AYG66159.1|1908127_1909315_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYG66160.1|1909438_1910158_-	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	26.6	5.6e-11
AYG66161.1|1910157_1910625_-	RidA family protein	NA	NA	NA	NA	NA
AYG66162.1|1910760_1911588_+	DUF1849 family protein	NA	NA	NA	NA	NA
AYG66163.1|1911810_1912890_+	toxic anion resistance protein	NA	H6X3X9	Enterobacteria_phage	22.1	1.9e-10
AYG66164.1|1912895_1914470_+	VWA domain-containing protein	NA	NA	NA	NA	NA
1912919:1912935	attR	CGGCCTGACGCTCGCGT	NA	NA	NA	NA
AYG66165.1|1914579_1915197_+	5-bromo-4-chloroindolyl phosphate hydrolase	NA	NA	NA	NA	NA
AYG66166.1|1915196_1916303_+	hypothetical protein	NA	NA	NA	NA	NA
AYG66167.1|1916491_1917259_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
AYG66168.1|1917635_1918562_+	elongation factor Ts	NA	NA	NA	NA	NA
AYG66169.1|1918696_1919416_+	UMP kinase	NA	NA	NA	NA	NA
AYG66170.1|1919471_1920032_+	ribosome recycling factor	NA	NA	NA	NA	NA
AYG66171.1|1920141_1920885_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.1	6.8e-20
AYG66172.1|1920884_1921718_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AYG66173.1|1921742_1923416_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 4
CP032684	Rhizobium sp. CCGE531 chromosome, complete genome	4041163	2603806	2611777	4041163	terminase	uncultured_Caudovirales_phage(42.86%)	11	NA	NA
AYG66759.1|2603806_2604292_-	hypothetical protein	NA	W6EKF5	Rhizobium_phage	45.1	1.1e-29
AYG66760.1|2604295_2604727_-	hypothetical protein	NA	NA	NA	NA	NA
AYG66761.1|2604763_2605156_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
AYG66762.1|2605176_2605404_-	hypothetical protein	NA	NA	NA	NA	NA
AYG66763.1|2605400_2605757_-	hypothetical protein	NA	NA	NA	NA	NA
AYG66764.1|2605756_2606254_-	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	38.3	2.3e-16
AYG66765.1|2606326_2607298_-	DUF2184 domain-containing protein	NA	A0A2H4J526	uncultured_Caudovirales_phage	71.0	1.5e-131
AYG66766.1|2607301_2607772_-	hypothetical protein	NA	A0A2H4J1G1	uncultured_Caudovirales_phage	57.1	2.8e-35
AYG66767.1|2607799_2608915_-	DUF2213 domain-containing protein	NA	A0A2R3UA67	Siphoviridae_environmental_samples	40.7	2.2e-67
AYG66768.1|2609017_2610358_-	DUF1073 domain-containing protein	NA	L7TRA1	Rhizobium_phage	51.1	2.6e-118
AYG68233.1|2610406_2611777_-|terminase	terminase	terminase	H9C0U8	Aeromonas_phage	44.5	8.5e-93
>prophage 5
CP032684	Rhizobium sp. CCGE531 chromosome, complete genome	4041163	2716404	2778017	4041163	protease,holin,tRNA,transposase	Roseobacter_phage(12.5%)	58	NA	NA
AYG66864.1|2716404_2716881_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AYG66865.1|2717093_2718251_+	hypothetical protein	NA	NA	NA	NA	NA
AYG66866.1|2718336_2718594_-	hypothetical protein	NA	NA	NA	NA	NA
AYG66867.1|2718768_2719680_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
AYG66868.1|2719872_2720151_+	hypothetical protein	NA	NA	NA	NA	NA
AYG66869.1|2720297_2720483_+	DUF1059 domain-containing protein	NA	NA	NA	NA	NA
AYG66870.1|2720610_2721867_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A1B0V011	Roseobacter_phage	47.0	1.1e-49
AYG66871.1|2721863_2722499_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
AYG66872.1|2722495_2723119_-	DUF1285 domain-containing protein	NA	NA	NA	NA	NA
AYG66873.1|2723286_2724300_+	MoxR family ATPase	NA	NA	NA	NA	NA
AYG66874.1|2724326_2725247_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
AYG66875.1|2725243_2728069_+	DUF4159 domain-containing protein	NA	NA	NA	NA	NA
AYG66876.1|2728070_2730143_+	hypothetical protein	NA	NA	NA	NA	NA
