The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	6453	27977	4293706	transposase,holin	Bacillus_phage(75.0%)	20	NA	NA
AYK64076.1|6453_7368_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
AYK64077.1|7784_9563_+	hypothetical protein	NA	D7NW65	Streptomyces_phage	37.6	2.6e-81
AYK64078.1|10081_11131_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	53.6	1.6e-86
AYK64079.1|11245_11638_+	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	100.0	2.2e-62
AYK64080.1|11659_11911_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	97.6	2.1e-37
AYK64081.1|12038_13175_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	98.4	5.2e-213
AYK64082.1|13164_13341_+	aspartate phosphatase	NA	A0A1P8CWP3	Bacillus_phage	100.0	1.8e-24
AYK64083.1|13382_13997_-	DNA polymerase	NA	A0A1P8CWP4	Bacillus_phage	98.4	1.5e-97
AYK64084.1|14037_15849_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.9	2.0e-28
AYK64085.1|17103_17436_-	YolD-like family protein	NA	O64030	Bacillus_phage	95.5	1.0e-52
AYK64086.1|17609_17945_+	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	100.0	4.2e-54
AYK64087.1|17988_18348_-	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	100.0	3.5e-62
AYK64088.1|18608_18725_+	hypothetical protein	NA	Q96209	Bacillus_phage	97.2	2.4e-09
AYK64089.1|18801_20505_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.4	3.8e-90
AYK64090.1|21369_21903_-	N-acetyltransferase	NA	O64026	Bacillus_phage	97.2	2.9e-97
AYK64091.1|21962_22517_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	90.8	2.8e-95
AYK64092.1|22572_23031_-	SMI1/KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	85.5	2.8e-72
AYK64093.1|23043_24930_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	80.6	7.2e-159
AYK64094.1|25695_27333_+	recombinase family protein	NA	O64015	Bacillus_phage	99.3	5.8e-306
AYK64095.1|27377_27977_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	28.6	1.3e-13
>prophage 2
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	52240	138854	4293706	portal,protease,tRNA,terminase,tail,holin,head,capsid,transposase,coat	Bacillus_phage(28.12%)	91	NA	NA
AYK64130.1|52240_53155_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
AYK64131.1|53151_53469_-|transposase	transposase	transposase	NA	NA	NA	NA
AYK64132.1|53585_53732_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64133.1|53806_54064_-	DUF2533 family protein	NA	NA	NA	NA	NA
AYK64134.1|54128_57710_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64135.1|57885_57975_-	Fur-regulated basic protein FbpC	NA	NA	NA	NA	NA
AYK64136.1|58045_58552_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64137.1|60683_62228_-	recombinase family protein	NA	A0A0U4IB69	Exiguobacterium_phage	29.7	4.2e-48
AYK64138.1|63692_64088_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64139.1|64102_64417_-	hypothetical protein	NA	NA	NA	NA	NA
AYK68055.1|64608_64806_+	XRE family transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	33.9	2.1e-05
AYK64140.1|64928_65231_+	hypothetical protein	NA	NA	NA	NA	NA
AYK64141.1|65286_65592_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64142.1|65606_67022_-	lipase	NA	NA	NA	NA	NA
AYK64143.1|67072_67438_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AYK64144.1|67468_67711_-	DNA-binding protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	54.4	8.7e-17
AYK64145.1|68174_68846_-	M15 family peptidase	NA	F8WPX5	Bacillus_phage	72.3	2.8e-65
AYK64146.1|68866_69130_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	8.8e-23
AYK64147.1|69144_69453_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64148.1|69487_69727_-	XkdX family protein	NA	NA	NA	NA	NA
AYK64149.1|69726_70068_-	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
AYK64150.1|70068_71355_-	DUF2479 domain-containing protein	NA	A0A1J0MFQ3	Staphylococcus_phage	39.3	1.1e-78
AYK64151.1|71371_72382_-	SGNH/GDSL hydrolase family protein	NA	A0A1J0MFI8	Staphylococcus_phage	40.7	1.5e-65
AYK64152.1|72378_72687_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64153.1|72679_73834_-	hypothetical protein	NA	A0A1W6JQ67	Staphylococcus_phage	33.6	8.4e-25
AYK64154.1|73843_74683_-|tail	phage tail family protein	tail	A0A0B5CTY7	Listeria_phage	27.8	1.3e-19
AYK64155.1|74685_80679_-|tail	phage tail tape measure protein	tail	A0A0B5CTS6	Listeria_phage	35.5	1.8e-22
AYK64156.1|80873_81194_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64157.1|81223_81457_-	hypothetical protein	NA	A0A1P8CWR2	Bacillus_phage	52.7	4.6e-15
AYK64158.1|81456_82044_-	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	45.3	2.0e-38
AYK64159.1|82052_82661_-|tail	phage tail protein	tail	A0A2P0ZKX7	Lactobacillus_phage	36.3	5.2e-26
AYK64160.1|82718_83105_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64161.1|83101_83518_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
AYK64162.1|83514_83844_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AYK64163.1|83816_84128_-	hypothetical protein	NA	E9LUQ4	Lactobacillus_phage	34.5	4.4e-05
AYK64164.1|84141_85344_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	47.5	5.0e-97
AYK68056.1|85347_86070_-|protease	Clp protease ClpP	protease	A0A2I7SDE1	Paenibacillus_phage	60.5	1.0e-68
AYK64165.1|86050_87274_-|portal	phage portal protein	portal	A0A2I7SCY4	Paenibacillus_phage	39.1	3.3e-72
AYK64166.1|87285_89076_-|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	57.7	2.2e-202
AYK64167.1|89065_89521_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	43.2	7.8e-27
AYK64168.1|89751_90063_-	HNH endonuclease	NA	A0A0C5AEM7	Paenibacillus_phage	45.2	5.5e-16
AYK64169.1|90046_90271_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64170.1|90267_90504_-	hypothetical protein	NA	F8WQ61	Bacillus_phage	44.0	1.4e-06
AYK64171.1|90535_90805_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64172.1|91539_92280_-	hypothetical protein	NA	A0A2D1GQ65	Lysinibacillus_phage	49.6	1.0e-23
AYK64173.1|92724_95403_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64174.1|95716_96766_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64175.1|97032_97497_-	hypothetical protein	NA	NA	NA	NA	NA
AYK68057.1|97516_98482_-	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	55.9	1.0e-76
AYK64176.1|100518_100785_+	hypothetical protein	NA	NA	NA	NA	NA
AYK64177.1|101218_101803_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AYK64178.1|102134_103640_-	carboxypeptidase	NA	NA	NA	NA	NA
AYK64179.1|103751_104744_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AYK64180.1|104788_105379_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
AYK64181.1|105380_106355_-	sugar kinase	NA	NA	NA	NA	NA
AYK64182.1|106392_107412_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYK64183.1|107633_108461_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
AYK64184.1|108462_109227_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	NA	NA	NA	NA
AYK64185.1|109267_111193_-	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	23.5	2.7e-12
AYK68058.1|111295_111487_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64186.1|111650_111803_+	YpzG family protein	NA	NA	NA	NA	NA
AYK64187.1|111855_113013_-	RNA methyltransferase	NA	NA	NA	NA	NA
AYK64188.1|113559_113856_-	cell division regulator GpsB	NA	NA	NA	NA	NA
AYK64189.1|113931_114564_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
AYK64190.1|114565_114793_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK64191.1|114876_115005_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64192.1|115105_116347_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64193.1|116362_118612_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	29.3	3.0e-10
AYK68059.1|118714_119221_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AYK64194.1|119358_119778_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AYK64195.1|119798_120176_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64196.1|120362_120551_+	hypothetical protein	NA	NA	NA	NA	NA
AYK64197.1|120589_120961_-	DUF1798 family protein	NA	NA	NA	NA	NA
AYK64198.1|121006_121252_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64199.1|121450_121555_+	acid-soluble spore protein SspM	NA	NA	NA	NA	NA
AYK64200.1|121579_122542_-	DUF2515 domain-containing protein	NA	NA	NA	NA	NA
AYK64201.1|122582_123203_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	36.6	5.5e-23
AYK64202.1|123224_125969_+	penicillin-binding protein 1AB	NA	NA	NA	NA	NA
AYK64203.1|126044_126539_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64204.1|126535_127195_-	endonuclease III	NA	NA	NA	NA	NA
AYK64205.1|127213_127912_-	DNA replication protein DnaD	NA	A0A0N7AE27	Bacillus_phage	42.7	4.3e-24
AYK68060.1|128005_129298_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.1	1.7e-58
AYK64206.1|129441_130623_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AYK64207.1|130645_131131_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64208.1|131139_131310_-	DUF4264 domain-containing protein	NA	NA	NA	NA	NA
AYK64209.1|131452_134248_-	ATP-dependent helicase DinG	NA	A0A127AW80	Bacillus_phage	26.6	4.9e-55
AYK64210.1|134373_134757_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AYK64211.1|134758_135619_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AYK64212.1|135620_136454_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	39.1	3.2e-50
AYK64213.1|136698_137676_-	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
AYK64214.1|137660_138854_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	45.3	4.4e-37
>prophage 3
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	209618	215910	4293706		Staphylococcus_phage(66.67%)	8	NA	NA
AYK64289.1|209618_210212_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.0e-14
AYK68065.1|210201_210954_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	27.2	7.1e-09
AYK64290.1|211231_211756_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AYK64291.1|211971_212346_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK64292.1|212458_212923_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
AYK64293.1|212955_214152_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	5.3e-115
AYK64294.1|214166_214814_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
AYK64295.1|214824_215910_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	6.6e-56
>prophage 4
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	444325	487571	4293706	transposase,coat	Bacillus_phage(25.0%)	45	NA	NA
AYK64531.1|444325_445573_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK64532.1|446108_446336_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64533.1|446369_447497_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYK64534.1|447839_448397_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64535.1|448581_449064_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64536.1|449212_449473_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
AYK64537.1|449494_449812_-	sulfurtransferase	NA	NA	NA	NA	NA
AYK64538.1|450203_450764_-	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	69.1	3.4e-56
AYK64539.1|450781_450994_-	NTP pyrophosphohydrolase	NA	NA	NA	NA	NA
AYK68077.1|450990_451134_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64540.1|451307_452129_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AYK64541.1|452245_453448_+	multidrug efflux MFS transporter Blt	NA	NA	NA	NA	NA
AYK64542.1|453629_454088_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK64543.1|455839_455983_-	YrzO family protein	NA	NA	NA	NA	NA
AYK64544.1|456000_456966_-	DMT family transporter	NA	NA	NA	NA	NA
AYK64545.1|457295_458210_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
AYK64546.1|458206_458524_-|transposase	transposase	transposase	NA	NA	NA	NA
AYK68078.1|458786_460334_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AYK64547.1|460330_461089_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
AYK64548.1|461963_463001_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	26.5	6.4e-16
AYK64549.1|463088_464036_-	cation transporter	NA	NA	NA	NA	NA
AYK64550.1|464710_466033_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AYK64551.1|466193_466526_-	branched-chain amino acid transporter AzlD	NA	NA	NA	NA	NA
AYK64552.1|467261_467735_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AYK64553.1|468068_468344_-	barnase inhibitor	NA	NA	NA	NA	NA
AYK64554.1|468616_469849_-	cytochrome P450	NA	NA	NA	NA	NA
AYK64555.1|469826_470015_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64556.1|471030_471228_+	hypothetical protein	NA	NA	NA	NA	NA
AYK64557.1|471243_471543_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYK64558.1|471539_471797_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64559.1|471803_472226_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AYK64560.1|472408_472603_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AYK64561.1|472733_473783_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	41.5	1.6e-67
AYK64562.1|473913_474423_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
AYK64563.1|474464_476498_-	levanase	NA	S6ATV4	Bacillus_phage	37.6	9.1e-83
AYK64564.1|476654_477482_-	fructose permease IID component	NA	NA	NA	NA	NA
AYK64565.1|477503_478313_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AYK64566.1|478329_478818_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
AYK64567.1|478817_479258_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AYK64568.1|479447_482255_-	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
AYK64569.1|482809_482950_+	hypothetical protein	NA	NA	NA	NA	NA
AYK64570.1|482988_484365_+	amino acid permease	NA	NA	NA	NA	NA
AYK64571.1|484456_485089_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64572.1|485241_486069_+	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
AYK64573.1|486218_487571_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 5
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	552505	649347	4293706	portal,protease,tRNA,terminase,tail,holin,head,capsid,coat	Bacillus_phage(46.15%)	103	NA	NA
AYK64633.1|552505_553651_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	3.4e-87
AYK64634.1|553677_554706_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AYK64635.1|554735_554936_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
AYK64636.1|554928_555933_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.2e-08
AYK64637.1|555943_556549_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AYK64638.1|556687_557200_-	protein BofC	NA	NA	NA	NA	NA
AYK64639.1|557247_558555_-	MFS transporter	NA	NA	NA	NA	NA
AYK64640.1|558625_559651_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
AYK64641.1|560571_560694_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64642.1|560778_561225_+	hypothetical protein	NA	NA	NA	NA	NA
AYK64643.1|561231_561372_+	hypothetical protein	NA	NA	NA	NA	NA
AYK64644.1|561535_562990_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
AYK68082.1|563030_563753_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYK64645.1|563854_564451_-	sporulation protein	NA	NA	NA	NA	NA
AYK64646.1|564598_565762_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
AYK64647.1|565878_566985_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
AYK64648.1|566971_567841_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
AYK64649.1|567794_569390_-	L-aspartate oxidase	NA	NA	NA	NA	NA
AYK64650.1|569492_570680_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A141ZJV0	Faustovirus	27.4	8.6e-33
AYK64651.1|570639_571182_+	transcription repressor NadR	NA	NA	NA	NA	NA
AYK64652.1|571205_572063_-	prephenate dehydratase	NA	NA	NA	NA	NA
AYK64653.1|572079_572523_-	ACT domain-containing protein	NA	NA	NA	NA	NA
AYK64654.1|572582_573869_-	GTPase ObgE	NA	NA	NA	NA	NA
AYK64655.1|573902_574481_-	sporulation initiation phosphotransferase B	NA	NA	NA	NA	NA
AYK64656.1|574558_574681_+	hypothetical protein	NA	NA	NA	NA	NA
AYK64657.1|574801_575086_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AYK64658.1|575098_575437_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
AYK64659.1|575439_575748_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AYK64660.1|575894_576761_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
AYK64661.1|576753_577548_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
AYK64662.1|577696_578503_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
AYK64663.1|578504_579185_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
AYK64664.1|579237_579756_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AYK64665.1|579752_580625_-	cell shape-determining protein MreC	NA	NA	NA	NA	NA
AYK64666.1|580655_581669_-	rod shape-determining protein	NA	NA	NA	NA	NA
AYK68083.1|582347_582602_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64667.1|582703_582934_-	DNA-binding protein	NA	NA	NA	NA	NA
AYK64668.1|582911_583154_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64669.1|583551_584211_+	hypothetical protein	NA	NA	NA	NA	NA
AYK64670.1|584410_586030_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	59.7	1.9e-75
AYK64671.1|586041_586458_+	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	57.2	6.7e-41
AYK64672.1|586490_587312_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	73.3	6.9e-66
AYK64673.1|587355_587778_-|holin	holin family protein	holin	D6R405	Bacillus_phage	85.0	1.1e-56
AYK64674.1|587818_588001_-	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	47.9	1.0e-06
AYK64675.1|587997_588324_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	62.4	3.3e-27
AYK64676.1|588339_589569_-	DUF2479 domain-containing protein	NA	M4ZRP1	Bacillus_phage	69.5	2.5e-152
AYK68084.1|589581_590136_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64677.1|591681_593385_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	55.5	4.3e-179
AYK64678.1|593399_594239_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	59.0	2.6e-92
AYK64679.1|594232_598720_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.4	1.3e-68
AYK64680.1|598919_599288_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64681.1|599354_599954_-|tail	phage tail protein	tail	A0A1J0MFV0	Staphylococcus_phage	32.1	1.0e-13
AYK64682.1|599968_600361_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AYK64683.1|600357_600756_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64684.1|600755_601070_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	2.2e-12
AYK64685.1|601059_601362_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	3.6e-12
AYK64686.1|601379_601859_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	63.1	5.4e-10
AYK64687.1|601881_603147_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	45.2	2.6e-80
AYK64688.1|603185_603917_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	55.6	8.9e-57
AYK64689.1|603861_605172_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.4	9.3e-105
AYK64690.1|605172_605364_-	DUF1056 family protein	NA	NA	NA	NA	NA
AYK64691.1|605376_607086_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.2	8.7e-204
AYK64692.1|607082_607598_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.0	1.7e-33
AYK64693.1|607823_608189_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	50.8	2.5e-28
AYK64694.1|608248_608509_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64695.1|608561_608876_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64696.1|609183_609396_-	cell division protein FtsK	NA	NA	NA	NA	NA
AYK64697.1|609523_609991_-	hypothetical protein	NA	NA	NA	NA	NA
AYK68085.1|610281_610935_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
AYK64698.1|611354_611735_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	76.4	2.0e-44
AYK64699.1|611731_613087_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	66.3	1.1e-180
AYK64700.1|613046_613361_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	57.8	2.4e-19
AYK64701.1|613669_616081_-	hypothetical protein	NA	A0A0A7RTG3	Clostridium_phage	56.8	3.6e-280
AYK64702.1|616104_616308_-	hypothetical protein	NA	O64114	Bacillus_phage	77.1	5.2e-15
AYK64703.1|616426_618373_-	hypothetical protein	NA	S5M5X4	Brevibacillus_phage	67.2	2.6e-252
AYK64704.1|618926_619208_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64705.1|619266_619833_-	DUF2815 family protein	NA	S5MC21	Brevibacillus_phage	78.0	5.4e-78
AYK64706.1|619865_621044_-	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	60.9	1.9e-133
AYK64707.1|621040_621418_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64708.1|621430_621832_-	hypothetical protein	NA	NA	NA	NA	NA
AYK64709.1|622145_622418_-	XRE family transcriptional regulator	NA	D6R414	Bacillus_phage	93.3	4.1e-39
AYK64710.1|622697_623132_+	XRE family transcriptional regulator	NA	Q786F1	Bacillus_phage	91.0	1.5e-64
AYK64711.1|623145_623592_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	89.2	7.1e-73
AYK64712.1|623631_625059_+	recombinase family protein	NA	Q9T200	Bacillus_phage	83.4	6.1e-227
AYK64713.1|625062_625479_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AYK64714.1|625515_626085_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AYK64715.1|626237_627236_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
AYK64716.1|627369_628116_-	prepilin peptidase	NA	NA	NA	NA	NA
AYK64717.1|628255_629548_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AYK64718.1|629607_632250_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.8	4.9e-161
AYK64719.1|632697_632889_+	hypothetical protein	NA	NA	NA	NA	NA
AYK64720.1|632907_633933_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
AYK64721.1|633965_636065_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AYK64722.1|636195_637488_-	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AYK64723.1|637518_638493_-	porphobilinogen synthase	NA	NA	NA	NA	NA
AYK64724.1|638489_639278_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AYK64725.1|639267_640212_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AYK64726.1|640244_641075_-	cytochrome C assembly protein	NA	NA	NA	NA	NA
AYK64727.1|641082_642450_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AYK64728.1|643185_643773_-	GTP-binding protein	NA	NA	NA	NA	NA
AYK64729.1|643769_646094_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	2.6e-182
AYK64730.1|646274_647933_-|protease	Lon protease 2	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
AYK64731.1|648084_649347_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
>prophage 6
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	1132298	1199139	4293706	portal,integrase,protease,terminase,tail,holin,head,plate,capsid,transposase	Bacillus_phage(37.5%)	73	1185242:1185256	1196796:1196810
AYK65149.1|1132298_1133651_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK65150.1|1134071_1134389_+|transposase	transposase	transposase	NA	NA	NA	NA
AYK65151.1|1134385_1135300_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
AYK65152.1|1135704_1136031_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
AYK65153.1|1136021_1136750_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYK65154.1|1136880_1138362_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AYK65155.1|1140063_1140816_+	fatty acid desaturase	NA	NA	NA	NA	NA
AYK65156.1|1141384_1142488_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	37.3	2.3e-19
AYK65157.1|1142669_1143398_+	transcriptional regulator PhoB	NA	NA	NA	NA	NA
AYK65158.1|1143422_1144277_-	fructoselysine 6-kinase	NA	NA	NA	NA	NA
AYK65159.1|1145198_1146077_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AYK65160.1|1147467_1148454_-	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	23.6	1.9e-09
AYK65161.1|1148669_1149044_-	nucleotide excision repair endonuclease	NA	NA	NA	NA	NA
AYK65162.1|1149146_1150265_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AYK65163.1|1150423_1150570_+	acid-soluble spore protein SspG	NA	NA	NA	NA	NA
AYK65164.1|1150569_1150845_+	hypothetical protein	NA	NA	NA	NA	NA
AYK65165.1|1150902_1152047_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.9	3.1e-40
AYK65166.1|1152192_1152576_-	VOC family protein	NA	NA	NA	NA	NA
AYK65167.1|1152685_1152964_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYK65168.1|1153222_1155472_+	restriction endonuclease	NA	NA	NA	NA	NA