AYG68246.1|2730145_2730571_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYG66877.1|2730713_2731286_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYG66878.1|2731634_2732624_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AYG66879.1|2732639_2733131_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AYG68247.1|2733181_2734120_+	metallophosphoesterase	NA	NA	NA	NA	NA
AYG66880.1|2734212_2734779_+	hypothetical protein	NA	NA	NA	NA	NA
AYG66881.1|2734987_2735500_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYG66882.1|2735512_2736346_+	anti-sigma factor	NA	NA	NA	NA	NA
AYG66883.1|2736444_2736648_+	hypothetical protein	NA	NA	NA	NA	NA
AYG66884.1|2736895_2738740_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	1.5e-31
AYG66885.1|2738813_2740520_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
AYG68248.1|2740848_2742033_-	benzoate transporter BenE	NA	NA	NA	NA	NA
AYG66886.1|2742223_2743009_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AYG68249.1|2743031_2744216_+	MFS transporter	NA	NA	NA	NA	NA
AYG66887.1|2744181_2744565_+	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
AYG66888.1|2744786_2745374_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	37.8	4.4e-30
AYG68250.1|2745606_2746416_+	DUF2076 domain-containing protein	NA	NA	NA	NA	NA
AYG66889.1|2746472_2746937_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	52.0	2.0e-30
AYG68251.1|2746937_2747852_-	cation transporter	NA	NA	NA	NA	NA
AYG68252.1|2748327_2748996_+	5,6-dimethylbenzimidazole synthase	NA	NA	NA	NA	NA
AYG66890.1|2749035_2749671_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
AYG68253.1|2749790_2750594_-	TIGR02117 family protein	NA	NA	NA	NA	NA
AYG66891.1|2750646_2752818_-	anthranilate synthase	NA	NA	NA	NA	NA
AYG66892.1|2753445_2753985_+	hypothetical protein	NA	NA	NA	NA	NA
AYG66893.1|2753985_2754456_+	hypothetical protein	NA	NA	NA	NA	NA
AYG66894.1|2754645_2756166_-	ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	23.0	3.2e-32
AYG66895.1|2756582_2758814_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
AYG66896.1|2759089_2759932_+	extensin	NA	NA	NA	NA	NA
AYG66897.1|2759988_2760834_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
AYG66898.1|2761010_2762690_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
AYG66899.1|2762856_2763366_+	TIGR00645 family protein	NA	NA	NA	NA	NA
AYG66900.1|2763380_2764331_-	hypothetical protein	NA	NA	NA	NA	NA
AYG68254.1|2764887_2765619_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AYG66901.1|2765775_2766915_-	DUF2333 family protein	NA	NA	NA	NA	NA
AYG66902.1|2767113_2768151_-	hypothetical protein	NA	NA	NA	NA	NA
AYG66903.1|2768326_2768713_-	cytochrome c family protein	NA	NA	NA	NA	NA
AYG66904.1|2768772_2769354_-	thymidine kinase	NA	A0A023W530	Serratia_phage	51.6	2.1e-53
AYG66905.1|2769584_2770541_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
AYG66906.1|2770709_2771567_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
AYG66907.1|2771563_2772613_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	32.3	5.1e-21
AYG66908.1|2772648_2773140_+	HugZ family protein	NA	NA	NA	NA	NA
AYG66909.1|2773507_2773825_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYG66910.1|2774189_2775518_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AYG66911.1|2775810_2776740_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	32.8	2.6e-24
AYG68255.1|2776778_2778017_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP032687	Rhizobium sp. CCGE531 plasmid pRCCGE531b, complete sequence	577596	269851	394482	577596	integrase,transposase	Stx2-converting_phage(30.77%)	97	340295:340314	392465:392484
AYG70483.1|269851_271354_+	SDR family oxidoreductase	NA	L7Y2R3	Megavirus	35.1	3.3e-05
AYG70484.1|271600_272665_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AYG70747.1|272834_273383_-	hypothetical protein	NA	A0A0H3UZE4	Geobacillus_virus	46.1	4.5e-37