AYK68106.1|1158772_1158961_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	50.0	3.2e-11
AYK65169.1|1159120_1160893_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	54.5	2.8e-120
AYK65170.1|1160905_1161367_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AYK65171.1|1161417_1162359_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	77.1	3.0e-97
AYK65172.1|1162400_1162823_-|holin	holin family protein	holin	D6R405	Bacillus_phage	85.7	3.0e-57
AYK65173.1|1162876_1163047_-	XkdX family protein	NA	NA	NA	NA	NA
AYK65174.1|1163043_1163343_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	78.1	3.4e-39
AYK68107.1|1163357_1164545_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	69.4	1.2e-146
AYK68108.1|1164599_1165154_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65175.1|1166658_1168533_-	autolysin	NA	M5AC19	Bacillus_phage	26.8	2.2e-51
AYK65176.1|1168545_1169379_-|tail	phage tail family protein	tail	M4ZS20	Bacillus_phage	34.1	1.6e-33
AYK65177.1|1169391_1173162_-	hypothetical protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	58.3	7.3e-110
AYK65178.1|1173224_1173407_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65179.1|1173418_1173781_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65180.1|1173837_1174419_-|tail	major tail protein	tail	J7KKC8	Streptococcus_phage	40.8	3.7e-29
AYK65181.1|1174411_1174831_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65182.1|1174827_1175220_-	HK97 gp10 family phage protein	NA	A0A0M5M1E5	Enterococcus_phage	37.9	4.0e-11
AYK65183.1|1175219_1175546_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AYK65184.1|1175535_1175829_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	33.0	2.6e-07
AYK65185.1|1175883_1176276_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	63.6	3.5e-07
AYK65186.1|1176303_1177509_-|capsid	phage major capsid protein	capsid	A0A2H4J824	uncultured_Caudovirales_phage	49.7	8.3e-76
AYK65187.1|1177556_1178153_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	53.8	4.3e-49
AYK65188.1|1178145_1179372_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	39.0	6.3e-71
AYK65189.1|1179376_1179583_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65190.1|1179599_1181306_-|terminase	terminase large subunit	terminase	A0A2H4JC16	uncultured_Caudovirales_phage	42.8	2.1e-120
AYK68109.1|1181298_1181793_-|terminase	phage terminase small subunit P27 family	terminase	A0A1Q1PVW3	Staphylococcus_phage	35.5	2.6e-20
AYK65191.1|1182025_1182238_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65192.1|1182240_1182624_-	HNH endonuclease	NA	A0A075M5R4	Enterococcus_phage	44.2	1.1e-18
AYK65193.1|1182726_1183341_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65194.1|1183477_1184038_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65195.1|1184295_1184838_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	63.9	5.8e-61
AYK68110.1|1184834_1185287_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	1.7e-37
1185242:1185256	attL	TTGCTTCTTCGTCAA	NA	NA	NA	NA
AYK65196.1|1185896_1186283_-	hypothetical protein	NA	A0A1P8CWX0	Bacillus_phage	36.2	3.8e-14
AYK65197.1|1186279_1186759_-	hypothetical protein	NA	F8WQ59	Bacillus_phage	53.8	1.0e-21
AYK65198.1|1186758_1187451_-	dUTPase	NA	R9TQ23	Paenibacillus_phage	43.7	6.7e-38
AYK65199.1|1187613_1187862_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	44.9	6.0e-05
AYK65200.1|1187858_1188266_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	45.0	2.9e-25
AYK65201.1|1188262_1188547_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65202.1|1188590_1188788_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65203.1|1189035_1189176_-	BH0509 family protein	NA	NA	NA	NA	NA
AYK65204.1|1189283_1189832_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	39.3	4.6e-05
AYK65205.1|1190131_1190986_-	AAA family ATPase	NA	Q4ZAS1	Staphylococcus_virus	29.4	2.2e-22
AYK65206.1|1190936_1191776_-	DNA replication protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	51.4	1.4e-66
AYK65207.1|1191768_1191999_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65208.1|1192022_1192235_-	hypothetical protein	NA	R9TQ08	Paenibacillus_phage	70.7	5.3e-18
AYK65209.1|1192292_1192577_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK65210.1|1192680_1193076_+	XRE family transcriptional regulator	NA	I3VYZ1	Thermoanaerobacterium_phage	39.1	6.6e-06
AYK65211.1|1193307_1193502_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65212.1|1193498_1194668_-	XRE family transcriptional regulator	NA	A0A1B1P786	Bacillus_phage	24.0	3.8e-09
AYK65213.1|1194955_1195993_+|integrase	site-specific integrase	integrase	A0A223LI82	Staphylococcus_phage	47.1	1.8e-87
AYK65214.1|1196067_1197465_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
1196796:1196810	attR	TTGCTTCTTCGTCAA	NA	NA	NA	NA
AYK65215.1|1197485_1197929_-	SUF system NifU family Fe-S cluster assembly protein	NA	A0A2P1CJL8	Mycobacterium_phage	38.7	2.5e-14
AYK65216.1|1197918_1199139_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.8	1.7e-116
>prophage 7
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	1432950	1494354	4293706	transposase,holin,protease	Streptococcus_phage(16.67%)	58	NA	NA
AYK65425.1|1432950_1434303_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK65426.1|1434307_1434502_+	hypothetical protein	NA	NA	NA	NA	NA
AYK65427.1|1434428_1435058_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
AYK65428.1|1435054_1435813_-	imidazole glycerol phosphate synthase cyclase subunit	NA	NA	NA	NA	NA
AYK65429.1|1435809_1436547_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AYK65430.1|1436543_1437182_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
AYK65431.1|1437182_1437767_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
AYK65432.1|1437763_1439047_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
AYK65433.1|1439043_1439685_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
AYK65434.1|1439677_1440853_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
AYK65435.1|1441103_1441856_+	hypothetical protein	NA	NA	NA	NA	NA
AYK65436.1|1442096_1442762_+	pectate lyase	NA	NA	NA	NA	NA
AYK65437.1|1442781_1443300_-	acetyltransferase	NA	NA	NA	NA	NA
AYK65438.1|1443303_1443954_-	pyrophosphatase PpaX	NA	NA	NA	NA	NA
AYK65439.1|1443950_1444889_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65440.1|1444912_1445722_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AYK65441.1|1445736_1446669_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
AYK65442.1|1446850_1448041_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AYK65443.1|1448037_1448766_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
AYK65444.1|1448783_1449515_+	transcriptional regulator	NA	NA	NA	NA	NA
AYK65445.1|1449535_1453405_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65446.1|1453595_1454105_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK65447.1|1454125_1455337_+	MFS transporter	NA	NA	NA	NA	NA
AYK65448.1|1455435_1456624_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.6	1.6e-31
AYK65449.1|1456677_1457037_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AYK65450.1|1457030_1457237_-	PspC domain-containing protein	NA	NA	NA	NA	NA
AYK65451.1|1457242_1458340_-	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
AYK65452.1|1458364_1458691_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65453.1|1458908_1459157_+	hypothetical protein	NA	NA	NA	NA	NA
AYK65454.1|1459324_1460146_-	flagellin	NA	NA	NA	NA	NA
AYK65455.1|1460483_1463357_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.1	0.0e+00
AYK65456.1|1463364_1465350_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AYK65457.1|1465535_1465766_-	protein CsbA	NA	NA	NA	NA	NA
AYK65458.1|1466213_1468706_+	phosphotransferase	NA	NA	NA	NA	NA
AYK65459.1|1468781_1469351_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYK65460.1|1469381_1470716_+	MFS transporter	NA	NA	NA	NA	NA
AYK65461.1|1470763_1471957_-|protease	serine protease	protease	NA	NA	NA	NA
AYK65462.1|1472035_1472389_-	swarming motility protein SwrAA	NA	NA	NA	NA	NA
AYK65463.1|1472772_1474215_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.9	2.8e-22
AYK68122.1|1474354_1475245_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK65464.1|1475237_1475924_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.0	1.7e-25
AYK65465.1|1476369_1477986_+	hypothetical protein	NA	NA	NA	NA	NA
AYK65466.1|1477975_1478920_+	hypothetical protein	NA	NA	NA	NA	NA
AYK65467.1|1478924_1479887_+	hypothetical protein	NA	NA	NA	NA	NA
AYK65468.1|1479887_1480922_+	hypothetical protein	NA	NA	NA	NA	NA
AYK65469.1|1480902_1481394_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AYK65470.1|1481412_1482090_+	HAD family hydrolase	NA	NA	NA	NA	NA
AYK68123.1|1482145_1482724_+	HD domain-containing protein	NA	NA	NA	NA	NA
AYK65471.1|1483185_1483971_+	hypothetical protein	NA	NA	NA	NA	NA
AYK65472.1|1483991_1484258_+	PqqD family protein	NA	NA	NA	NA	NA
AYK65473.1|1484473_1485100_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYK65474.1|1485120_1485927_+	ABC transporter permease	NA	NA	NA	NA	NA
AYK65475.1|1486923_1487733_+	ABC transporter permease	NA	NA	NA	NA	NA
AYK65476.1|1487920_1488259_-	cytochrome c551	NA	NA	NA	NA	NA
AYK65477.1|1488307_1489192_-	YitT family protein	NA	NA	NA	NA	NA
AYK65478.1|1489317_1490419_-	peptide chain release factor 2	NA	NA	NA	NA	NA
AYK65479.1|1490488_1493014_-	protein translocase subunit SecA	NA	NA	NA	NA	NA
AYK65480.1|1493203_1494354_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
>prophage 8
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	1682802	1693640	4293706	transposase,tRNA,bacteriocin	Streptococcus_phage(50.0%)	12	NA	NA
AYK65670.1|1682802_1684137_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	42.2	2.0e-86
AYK65671.1|1684292_1685963_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
AYK65672.1|1685959_1686388_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
AYK65673.1|1686702_1686834_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
AYK65674.1|1686790_1686943_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
AYK65675.1|1686967_1688314_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
AYK65676.1|1688326_1688488_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
AYK65677.1|1688484_1689204_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	1.6e-18
AYK65678.1|1689196_1690507_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
AYK68131.1|1690496_1691657_+	insulinase family protein	NA	NA	NA	NA	NA
AYK65679.1|1691661_1692942_+	insulinase family protein	NA	NA	NA	NA	NA
AYK65680.1|1692938_1693640_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
>prophage 9
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	1703361	1739017	4293706	tRNA,coat,protease	Enterobacteria_phage(22.22%)	36	NA	NA
AYK65690.1|1703361_1704021_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AYK65691.1|1704129_1704318_+	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
AYK65692.1|1704360_1704780_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK65693.1|1704899_1706816_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.0	1.8e-141
AYK65694.1|1707431_1707575_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65695.1|1707646_1709050_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
AYK65696.1|1709049_1709520_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AYK65697.1|1709631_1710132_-	YwgA family protein	NA	NA	NA	NA	NA
AYK65698.1|1710167_1711469_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
AYK65699.1|1711630_1711855_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
AYK65700.1|1712070_1712847_+	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
AYK65701.1|1712990_1713881_-	DMT family transporter	NA	NA	NA	NA	NA
AYK65702.1|1714048_1714894_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
AYK65703.1|1714942_1715842_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
AYK65704.1|1715987_1716959_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AYK65705.1|1717233_1717998_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
AYK65706.1|1718130_1718910_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYK65707.1|1718802_1719084_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65708.1|1720797_1722210_-	amino acid permease	NA	NA	NA	NA	NA
AYK65709.1|1722209_1723910_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
AYK65710.1|1723983_1725531_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYK65711.1|1725757_1727032_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
AYK65712.1|1727209_1727674_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65713.1|1727997_1728453_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK65714.1|1728445_1729297_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.3	1.7e-38
AYK65715.1|1729310_1730258_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
AYK65716.1|1730257_1730998_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	42.0	7.7e-48
AYK65717.1|1731022_1732042_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK65718.1|1732044_1732767_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK65719.1|1732759_1733881_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK65720.1|1733880_1734750_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK65721.1|1734750_1735920_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	27.2	6.5e-17
AYK65722.1|1735940_1737365_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
AYK65723.1|1737369_1738140_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
AYK65724.1|1738132_1738312_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65725.1|1738459_1739017_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
>prophage 10
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	1954061	1997594	4293706	transposase,holin,bacteriocin	Bacillus_phage(33.33%)	38	NA	NA
AYK65917.1|1954061_1954280_-|bacteriocin	bacteriocin leader domain-containing protein	bacteriocin	NA	NA	NA	NA
AYK65918.1|1954324_1954546_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65919.1|1954867_1955992_+|transposase	IS4 family transposase IS4Bsu1	transposase	NA	NA	NA	NA
AYK65920.1|1956269_1956524_+	hypothetical protein	NA	NA	NA	NA	NA
AYK65921.1|1956687_1958871_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	30.8	1.7e-50
AYK65922.1|1958871_1960341_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYK65923.1|1960442_1960631_+	hypothetical protein	NA	NA	NA	NA	NA
AYK65924.1|1960749_1961784_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AYK65925.1|1961877_1962453_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYK65926.1|1962584_1963655_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYK65927.1|1963712_1964144_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK65928.1|1964370_1964775_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
AYK65929.1|1964744_1965437_+	LrgB family protein	NA	NA	NA	NA	NA
AYK65930.1|1965476_1966508_-	general stress protein	NA	NA	NA	NA	NA
AYK65931.1|1966600_1967749_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.6	5.2e-51
AYK65932.1|1967944_1968676_+	gluconate operon transcriptional regulator	NA	NA	NA	NA	NA
AYK65933.1|1968668_1970210_+	gluconokinase	NA	NA	NA	NA	NA
AYK65934.1|1970238_1971585_+	gluconate permease	NA	NA	NA	NA	NA
AYK65935.1|1971607_1973014_+	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	30.3	2.5e-31
AYK65936.1|1973504_1974068_+	peroxiredoxin	NA	NA	NA	NA	NA
AYK65937.1|1974081_1975611_+	alkyl hydroperoxide reductase subunit F	NA	A0A1V0SIN1	Klosneuvirus	29.3	1.0e-33
AYK65938.1|1975706_1977143_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AYK65939.1|1977229_1977409_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65940.1|1977715_1978426_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYK65941.1|1978453_1978612_+	hypothetical protein	NA	NA	NA	NA	NA
AYK65942.1|1978742_1979465_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYK65943.1|1979485_1980115_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
AYK65944.1|1980606_1982532_+	fructose-1,6-bisphosphatase	NA	NA	NA	NA	NA
AYK65945.1|1982982_1983333_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65946.1|1983813_1984254_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	34.4	3.4e-11
AYK65947.1|1984254_1984434_+	hypothetical protein	NA	NA	NA	NA	NA
AYK68141.1|1985427_1986975_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AYK65948.1|1987104_1987545_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65949.1|1987952_1989416_+	hypothetical protein	NA	A0A0S2MYH0	Enterococcus_phage	36.0	1.0e-11
AYK65950.1|1989805_1991692_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	21.8	6.6e-19
AYK65951.1|1994183_1995334_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	98.9	9.8e-151
AYK68142.1|1996032_1996296_-	hypothetical protein	NA	NA	NA	NA	NA
AYK65952.1|1996679_1997594_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
>prophage 11
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	2325837	2368468	4293706	transposase,protease	Bacillus_phage(37.5%)	43	NA	NA
AYK66231.1|2325837_2326779_+|protease	serine protease	protease	NA	NA	NA	NA
AYK66232.1|2326741_2327140_+	DUF2606 family protein	NA	NA	NA	NA	NA
AYK66233.1|2327310_2328201_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYK66234.1|2328396_2328930_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AYK66235.1|2328920_2329409_+	DedA family protein	NA	NA	NA	NA	NA
AYK66236.1|2329401_2330193_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AYK66237.1|2330247_2330526_+	hypothetical protein	NA	NA	NA	NA	NA
AYK66238.1|2330955_2331924_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
AYK66239.1|2332057_2333410_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK66240.1|2333540_2334785_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AYK66241.1|2336837_2337587_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
AYK66242.1|2337805_2338513_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYK66243.1|2338546_2338822_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
AYK66244.1|2339031_2340102_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
AYK66245.1|2340053_2340236_-	hypothetical protein	NA	NA	NA	NA	NA
AYK66246.1|2340240_2341593_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK66247.1|2341719_2343132_-	S-methylmethionine permease	NA	NA	NA	NA	NA
AYK66248.1|2343251_2344193_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AYK66249.1|2344196_2344310_+	homocysteine methyltransferase	NA	NA	NA	NA	NA
AYK66250.1|2344321_2345728_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
AYK66251.1|2348301_2349246_+	response regulator	NA	NA	NA	NA	NA
AYK66252.1|2349268_2349457_+	hypothetical protein	NA	NA	NA	NA	NA
AYK66253.1|2349472_2350339_+	5-dehydro-4-deoxyglucarate dehydratase	NA	NA	NA	NA	NA
AYK66254.1|2350428_2351892_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
AYK66255.1|2351975_2353343_+	MFS transporter	NA	NA	NA	NA	NA
AYK66256.1|2353379_2354747_+	glucarate dehydratase	NA	NA	NA	NA	NA
AYK66257.1|2354816_2355518_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
AYK66258.1|2355609_2357142_+	galactarate dehydratase	NA	NA	NA	NA	NA
AYK66259.1|2358738_2358900_+	tryptophan RNA-binding attenuator protein inhibitory protein	NA	NA	NA	NA	NA
AYK66260.1|2358920_2359859_+	DMT family transporter	NA	NA	NA	NA	NA
AYK68154.1|2359955_2360636_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.2	1.6e-31
AYK66261.1|2360637_2361573_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.0e-25
AYK66262.1|2361664_2362588_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.0	3.0e-41
AYK68155.1|2362606_2363293_+	ABC transporter permease	NA	NA	NA	NA	NA
AYK66263.1|2363253_2363388_-	hypothetical protein	NA	NA	NA	NA	NA
AYK66264.1|2363347_2363734_-	DUF2512 family protein	NA	NA	NA	NA	NA
AYK66265.1|2364046_2364475_+	cell wall hydrolase	NA	A0A172JHR8	Bacillus_phage	35.4	2.7e-05
AYK66266.1|2364761_2365247_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYK66267.1|2365301_2365592_-	hypothetical protein	NA	NA	NA	NA	NA
AYK66268.1|2365632_2366880_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK68156.1|2366911_2367151_+	hypothetical protein	NA	NA	NA	NA	NA
AYK66269.1|2367239_2368154_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
AYK66270.1|2368150_2368468_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	2587238	2630650	4293706	transposase,protease	Streptococcus_phage(25.0%)	44	NA	NA
AYK66443.1|2587238_2588591_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.4	3.1e-87
AYK66444.1|2588714_2588894_-	Fur-regulated basic protein FbpB	NA	NA	NA	NA	NA
AYK66445.1|2588847_2589012_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
AYK66446.1|2589259_2590132_+	cation transporter	NA	NA	NA	NA	NA
AYK66447.1|2590146_2590467_-	thiol reductase thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	33.3	2.2e-07
AYK66448.1|2590620_2591706_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AYK68166.1|2591777_2593151_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AYK66449.1|2593550_2595035_+	ATP-dependent RNA helicase CshA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.3	7.6e-63
AYK66450.1|2595207_2595687_+	hypothetical protein	NA	NA	NA	NA	NA
AYK66451.1|2595676_2597158_+	hypothetical protein	NA	NA	NA	NA	NA
AYK66452.1|2597339_2597939_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AYK66453.1|2598033_2598399_+	holo-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
AYK68167.1|2598564_2599581_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AYK66454.1|2599695_2600865_+	alanine racemase	NA	NA	NA	NA	NA
AYK66455.1|2600980_2601262_+	antitoxin EndoAI	NA	NA	NA	NA	NA
AYK66456.1|2601266_2601617_+	mRNA interferase EndoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	5.8e-14
AYK66457.1|2601721_2602546_+	RsbT co-antagonist protein RsbRA	NA	NA	NA	NA	NA
AYK66458.1|2602550_2602916_+	RsbT antagonist protein RsbS	NA	NA	NA	NA	NA
AYK66459.1|2602919_2603321_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AYK66460.1|2603332_2604340_+	phosphoserine phosphatase RsbU	NA	NA	NA	NA	NA
AYK66461.1|2604401_2604731_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AYK66462.1|2604727_2605210_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
AYK66463.1|2605175_2605964_+	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	35.2	2.2e-24
AYK66464.1|2605963_2606563_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
AYK66465.1|2606704_2608057_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK66466.1|2608248_2610408_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
AYK66467.1|2610417_2610531_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
AYK66468.1|2610634_2611087_+	SprT family protein	NA	U5J9G1	Bacillus_phage	29.8	3.8e-05
AYK66469.1|2612145_2612709_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYK66470.1|2612899_2613424_-	hypothetical protein	NA	NA	NA	NA	NA
AYK68168.1|2613604_2613802_-	hypothetical protein	NA	NA	NA	NA	NA
AYK68169.1|2614667_2615459_+	DUF3427 domain-containing protein	NA	NA	NA	NA	NA
AYK66471.1|2615706_2616207_-	DUF4944 domain-containing protein	NA	NA	NA	NA	NA
AYK66472.1|2616292_2617342_+	hypothetical protein	NA	A0A0C5AEJ0	Paenibacillus_phage	28.2	2.2e-08
AYK66473.1|2617570_2618329_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
AYK68170.1|2618325_2619873_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AYK66474.1|2620356_2620812_+	hypothetical protein	NA	NA	NA	NA	NA
AYK68171.1|2621591_2621825_+	transcriptional regulator	NA	NA	NA	NA	NA
AYK66475.1|2623073_2623250_+	hypothetical protein	NA	NA	NA	NA	NA
AYK66476.1|2623274_2623961_+	hypothetical protein	NA	O64048	Bacillus_phage	98.2	1.6e-124
AYK66477.1|2624308_2625661_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK66478.1|2625947_2626133_+	hypothetical protein	NA	NA	NA	NA	NA
AYK66479.1|2627315_2627516_+	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	75.8	9.6e-22
AYK68172.1|2629102_2630650_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 13
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	2651564	2689077	4293706	transposase	Streptococcus_phage(71.43%)	38	NA	NA
AYK66497.1|2651564_2652915_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	42.1	8.1e-88