AYG70485.1|273716_275282_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	33.3	4.1e-59
AYG70486.1|275336_275615_-	hypothetical protein	NA	S5VXZ8	Leptospira_phage	45.3	1.4e-07
AYG70487.1|275568_277659_-	recombinase family protein	NA	A0A0U4IB69	Exiguobacterium_phage	22.2	7.6e-08
AYG70488.1|277655_278072_-	hypothetical protein	NA	NA	NA	NA	NA
AYG70489.1|277992_278301_-	hypothetical protein	NA	NA	NA	NA	NA
AYG70748.1|278281_278731_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	48.6	1.4e-07
AYG70490.1|279597_281679_+	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	30.5	2.8e-18
AYG70491.1|281873_282839_-	hypothetical protein	NA	NA	NA	NA	NA
AYG70492.1|283397_283586_-	hypothetical protein	NA	NA	NA	NA	NA
AYG70493.1|283837_284812_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYG70749.1|285421_286315_+	nitrogenase iron protein	NA	NA	NA	NA	NA
AYG70494.1|286418_287921_+	nitrogenase molybdenum-iron protein alpha chain	NA	NA	NA	NA	NA
AYG70495.1|288046_289588_+	nitrogenase molybdenum-iron protein subunit beta	NA	NA	NA	NA	NA
AYG70496.1|289619_291146_+	nitrogenase iron-molybdenum cofactor biosynthesis protein NifE	NA	NA	NA	NA	NA
AYG70497.1|291145_292537_+	nitrogenase iron-molybdenum cofactor biosynthesis protein NifN	NA	NA	NA	NA	NA
AYG70498.1|292502_293003_+	nitrogen fixation protein NifX	NA	NA	NA	NA	NA
AYG70499.1|293015_293504_+	NifX-associated nitrogen fixation protein	NA	NA	NA	NA	NA
AYG70500.1|293528_293732_+	hypothetical protein	NA	NA	NA	NA	NA
AYG70501.1|293728_294058_+	ferredoxin III, nif-specific	NA	NA	NA	NA	NA
AYG70502.1|294073_294337_+	hypothetical protein	NA	NA	NA	NA	NA
AYG70503.1|294697_295711_+	1-aminocyclopropane-1-carboxylate deaminase	NA	NA	NA	NA	NA
AYG70504.1|296003_296717_-	transcriptional regulator	NA	NA	NA	NA	NA
AYG70750.1|297304_297970_+	hypothetical protein	NA	NA	NA	NA	NA
AYG70505.1|298317_299301_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AYG70751.1|299541_300816_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	24.5	1.5e-19
AYG70506.1|301589_302483_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AYG70507.1|303544_303922_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AYG70508.1|303918_304266_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	51.4	9.2e-28
AYG70509.1|307847_308027_-	hypothetical protein	NA	NA	NA	NA	NA
AYG70510.1|308550_308784_-	hypothetical protein	NA	NA	NA	NA	NA
AYG70511.1|310284_310638_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	55.6	8.2e-32
AYG70512.1|311595_313137_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	55.7	1.7e-145
AYG70752.1|315081_315951_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
AYG70513.1|316611_316851_-	hypothetical protein	NA	NA	NA	NA	NA
AYG70514.1|318858_319191_+|transposase	transposase	transposase	NA	NA	NA	NA
AYG70753.1|319098_320955_-	recombinase family protein	NA	NA	NA	NA	NA
AYG70515.1|320957_321221_-	hypothetical protein	NA	NA	NA	NA	NA
AYG70516.1|321247_321709_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYG70517.1|321832_322078_-	hypothetical protein	NA	NA	NA	NA	NA
AYG70518.1|322173_322359_+	hypothetical protein	NA	NA	NA	NA	NA
AYG70519.1|322417_324070_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.6	1.8e-81
AYG70520.1|324342_325590_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AYG70521.1|326040_326466_+|transposase	IS200/IS605 family transposase	transposase	A0A0H3UZM0	Geobacillus_virus	33.8	5.8e-16
AYG70522.1|326562_327426_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	32.6	1.5e-31
AYG70523.1|327430_328618_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYG70524.1|329121_330657_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	43.5	3.6e-116
AYG70525.1|330670_331426_+	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	45.0	5.6e-54