AYK66498.1|2654108_2655557_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AYK66499.1|2655674_2656298_-	flavin reductase family protein	NA	NA	NA	NA	NA
AYK66500.1|2656387_2657068_+	transcriptional regulator	NA	NA	NA	NA	NA
AYK66501.1|2657147_2657591_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AYK66502.1|2657676_2657856_-	hypothetical protein	NA	NA	NA	NA	NA
AYK66503.1|2657852_2658002_-	hypothetical protein	NA	NA	NA	NA	NA
AYK66504.1|2658269_2659457_+	sensor histidine kinase	NA	NA	NA	NA	NA
AYK66505.1|2659537_2660452_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
AYK66506.1|2660448_2660766_-|transposase	transposase	transposase	NA	NA	NA	NA
AYK68175.1|2660829_2662998_+	MMPL family transporter	NA	NA	NA	NA	NA
AYK66507.1|2663131_2664484_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK66508.1|2664634_2665324_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
AYK66509.1|2665413_2666226_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AYK66510.1|2666337_2667231_-	cation transporter	NA	NA	NA	NA	NA
AYK66511.1|2667707_2668328_+	nitroreductase family protein	NA	NA	NA	NA	NA
AYK66512.1|2668343_2669282_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
AYK66513.1|2669380_2669770_+	DoxX family protein	NA	NA	NA	NA	NA
AYK66514.1|2669955_2670303_+	thioredoxin	NA	NA	NA	NA	NA
AYK66515.1|2670408_2671761_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK66516.1|2671765_2671969_+	hypothetical protein	NA	NA	NA	NA	NA
AYK66517.1|2671897_2672134_-	spore germination protein	NA	NA	NA	NA	NA
AYK66518.1|2672659_2672890_-	spore germination protein	NA	NA	NA	NA	NA
AYK66519.1|2674470_2674902_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AYK66520.1|2674914_2675157_-	spore germination protein	NA	NA	NA	NA	NA
AYK66521.1|2675170_2675443_-	spore germination protein	NA	NA	NA	NA	NA
AYK66522.1|2675742_2676342_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYK66523.1|2676338_2676683_+	DoxX family protein	NA	NA	NA	NA	NA
AYK66524.1|2676845_2677319_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK66525.1|2677479_2679126_-	ABC transporter ATP-binding protein	NA	Q6DMX7	Streptococcus_phage	32.3	9.4e-54
AYK66526.1|2679445_2680822_-	amino acid permease	NA	NA	NA	NA	NA
AYK66527.1|2680993_2681512_-	damage-inducible protein DinB	NA	NA	NA	NA	NA
AYK66528.1|2681680_2682139_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK66529.1|2682135_2684793_+	MMPL family transporter	NA	NA	NA	NA	NA
AYK66530.1|2684939_2685569_-	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	53.1	6.2e-06
AYK66531.1|2685584_2686079_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK68176.1|2686390_2687599_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
AYK66532.1|2687724_2689077_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 14
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	2794340	2802706	4293706		Synechococcus_phage(50.0%)	8	NA	NA
AYK66618.1|2794340_2795636_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	7.7e-19
AYK66619.1|2795709_2796435_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	4.1e-46
AYK66620.1|2796427_2796682_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AYK66621.1|2796678_2797362_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AYK66622.1|2797345_2799574_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	3.8e-159
AYK66623.1|2799549_2800980_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
AYK66624.1|2801081_2802122_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	1.7e-64
AYK66625.1|2802118_2802706_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
>prophage 15
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	3068227	3074706	4293706	integrase	Streptococcus_phage(50.0%)	11	3064316:3064329	3070411:3070424
3064316:3064329	attL	TATTGAAACTTTTT	NA	NA	NA	NA
AYK66848.1|3068227_3069370_-|integrase	site-specific integrase	integrase	A0A0A8WF08	Clostridium_phage	31.8	3.0e-35
AYK68190.1|3069395_3069914_-	ImmA/IrrE family metallo-endopeptidase	NA	Q0H245	Geobacillus_phage	29.5	1.9e-08
AYK66849.1|3069913_3070291_-	XRE family transcriptional regulator	NA	D2XQ11	Bacillus_virus	38.2	1.6e-09
AYK66850.1|3070467_3070659_+	ICEBs1 excisionase	NA	NA	NA	NA	NA
3070411:3070424	attR	AAAAAGTTTCAATA	NA	NA	NA	NA
AYK66851.1|3070655_3070916_+	hypothetical protein	NA	NA	NA	NA	NA
AYK66852.1|3070969_3071230_+	hypothetical protein	NA	NA	NA	NA	NA
AYK66853.1|3071432_3071534_+	hypothetical protein	NA	NA	NA	NA	NA
AYK66854.1|3071596_3071977_+	DUF961 domain-containing protein	NA	A0A1S5SF38	Streptococcus_phage	37.0	3.7e-06
AYK66855.1|3072021_3072204_+	hypothetical protein	NA	NA	NA	NA	NA
AYK68191.1|3072212_3073655_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	50.3	1.5e-119
AYK66856.1|3073647_3074706_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	41.6	1.3e-64
>prophage 16
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	3326846	3500943	4293706	integrase,portal,tRNA,terminase,tail,head,holin,capsid,plate,transposase,coat	Bacillus_phage(29.21%)	207	3404242:3404301	3459649:3461207
AYK68204.1|3326846_3327839_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AYK67086.1|3328583_3330221_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYK67087.1|3330328_3331264_+	ABC transporter permease	NA	NA	NA	NA	NA
AYK67088.1|3331267_3332185_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYK67089.1|3332189_3333266_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
AYK67090.1|3333267_3334185_+	oligopeptide transport ATP-binding protein OppF	NA	G9BWD6	Planktothrix_phage	34.8	1.6e-23
AYK67091.1|3334290_3335508_+	MFS transporter	NA	NA	NA	NA	NA
AYK67092.1|3335671_3336250_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYK67093.1|3336430_3336826_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AYK67094.1|3336868_3337525_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
AYK67095.1|3337694_3337835_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67096.1|3337801_3338458_+	adaptor protein MecA	NA	NA	NA	NA	NA
AYK67097.1|3338452_3338575_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67098.1|3338618_3339770_+	competence protein CoiA	NA	NA	NA	NA	NA
AYK67099.1|3339816_3341853_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AYK67100.1|3341866_3342034_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67101.1|3342129_3342333_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67102.1|3342347_3343247_-	DsbA family protein	NA	NA	NA	NA	NA
AYK67103.1|3343243_3343642_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
AYK68205.1|3343896_3344442_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	59.7	4.1e-38
AYK67104.1|3344645_3345218_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AYK67105.1|3345342_3345711_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67106.1|3345739_3346375_+	GTP pyrophosphokinase YjbM	NA	NA	NA	NA	NA
AYK67107.1|3346393_3347194_+	NAD(+) kinase	NA	NA	NA	NA	NA
AYK68206.1|3347256_3348108_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AYK67108.1|3348120_3348855_-	bis(5'-nucleosyl)-tetraphosphatase PrpE [asymmetrical]	NA	M4Q4T6	Vibrio_phage	23.3	2.5e-06
AYK67109.1|3349087_3350932_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AYK67110.1|3351180_3351891_+	thiaminase II	NA	NA	NA	NA	NA
AYK67111.1|3352465_3353575_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
AYK68207.1|3353574_3353775_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AYK67112.1|3353771_3354542_+	thiazole synthase	NA	NA	NA	NA	NA
AYK67113.1|3354538_3355549_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
AYK67114.1|3355567_3356383_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AYK67115.1|3356518_3357295_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AYK67116.1|3357395_3358079_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYK67117.1|3358171_3358621_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK67118.1|3359387_3359906_-|coat	spore coat protein X	coat	NA	NA	NA	NA
AYK67119.1|3360005_3360320_-|coat	spore coat protein CotW	coat	NA	NA	NA	NA
AYK67120.1|3360361_3360748_-|coat	spore coat protein V	coat	NA	NA	NA	NA
AYK67121.1|3360907_3361264_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
AYK67122.1|3361544_3361751_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67123.1|3361832_3361979_+	sporulation protein YjcZ	NA	NA	NA	NA	NA
AYK67124.1|3362111_3362366_+	sporulation-specific transcription factor SpoVIF	NA	NA	NA	NA	NA
AYK67125.1|3362439_3364719_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	34.8	7.8e-91
AYK67126.1|3364835_3365090_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67127.1|3365161_3365584_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK67128.1|3365587_3366103_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67129.1|3366139_3366862_-	esterase family protein	NA	NA	NA	NA	NA
AYK68208.1|3367217_3368339_+	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	26.3	6.2e-17
AYK67130.1|3368331_3369504_+	cystathionine beta-lyase MetC	NA	NA	NA	NA	NA
AYK67131.1|3369734_3370280_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYK67132.1|3370349_3371540_-	DUF819 domain-containing protein	NA	NA	NA	NA	NA
AYK67133.1|3371899_3373111_-|integrase	site-specific integrase	integrase	A0A2I7SC08	Paenibacillus_phage	46.7	1.2e-98
AYK67134.1|3373113_3373608_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	68.6	2.0e-60
AYK67135.1|3373679_3374027_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	64.3	3.6e-16
AYK67136.1|3374039_3374561_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67137.1|3374860_3375244_-	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	68.3	3.6e-33
AYK67138.1|3375407_3375635_+	XRE family transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	61.6	4.8e-17
AYK67139.1|3375646_3375838_+	DNA-binding protein	NA	NA	NA	NA	NA
AYK67140.1|3375902_3376664_+	phage antirepressor Ant	NA	A0A290FZK7	Caldibacillus_phage	68.8	5.8e-99
AYK67141.1|3376796_3377366_+	XRE family transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	55.6	1.4e-60
AYK67142.1|3377362_3377620_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	1.7e-10
AYK67143.1|3377616_3377799_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67144.1|3377749_3377950_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67145.1|3378052_3378241_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67146.1|3378240_3379191_+	hypothetical protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	71.4	1.7e-132
AYK67147.1|3379193_3380036_+	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	85.5	2.7e-129
AYK67148.1|3380200_3380899_+	DNA-binding protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	42.4	9.2e-43
AYK67149.1|3380783_3381731_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	52.2	3.1e-57
AYK67150.1|3381966_3382392_+	hypothetical protein	NA	O64129	Bacillus_phage	88.7	1.2e-66
AYK67151.1|3382378_3382837_+	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	80.0	4.6e-59
AYK67152.1|3382790_3383000_+	hypothetical protein	NA	NA	NA	NA	NA
AYK68209.1|3383264_3383705_+	HNH endonuclease	NA	A0A1W6DXY0	Salmonella_phage	34.8	2.2e-10
AYK67153.1|3383779_3383986_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	2.1e-19
AYK68210.1|3384056_3384380_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AYK67154.1|3384376_3384625_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	42.3	1.6e-05
AYK67155.1|3384636_3385617_+	DNA (cytosine-5-)-methyltransferase	NA	A8YQM6	Lactobacillus_phage	45.5	1.5e-62
AYK67156.1|3385864_3386191_+	hypothetical protein	NA	A0A2P1JTX4	Anoxybacillus_phage	33.3	2.4e-06
AYK67157.1|3386383_3386515_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67158.1|3386530_3386716_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67159.1|3386736_3387198_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	46.7	2.4e-23
AYK67160.1|3387324_3387669_+	hypothetical protein	NA	Q38578	Bacillus_phage	60.0	1.1e-09
AYK67161.1|3387668_3387851_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67162.1|3388024_3388774_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	54.8	6.3e-66