AYG70526.1|332956_334102_-	lysine 2,3-aminomutase	NA	NA	NA	NA	NA
AYG70527.1|335971_337149_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	64.6	1.2e-90
AYG70528.1|337963_338341_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AYG70529.1|338337_338685_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	51.4	9.2e-28
AYG70754.1|338752_340411_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.8	2.2e-103
340295:340314	attL	GCCTGGCTTGCCGATGTGCT	NA	NA	NA	NA
AYG70530.1|340391_340625_-	hypothetical protein	NA	NA	NA	NA	NA
AYG70531.1|340804_341650_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	35.1	2.2e-38
AYG70532.1|341728_343012_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AYG70533.1|343639_344671_+	peptidase C45	NA	NA	NA	NA	NA
AYG70534.1|347632_348823_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
AYG70535.1|349152_349347_-	hypothetical protein	NA	NA	NA	NA	NA
AYG70536.1|349370_350474_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYG70537.1|350611_351706_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	6.5e-27
AYG70538.1|351724_353497_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
AYG70755.1|353878_354763_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AYG70756.1|354997_356323_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AYG70539.1|356335_356872_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AYG70540.1|357044_358223_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
AYG70541.1|358404_358872_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AYG70542.1|359013_360198_+	amidohydrolase	NA	NA	NA	NA	NA
AYG70543.1|360227_361217_+	hydroxyectoine utilization dehydratase EutB	NA	NA	NA	NA	NA
AYG70544.1|361213_362203_+	ectoine utilization protein EutC	NA	NA	NA	NA	NA
AYG70545.1|362324_363041_+	hypothetical protein	NA	NA	NA	NA	NA
AYG70546.1|363071_364253_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
AYG70547.1|364371_365427_+	peptidase C45	NA	NA	NA	NA	NA
AYG70548.1|365836_367240_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.9	6.0e-17
AYG70549.1|367378_368788_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
AYG70550.1|368892_369591_+	CoA transferase subunit A	NA	NA	NA	NA	NA
AYG70551.1|369607_370237_+	CoA transferase subunit B	NA	NA	NA	NA	NA
AYG70552.1|370307_371441_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
AYG70553.1|371453_371951_+	UPF0262 family protein	NA	NA	NA	NA	NA
AYG70757.1|372085_373441_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
AYG70554.1|376946_377165_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYG70555.1|377292_378894_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
AYG70556.1|378927_379329_+	cytochrome c	NA	NA	NA	NA	NA
AYG70557.1|380833_382084_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
AYG70558.1|382135_382369_+	hypothetical protein	NA	NA	NA	NA	NA
AYG70559.1|382602_383892_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AYG70560.1|384168_384639_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AYG70561.1|384897_386136_+|integrase	integrase	integrase	A0A1B1P7C7	Bacillus_phage	31.0	3.2e-06
AYG70562.1|386132_387065_+|integrase	integrase	integrase	NA	NA	NA	NA
AYG70563.1|387061_388069_+|integrase	integrase	integrase	A0A0K2CP59	Brevibacillus_phage	24.2	3.0e-10
AYG70564.1|388286_389165_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	31.1	2.4e-32
AYG70565.1|389172_390369_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYG70566.1|391021_392596_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	34.6	1.6e-74
392465:392484	attR	GCCTGGCTTGCCGATGTGCT	NA	NA	NA	NA
AYG70567.1|392592_393156_+	YecA family protein	NA	NA	NA	NA	NA
AYG70568.1|393336_394482_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