AYK67163.1|3388773_3390048_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	63.1	6.0e-157
AYK67164.1|3390044_3391448_+|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	59.8	1.2e-153
AYK67165.1|3391434_3392358_+|head	phage head morphogenesis protein	head	A0A1Q1PVS0	Bacillus_phage	45.8	2.0e-69
AYK67166.1|3392763_3393003_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67167.1|3393100_3393682_+	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	54.7	3.6e-53
AYK67168.1|3393696_3394614_+|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	68.9	2.0e-114
AYK67169.1|3394618_3394954_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67170.1|3394955_3395207_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67171.1|3395215_3395515_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67172.1|3395511_3395856_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AYK67173.1|3395842_3396259_+	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	52.2	1.5e-32
AYK67174.1|3396277_3396676_+	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	43.1	9.3e-24
AYK67175.1|3396689_3397202_+|tail	phage major tail protein, TP901-1 family	tail	Q0PDK9	Bacillus_phage	45.9	1.7e-30
AYK67176.1|3397125_3397458_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	77.8	1.5e-27
AYK67177.1|3397496_3397712_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
AYK67178.1|3397766_3398279_+	hypothetical protein	NA	A0A2H4JI48	uncultured_Caudovirales_phage	35.2	7.2e-13
AYK68211.1|3398326_3398635_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67179.1|3398639_3403346_+	hypothetical protein	NA	A0A1W6JQL3	Staphylococcus_phage	28.9	1.9e-30
AYK67180.1|3403342_3404107_+|tail	phage tail family protein	tail	NA	NA	NA	NA
AYK67181.1|3404081_3404342_-	hypothetical protein	NA	NA	NA	NA	NA
3404242:3404301	attL	TCAGCTTGTAGAGAAAACGACGTTTTTTCTACAAGCTTTTTTGTTTTATACAGTTTCTTT	NA	NA	NA	NA
AYK67182.1|3404346_3405699_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK67183.1|3405806_3409043_+	hypothetical protein	NA	Q5YA57	Bacillus_phage	48.6	7.1e-130
AYK67184.1|3409057_3409462_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67185.1|3409622_3409793_+	XkdX family protein	NA	NA	NA	NA	NA
AYK67186.1|3409804_3410062_+	hypothetical protein	NA	NA	NA	NA	NA
AYK68212.1|3410148_3410418_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	75.3	1.4e-28
AYK67187.1|3410433_3410697_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	69.0	5.5e-25
AYK67188.1|3410750_3411572_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	74.5	1.2e-65
AYK67189.1|3411608_3412049_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AYK67190.1|3412063_3413899_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	46.2	4.3e-116
AYK67191.1|3414149_3414863_+	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	47.0	3.7e-55
AYK67192.1|3414863_3415481_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67193.1|3415691_3416018_-	YolD-like family protein	NA	O64030	Bacillus_phage	45.1	1.9e-14
AYK67194.1|3416461_3417511_+|integrase	integrase	integrase	Q938N9	Temperate_phage	28.1	1.0e-08
AYK67195.1|3418734_3419286_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	45.3	2.4e-38
AYK67196.1|3419426_3419651_-	XRE family transcriptional regulator	NA	D0R7I7	Paenibacillus_phage	69.2	8.9e-08
AYK67197.1|3419721_3420033_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67198.1|3420046_3421471_-	lipase	NA	NA	NA	NA	NA
AYK67199.1|3421521_3421863_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AYK67200.1|3421893_3423141_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	4.5e-24
AYK67201.1|3423283_3423790_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYK67202.1|3424009_3424405_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67203.1|3424632_3425112_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AYK67204.1|3425152_3425347_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
AYK67205.1|3426202_3426397_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67206.1|3426415_3427396_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AYK67207.1|3427528_3427762_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK67208.1|3428014_3429418_+	DUF4163 domain-containing protein	NA	NA	NA	NA	NA
AYK67209.1|3429457_3429931_-	DUF2690 domain-containing protein	NA	NA	NA	NA	NA
AYK67210.1|3430058_3430226_-	putative motility protein	NA	NA	NA	NA	NA
AYK67211.1|3435147_3435792_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
AYK67212.1|3435867_3436494_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AYK67213.1|3436524_3436803_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67214.1|3437191_3438382_+	cytochrome P450	NA	NA	NA	NA	NA
AYK67215.1|3438404_3439583_+	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	28.3	9.5e-08
AYK67216.1|3439623_3439812_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	77.6	3.4e-21
AYK67217.1|3439985_3440801_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AYK67218.1|3440845_3441598_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AYK67219.1|3441597_3442350_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.8	1.1e-17
AYK67220.1|3442469_3443444_-	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
AYK67221.1|3443575_3444073_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AYK67222.1|3444461_3444884_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
AYK67223.1|3444923_3446102_+	NADH dehydrogenase	NA	NA	NA	NA	NA
AYK67224.1|3446299_3447721_+	glucuronate isomerase	NA	NA	NA	NA	NA
AYK67225.1|3447788_3449168_+	MFS transporter	NA	NA	NA	NA	NA
AYK67226.1|3449272_3450286_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AYK67227.1|3452387_3453224_+	SDR family NAD(P)-dependent oxidoreductase	NA	M1NMS3	Moumouvirus	30.4	2.7e-09
AYK67228.1|3454627_3455629_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AYK67229.1|3455703_3457146_+	tagaturonate reductase	NA	NA	NA	NA	NA
AYK67230.1|3458674_3459439_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AYK67231.1|3459753_3461106_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK67232.1|3461244_3461709_-	DUF664 domain-containing protein	NA	NA	NA	NA	NA
3459649:3461207	attR	TCAGCTTGTAGAGAAAACGACGTTTTTTCTACAAGCTTTTTTGTTTTATACAGTTTCTTTAGATATTCATCAGGTTTCAGATGCAGAAAAAGCGCTCCCACATGCCTAGCCCTGCTTGGCTAGGTATGTGGCAATCTTCTTCATGTTCTGGCATGCGGCTGTGAGGAGAACTTGTTCACTCACATTTCGTTTTCCCCTCAACCTGCAATAGCGAAGCCCATGCAGCTGTTTTGAATCTGCAAAGCTTCGCTCTATTTTTTCTTTTCTTTTTTTGTAGAGGTTTTTTCCTGAAACAGACAAGCGATTTTGTCTGACCTTTTCTTTATGATCTTCCCATACATGTCGAGTAATCACTTTCTGCCGATTCTTTGATTTTGTACAGTTTTCAAGCAGTGGGCATGAGGAACATATTTCAGGATTTGATTTATATGACCGGTAGCCTTTTCGGTCAGTTGTTGAGTATGTAAGTGTTTGGTGATTTGGACAAATGTATCTGTCTTGTTCACTGTCATAATGAAATTTCCATTTTGGAAACAAGCCTCGGATAGGGTGATAACGTCTATGTGCGATGACACCAAAGATTTGGCGGTCAGATAATCCTTTACAGATCGGAGTCGTTAAATATCCGGAATCAAGGGCGACGGCTTCTACTTGAAAACCAAATCGTGCGATTTGGTGGTCTAATCGGTCAAGATAAGGCACAGAATCATGGACATTTCCAGGTGTGACGTAGGCATCGGTGATAATGTTGTATTTCATATCTGTTGTGCGGTGATCTAAATAGAAAAAACCTTCTGGTTTGTTTTCACGATACAGATAGCCACTTTCCGGATCGGTTGTACTGTGGCGGATCTCTTTTTCAGCTTTCACCTCCTCTTTGGCTGTTAATGGTTTTTTTCCGTGTTCCTCCCGATCCTCTTGAATGGCTTCATTTAAATCCTTGATATAGTTTTGGGTATCCTGCGCAATTGTTTTTCTTGTGTATTTATGCTTGTTGGCATTGGCTTTAAGGTGTGTGGAGTCGGTGAATAGGACTCGTCCGCCCACCATGTCATGATTGATGGCCTGAAGAACGATCTCATCAAAAATGTCTTGGAAGATGGTTGTATCTTTAAAGCGTGTGCGTCTGTTCCAGCTGATGGTGGAGTGGTGTGGAACCGGGTCGTTTATGTTCAATCCGAGAAACCATCTGTACGCCATATTGTAGTAAATTTCTTTTTCAAGCTGTCTTTCTGAACGGATACCATAGAGGTATCCGATAAACATCATTTTAAATAAAATAAGCGGATCAAGTGAGGGGCGGCCTTTGTTTTCACTGTAGTAAGGTTTCACCTTTTCAATGATGAAAGAGAAGTCTATGTGTTTATCAATTTTCCGAAGCAGGTGATCCTCTTCAACGAGTTGGTCAAGCAGAACAAATTCGGCTGTGTTTTGAGAAGAGTTTCTTGTGTGGAACATGAGAAAGACACCGTCCTTTTAAGTCTTTCTTTTATTTTATTACAGAAGAATGGATATTTTAAAGAAAAATAAAGGCTGTCGAGATTTTCTCGACAGCCTGA	NA	NA	NA	NA
AYK67233.1|3463253_3464390_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	46.8	4.1e-93
AYK67234.1|3464379_3464514_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
AYK67235.1|3464544_3464802_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67236.1|3464923_3465877_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	74.4	7.3e-67
AYK67237.1|3465915_3466293_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	4.7e-17
AYK67238.1|3466398_3467001_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	48.2	7.1e-44
AYK67239.1|3467561_3468158_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
AYK67240.1|3468320_3468662_-	transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	46.6	4.5e-19
AYK67241.1|3468840_3469020_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67242.1|3469006_3469843_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	27.8	2.3e-24
AYK67243.1|3469742_3470543_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	52.2	3.8e-61
AYK67244.1|3470542_3470710_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67245.1|3470794_3471145_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
AYK67246.1|3471148_3471343_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AYK67247.1|3471463_3471973_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	38.0	1.9e-21
AYK67248.1|3472090_3472888_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.5	4.2e-60
AYK67249.1|3472884_3474186_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.5	1.1e-153
AYK67250.1|3474189_3475677_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
AYK67251.1|3475696_3476524_+	phage-like element PBSX protein XkdF	NA	A0A1B1P7E4	Bacillus_phage	58.7	2.1e-54
AYK67252.1|3476549_3477485_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
AYK67253.1|3477506_3477890_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
AYK67254.1|3477886_3478243_+	DUF3599 family protein	NA	NA	NA	NA	NA
AYK67255.1|3478239_3478725_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	3.6e-38
AYK67256.1|3478737_3479178_+|portal	phage portal protein	portal	NA	NA	NA	NA
AYK67257.1|3479181_3479400_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67258.1|3479396_3480797_+	phage-like element PBSX protein XkdK	NA	A0A0A7S087	Clostridium_phage	39.3	2.3e-77
AYK67259.1|3480798_3481242_+|portal	phage portal protein	portal	A0A0K2CNG3	Brevibacillus_phage	45.9	2.9e-26
AYK67260.1|3481333_3481780_+	phage-like element PBSX protein XkdN	NA	A0A249XXA9	Clostridium_phage	33.6	7.5e-14
AYK67261.1|3481809_3481959_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67262.1|3481960_3485842_+	lytic transglycosylase	NA	A0A1L2JY60	Aeribacillus_phage	44.5	3.9e-42
AYK67263.1|3485834_3486494_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.0	6.2e-25
AYK67264.1|3486509_3487487_+|portal	phage portal protein	portal	H7BV96	unidentified_phage	32.3	5.1e-39
AYK67265.1|3487486_3487753_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	35.2	8.4e-05
AYK67266.1|3487810_3488236_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	5.6e-11
AYK67267.1|3488228_3489275_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	5.7e-73
AYK67268.1|3489258_3489837_+	DUF2313 domain-containing protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.1	2.3e-15
AYK67269.1|3489833_3490106_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67270.1|3490108_3492193_+|terminase	terminase	terminase	A0A1P8CWR7	Bacillus_phage	53.0	1.7e-31
AYK67271.1|3492204_3492534_+|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	40.7	3.8e-15
AYK67272.1|3492530_3492695_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	66.0	5.5e-15
AYK67273.1|3492738_3493578_+|portal	phage portal protein	portal	NA	NA	NA	NA
AYK67274.1|3493630_3493900_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	6.2e-24
AYK67275.1|3493912_3494176_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	63.2	8.8e-23
AYK67276.1|3494188_3495082_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.2	5.2e-83
AYK67277.1|3495119_3495257_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67278.1|3495342_3495513_-	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
AYK67279.1|3495512_3496259_-	type II toxin-antitoxin system SpoIISA family toxin	NA	NA	NA	NA	NA
AYK67280.1|3496368_3497370_-	low-affinity inorganic phosphate transporter	NA	NA	NA	NA	NA
AYK67281.1|3497382_3498000_-	DUF47 domain-containing protein	NA	NA	NA	NA	NA
AYK67282.1|3498276_3499593_-	amino acid permease	NA	NA	NA	NA	NA
AYK67283.1|3499818_3500943_+|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
>prophage 17
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	3926510	3975593	4293706	integrase,protease,tRNA,holin,transposase,coat	Bacillus_phage(73.91%)	48	3923861:3923879	3977915:3977933
3923861:3923879	attL	TAAAAACAAATAAAGCATT	NA	NA	NA	NA
AYK67684.1|3926510_3928040_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AYK67685.1|3928041_3928473_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67686.1|3928734_3929280_+|coat	spore coat protein E	coat	NA	NA	NA	NA
AYK67687.1|3929412_3931989_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	27.5	4.1e-40
AYK67688.1|3932004_3933888_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.5	6.9e-69
AYK67689.1|3934287_3934743_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67690.1|3934897_3935455_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67691.1|3935575_3936190_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYK67692.1|3936326_3936683_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67693.1|3936761_3937346_-	hydrolase	NA	NA	NA	NA	NA
AYK67694.1|3937471_3938800_-|protease	serine protease	protease	A0A1B0T6A2	Bacillus_phage	33.6	1.2e-27
AYK67695.1|3939024_3939258_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67696.1|3939537_3940245_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	56.9	2.4e-51
AYK67697.1|3940314_3940767_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AYK67698.1|3940780_3941134_-	multidrug efflux SMR transporter subunit EbrB	NA	NA	NA	NA	NA
AYK67699.1|3941147_3941465_-	multidrug efflux SMR transporter subunit EbrA	NA	NA	NA	NA	NA
AYK67700.1|3941853_3942267_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67701.1|3942366_3943311_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AYK67702.1|3943350_3943572_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AYK67703.1|3943767_3944040_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67704.1|3944121_3944352_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67705.1|3944594_3944987_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
AYK67706.1|3944946_3947049_+	ribonucleotide-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
AYK67707.1|3947066_3948056_+	ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
AYK67708.1|3948105_3948726_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.4	7.9e-46
AYK67709.1|3948789_3949557_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	5.3e-52
AYK67710.1|3950175_3951144_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
AYK67711.1|3951276_3952539_+	GTPase HflX	NA	NA	NA	NA	NA
AYK67712.1|3952556_3953822_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AYK67713.1|3953931_3954339_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AYK67714.1|3954397_3955732_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
AYK67715.1|3955851_3956997_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	38.7	8.8e-67
AYK68227.1|3957253_3958063_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67716.1|3958082_3959330_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK67717.1|3959588_3960569_-	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	75.5	1.1e-78
AYK67718.1|3960744_3962631_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	76.2	1.4e-149
AYK67719.1|3962643_3963102_+	SMI1/KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	85.5	2.8e-72
AYK67720.1|3963157_3963736_+	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	93.2	1.4e-100
AYK67721.1|3963771_3964305_+	N-acetyltransferase	NA	O64026	Bacillus_phage	98.9	4.0e-99
AYK67722.1|3964562_3965687_-|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
AYK67723.1|3966440_3966641_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67724.1|3966928_3968059_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	49.5	6.1e-97
AYK67725.1|3968194_3968446_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	95.2	2.3e-36
AYK67726.1|3968466_3968859_-	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	98.5	8.4e-62
AYK67727.1|3968974_3970078_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1P8CWN6	Bacillus_phage	93.7	2.9e-176
AYK68228.1|3970230_3970785_-	hypothetical protein	NA	NA	NA	NA	NA
AYK68229.1|3972117_3972936_-	hypothetical protein	NA	O64043	Bacillus_phage	68.3	1.6e-102
AYK67728.1|3972950_3975593_-	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	92.8	0.0e+00
3977915:3977933	attR	AATGCTTTATTTGTTTTTA	NA	NA	NA	NA
>prophage 18
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	3983323	3992940	4293706	integrase	Bacillus_phage(84.62%)	15	3970010:3970023	3987011:3987024
3970010:3970023	attL	ACCATTTAACTTTA	NA	NA	NA	NA
AYK67730.1|3983323_3983950_-	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	28.9	3.1e-18
AYK67731.1|3984131_3984542_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67732.1|3984605_3984962_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67733.1|3985374_3986382_-|integrase	site-specific integrase	integrase	A0A0H3V0P2	Geobacillus_virus	66.0	4.4e-123
AYK67734.1|3986395_3986815_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	89.1	7.4e-64
AYK67735.1|3986798_3987299_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	95.8	6.5e-83
3987011:3987024	attR	ACCATTTAACTTTA	NA	NA	NA	NA
AYK67736.1|3987358_3987556_-	XkdX family protein	NA	A0A1P8CWR4	Bacillus_phage	61.9	1.0e-15
AYK67737.1|3987915_3988944_-	hypothetical protein	NA	M4ZRP1	Bacillus_phage	66.1	4.3e-65
AYK67738.1|3988943_3989300_-	hypothetical protein	NA	O64055	Bacillus_phage	92.4	5.9e-54
AYK67739.1|3989363_3989591_-	hypothetical protein	NA	A0A1P8CWR2	Bacillus_phage	100.0	1.9e-37
AYK67740.1|3989590_3990202_-	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	96.6	6.3e-64
AYK67741.1|3990219_3991014_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	38.6	3.3e-20
AYK67742.1|3991049_3991778_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	43.0	3.5e-45
AYK67743.1|3991774_3992281_-	hypothetical protein	NA	O64060	Bacillus_phage	85.1	9.8e-79
AYK67744.1|3992277_3992940_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	78.3	7.1e-69
>prophage 19
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	3998230	4075250	4293706	transposase,coat,integrase	Bacillus_phage(86.15%)	98	4021324:4021346	4045629:4045651
AYK67750.1|3998230_3999979_-	hypothetical protein	NA	A0A0K2FLD6	Brevibacillus_phage	30.2	2.4e-63
AYK67751.1|3999978_4000971_-	hypothetical protein	NA	Q331V7	Clostridium_botulinum_C_phage	24.0	1.5e-06
AYK67752.1|4001074_4001575_-	hypothetical protein	NA	A0A1P8CWS3	Bacillus_phage	96.4	4.8e-86
AYK67753.1|4001612_4001942_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67754.1|4002177_4003395_-	hypothetical protein	NA	A0A1P8CWS1	Bacillus_phage	99.5	5.6e-229
AYK67755.1|4003407_4003599_-	hypothetical protein	NA	A0A1P8CWT3	Bacillus_phage	100.0	1.9e-27
AYK67756.1|4004747_4005023_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	93.4	2.0e-38
AYK68230.1|4005285_4005900_-	hypothetical protein	NA	A0A1P8CWS4	Bacillus_phage	99.0	2.2e-112
AYK67757.1|4006315_4008193_-	hypothetical protein	NA	A0A1P8CWS8	Bacillus_phage	98.2	0.0e+00
AYK67758.1|4008237_4008417_-	hypothetical protein	NA	A0A1P8CWT4	Bacillus_phage	100.0	3.1e-27
AYK67759.1|4008970_4009291_+	hypothetical protein	NA	A0A1P8CWU7	Bacillus_phage	100.0	1.3e-57
AYK67760.1|4010456_4010660_+	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	68.7	4.7e-16
AYK67761.1|4010710_4010950_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67762.1|4011030_4012263_+	hypothetical protein	NA	O64082	Bacillus_phage	64.5	1.4e-155
AYK67763.1|4012609_4013464_+	hypothetical protein	NA	A0A1P8CWT8	Bacillus_phage	93.0	4.4e-140
AYK67764.1|4013469_4014387_+	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	90.2	3.0e-142
AYK67765.1|4014388_4014991_+	hypothetical protein	NA	A0A1P8CWV1	Bacillus_phage	100.0	3.9e-106
AYK67766.1|4014992_4016789_+	ATP-dependent helicase	NA	A0A1P8CWU5	Bacillus_phage	99.8	0.0e+00
AYK67767.1|4017033_4017300_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67768.1|4017707_4018172_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67769.1|4018239_4018419_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67770.1|4018450_4018879_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYK67771.1|4019035_4019215_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	91.5	2.6e-26
AYK67772.1|4019285_4019537_+	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	98.8	1.0e-36
AYK67773.1|4019540_4019756_+	hypothetical protein	NA	O64089	Bacillus_phage	93.0	1.4e-29
AYK67774.1|4019767_4019899_+	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	95.3	4.2e-18
AYK67775.1|4019959_4021081_+	hypothetical protein	NA	NA	NA	NA	NA
4021324:4021346	attL	AAATAAAGAATAAAAATAAAATA	NA	NA	NA	NA
AYK67776.1|4021875_4022994_+|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
AYK67777.1|4024582_4024789_+	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	100.0	1.4e-31
AYK67778.1|4024805_4025051_+	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	98.8	8.7e-41
AYK67779.1|4025047_4025239_+	hypothetical protein	NA	A0A1P8CWX2	Bacillus_phage	94.9	3.5e-13
AYK67780.1|4025249_4026311_+|integrase	integrase	integrase	A0A1P8CWW9	Bacillus_phage	99.7	1.9e-201
AYK67781.1|4026393_4027740_+	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	100.0	2.6e-251
AYK67782.1|4027758_4028730_+|integrase	integrase	integrase	A0A1P8CWX4	Bacillus_phage	100.0	2.2e-180
AYK67783.1|4028960_4029182_-	XRE family transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	100.0	1.1e-34
AYK67784.1|4029349_4029649_+	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	100.0	1.5e-47
AYK67785.1|4029721_4029961_+	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	100.0	3.3e-37
AYK67786.1|4030079_4030319_+	hypothetical protein	NA	A0A1P8CWW8	Bacillus_phage	98.7	9.7e-37
AYK67787.1|4030354_4030690_+	hypothetical protein	NA	A0A1P8CWX6	Bacillus_phage	92.8	1.8e-44
AYK67788.1|4030686_4031088_+	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	56.8	5.4e-40
AYK67789.1|4031478_4032276_+	hypothetical protein	NA	A0A0S2SXZ1	Bacillus_phage	54.6	8.2e-72
AYK68231.1|4032308_4032566_+	hypothetical protein	NA	O64116	Bacillus_phage	90.6	2.9e-39
AYK67790.1|4032614_4032809_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67791.1|4032840_4033131_+	hypothetical protein	NA	A0A127AWI5	Bacillus_phage	45.6	9.7e-15
AYK67792.1|4033319_4033535_+	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	80.3	7.7e-25
AYK67793.1|4033550_4033925_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	64.5	4.9e-35
AYK67794.1|4034048_4034450_+	hypothetical protein	NA	K4JWE2	Caulobacter_phage	38.3	6.9e-19
AYK67795.1|4034492_4034690_+	hypothetical protein	NA	A0A1P8CWY0	Bacillus_phage	60.0	1.6e-13
AYK67796.1|4034938_4035160_+	hypothetical protein	NA	A0A1P8CWZ6	Bacillus_phage	93.2	1.3e-32
AYK67797.1|4035933_4036251_+|transposase	transposase	transposase	NA	NA	NA	NA
AYK67798.1|4036247_4037162_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
AYK67799.1|4039828_4040350_+	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	85.5	3.5e-79
AYK67800.1|4040930_4041173_+	thioredoxin	NA	A0A1P8CX24	Bacillus_phage	100.0	1.4e-38
AYK67801.1|4041218_4041647_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1P8CX51	Bacillus_phage	93.0	8.9e-73
AYK67802.1|4041734_4041917_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67803.1|4042158_4043073_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
AYK67804.1|4043069_4043387_-|transposase	transposase	transposase	NA	NA	NA	NA
AYK67805.1|4043478_4043646_+	hypothetical protein	NA	A0A1P8CX64	Bacillus_phage	83.6	2.3e-21
AYK67806.1|4043650_4043941_+	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	93.5	6.1e-41
AYK67807.1|4043940_4044156_+	hypothetical protein	NA	A0A1P8CX47	Bacillus_phage	95.8	1.0e-32
AYK67808.1|4044269_4044614_+	hypothetical protein	NA	A0A1P8CX52	Bacillus_phage	88.6	2.9e-50
AYK67809.1|4044670_4045510_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	97.8	6.2e-163
AYK67810.1|4045782_4046133_+	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	94.9	1.6e-51
4045629:4045651	attR	AAATAAAGAATAAAAATAAAATA	NA	NA	NA	NA
AYK67811.1|4046305_4046596_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	94.1	6.5e-27
AYK67812.1|4046763_4047132_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67813.1|4047168_4047354_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67814.1|4047377_4047782_+	hypothetical protein	NA	NA	NA	NA	NA
AYK68232.1|4047861_4048194_+	hypothetical protein	NA	A0A1P8CX53	Bacillus_phage	62.4	2.5e-30
AYK67815.1|4048174_4048723_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67816.1|4048723_4048888_+	hypothetical protein	NA	O64190	Bacillus_phage	84.2	6.9e-18
AYK67817.1|4048884_4049136_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67818.1|4049192_4049405_+	hypothetical protein	NA	O64192	Bacillus_phage	98.6	2.0e-33
AYK67819.1|4049488_4049674_+	hypothetical protein	NA	O64193	Bacillus_phage	96.7	1.3e-25
AYK67820.1|4049675_4049918_-	XRE family transcriptional regulator	NA	O64194	Bacillus_phage	98.8	3.6e-39
AYK67821.1|4049992_4050580_+	hypothetical protein	NA	O64195	Bacillus_phage	93.8	2.5e-102
AYK67822.1|4050582_4050759_+	hypothetical protein	NA	O64196	Bacillus_phage	100.0	5.3e-24
AYK67823.1|4050793_4051219_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI8	Catovirus	36.8	4.9e-15
AYK67824.1|4051588_4052737_+	phytase	NA	NA	NA	NA	NA
AYK67825.1|4052807_4053761_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67826.1|4054635_4055415_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK67827.1|4055374_4055608_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
AYK67828.1|4055754_4057107_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK67829.1|4057320_4058655_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AYK67830.1|4058661_4059351_+	CoA transferase subunit A	NA	NA	NA	NA	NA
AYK67831.1|4059983_4061294_+	peptidase	NA	NA	NA	NA	NA
AYK67832.1|4061271_4062099_+	putative beta-lysine N-acetyltransferase	NA	NA	NA	NA	NA
AYK67833.1|4062127_4063192_+	lysine 2,3-aminomutase	NA	NA	NA	NA	NA
AYK68233.1|4065789_4067337_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AYK67834.1|4067333_4068092_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
AYK67835.1|4068739_4069057_+|transposase	transposase	transposase	NA	NA	NA	NA
AYK67836.1|4069053_4069968_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
AYK67837.1|4070345_4070807_+	DUF2691 family protein	NA	NA	NA	NA	NA
AYK67838.1|4070836_4071271_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1P8CX51	Bacillus_phage	92.3	5.8e-72
AYK67839.1|4071363_4071981_-	VanZ family protein	NA	NA	NA	NA	NA
AYK67840.1|4072326_4073166_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	97.8	2.8e-163
AYK67841.1|4073253_4073541_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67842.1|4074468_4074825_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67843.1|4075070_4075250_-|coat	spore coat protein C	coat	NA	NA	NA	NA
>prophage 20
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	4142700	4195738	4293706	transposase,integrase	Bacillus_phage(30.0%)	48	4140187:4140204	4166359:4166376
4140187:4140204	attL	TTCCTCCATTTTATATTT	NA	NA	NA	NA
AYK67901.1|4142700_4143246_-|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	50.8	3.9e-41
AYK67902.1|4143562_4143793_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYK67903.1|4143977_4145738_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AYK67904.1|4145855_4147005_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AYK67905.1|4147088_4148570_-	glutamate synthase small subunit	NA	NA	NA	NA	NA
AYK67906.1|4148586_4153149_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
AYK67907.1|4153294_4154197_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYK67908.1|4154247_4155363_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.7	5.3e-69
AYK67909.1|4155359_4156226_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	32.7	1.0e-30
AYK67910.1|4156388_4156757_-	Replication termination protein	NA	A0A0K2CP62	Brevibacillus_phage	41.0	1.6e-17
AYK67911.1|4157055_4157772_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	77.2	3.7e-47
AYK67912.1|4157921_4158227_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
AYK67913.1|4158286_4159057_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67914.1|4159100_4159634_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYK67915.1|4159773_4160766_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK67916.1|4160759_4161506_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK67917.1|4161515_4162454_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.7	6.1e-26
AYK67918.1|4162469_4163021_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK67919.1|4163417_4164662_-	MFS transporter	NA	NA	NA	NA	NA
AYK68237.1|4165676_4166111_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AYK67920.1|4166472_4167966_-	cardiolipin synthase	NA	NA	NA	NA	NA
4166359:4166376	attR	TTCCTCCATTTTATATTT	NA	NA	NA	NA
AYK67921.1|4168318_4168729_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AYK67922.1|4168941_4169802_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AYK67923.1|4169831_4170038_-	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
AYK67924.1|4170049_4170400_-	stage V sporulation protein AE	NA	NA	NA	NA	NA
AYK67925.1|4170396_4171416_-	stage V sporulation protein AD	NA	NA	NA	NA	NA
AYK67926.1|4171415_4171895_-	stage V sporulation protein AC	NA	NA	NA	NA	NA
AYK67927.1|4172468_4172675_-	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
AYK67928.1|4172979_4173870_-	manganese catalase family protein	NA	NA	NA	NA	NA
AYK67929.1|4173938_4174145_-	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
AYK67930.1|4174552_4175005_-	spore gernimation protein GerC	NA	NA	NA	NA	NA
AYK67931.1|4175019_4176096_-	spore germination protein	NA	NA	NA	NA	NA
AYK67932.1|4175986_4176289_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A142F1B8	Bacillus_phage	50.7	7.8e-15
AYK67933.1|4176623_4177100_+	hypothetical protein	NA	NA	NA	NA	NA
AYK67934.1|4177760_4177955_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67935.1|4178281_4179733_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
AYK67936.1|4179769_4180468_-	Expansin-YoaJ	NA	NA	NA	NA	NA
AYK67937.1|4180730_4181408_-	DUF1275 family protein	NA	NA	NA	NA	NA
AYK67938.1|4182068_4183187_+|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
AYK67939.1|4185271_4185577_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67940.1|4187402_4187558_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67941.1|4188088_4188586_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67942.1|4188686_4189598_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67943.1|4189902_4190385_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
AYK67944.1|4190394_4190619_+	transcriptional regulator	NA	NA	NA	NA	NA
AYK67945.1|4192043_4192361_+|transposase	transposase	transposase	NA	NA	NA	NA
AYK67946.1|4192357_4193272_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
AYK67947.1|4194823_4195738_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
>prophage 21
CP032855	Bacillus subtilis subsp. subtilis strain PJ-7 chromosome, complete genome	4293706	4243371	4280583	4293706	portal,integrase,protease,terminase,tail,holin,head,capsid	Bacillus_phage(27.27%)	49	4234149:4234163	4280746:4280760
4234149:4234163	attL	GTGAAACAGCACGAT	NA	NA	NA	NA
AYK67992.1|4243371_4244484_-	aspartate phosphatase	NA	D6R410	Bacillus_phage	98.6	3.6e-206
AYK67993.1|4244921_4245575_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67994.1|4245724_4245970_-	peptidoglycan-binding protein	NA	F8WPX5	Bacillus_phage	59.2	7.4e-16
AYK67995.1|4245915_4246875_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	50.9	3.2e-70
AYK67996.1|4246930_4247197_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	68.7	1.2e-22
AYK67997.1|4247208_4247424_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	53.6	2.0e-12
AYK67998.1|4247458_4247704_-	hypothetical protein	NA	NA	NA	NA	NA
AYK67999.1|4247710_4248046_-	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
AYK68000.1|4248046_4249333_-	DUF2479 domain-containing protein	NA	A0A1J0MFQ3	Staphylococcus_phage	38.4	3.2e-81
AYK68240.1|4249349_4250081_-	SGNH/GDSL hydrolase family protein	NA	Q4ZE16	Staphylococcus_virus	49.8	2.4e-57
AYK68001.1|4250379_4251561_-	hydrolase	NA	G3MB53	Bacillus_virus	50.6	3.9e-94
AYK68002.1|4251553_4252708_-	hypothetical protein	NA	A0A2H4JB19	uncultured_Caudovirales_phage	27.1	1.6e-07
AYK68003.1|4252716_4253556_-|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	30.4	3.3e-31
AYK68004.1|4253552_4259315_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	33.1	5.5e-16
AYK68005.1|4259497_4259818_-	hypothetical protein	NA	A0A0M4R2F4	Enterococcus_phage	36.0	1.2e-08
AYK68006.1|4259894_4260470_-|tail	phage tail protein	tail	A0A1I9KKC4	Lactobacillus_phage	36.4	6.0e-24
AYK68007.1|4260527_4260917_-	hypothetical protein	NA	NA	NA	NA	NA
AYK68008.1|4260913_4261342_-	HK97 gp10 family phage protein	NA	A0A0M5M1E5	Enterococcus_phage	44.3	2.6e-08
AYK68009.1|4261338_4261668_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AYK68010.1|4261674_4261989_-	hypothetical protein	NA	A0A2H4J8T8	uncultured_Caudovirales_phage	37.5	1.7e-09
AYK68011.1|4262002_4263208_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	47.8	1.0e-97
AYK68012.1|4263204_4263927_-|protease	Clp protease ClpP	protease	A0A0C5AJ10	Paenibacillus_phage	65.2	1.5e-67
AYK68013.1|4263901_4265122_-|portal	phage portal protein	portal	A0A2I7SCY4	Paenibacillus_phage	37.2	7.2e-67
AYK68014.1|4265134_4266925_-|terminase	terminase large subunit	terminase	F8J1B1	Lactobacillus_phage	60.7	2.9e-210
AYK68015.1|4266914_4267370_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	39.4	3.9e-26
AYK68016.1|4267599_4267914_-	HNH endonuclease	NA	A0A0C5AEM7	Paenibacillus_phage	46.6	1.5e-16
AYK68017.1|4267945_4268146_-	hypothetical protein	NA	NA	NA	NA	NA
AYK68018.1|4268321_4268798_-	hypothetical protein	NA	NA	NA	NA	NA
AYK68019.1|4268909_4269362_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
AYK68020.1|4269462_4269648_+	type II toxin-antitoxin system HicA family toxin	NA	D6R431	Bacillus_phage	69.5	1.2e-18
AYK68021.1|4269674_4270091_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CYJ8	Paenibacillus_phage	56.5	3.1e-38
AYK68022.1|4270106_4270622_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	43.8	4.7e-28
AYK68023.1|4270841_4271042_-	hypothetical protein	NA	NA	NA	NA	NA
AYK68024.1|4271126_4271879_+	hypothetical protein	NA	NA	NA	NA	NA
AYK68025.1|4271902_4272127_-	hypothetical protein	NA	A0A0U4B0C8	Bacillus_phage	45.3	2.8e-09
AYK68026.1|4272116_4273445_-	replicative DNA helicase	NA	W8EEZ1	Geobacillus_phage	56.7	1.1e-137
AYK68027.1|4273446_4273803_-	hypothetical protein	NA	NA	NA	NA	NA
AYK68028.1|4273795_4274587_-	Replication protein O	NA	A0A0S2GLI6	Bacillus_phage	48.2	2.5e-28
AYK68241.1|4274598_4274967_-	hypothetical protein	NA	NA	NA	NA	NA
AYK68029.1|4275126_4275972_-	hypothetical protein	NA	NA	NA	NA	NA
AYK68030.1|4275984_4276638_-	DNA-binding protein	NA	A0A288WFT2	Bacillus_phage	40.4	1.7e-38
AYK68031.1|4276695_4276947_+	hypothetical protein	NA	NA	NA	NA	NA
AYK68032.1|4277082_4277385_-	hypothetical protein	NA	NA	NA	NA	NA
AYK68033.1|4277371_4277653_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	39.5	3.0e-13
AYK68034.1|4277848_4278121_-	hypothetical protein	NA	NA	NA	NA	NA
AYK68035.1|4278107_4278314_-	XRE family transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	66.7	2.2e-13
AYK68036.1|4278582_4278888_+	XRE family transcriptional regulator	NA	A0A141E189	Streptococcus_phage	54.3	1.2e-15
AYK68037.1|4278902_4279367_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	51.6	5.3e-39
AYK68038.1|4279434_4280583_+|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	30.3	3.7e-33
4280746:4280760	attR	ATCGTGCTGTTTCAC	NA	NA	NA	NA
