The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032861	Bacillus subtilis subsp. subtilis strain N1-1 chromosome, complete genome	4108100	309922	316017	4108100		Staphylococcus_phage(66.67%)	8	NA	NA
AYK85299.1|309922_311008_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	6.6e-56
AYK85300.1|311018_311666_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
AYK85301.1|311680_312877_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
AYK85302.1|312909_313374_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
AYK85303.1|313486_313861_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK85304.1|313874_314399_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AYK88862.1|314678_315434_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
AYK85305.1|315423_316017_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.6e-14
>prophage 2
CP032861	Bacillus subtilis subsp. subtilis strain N1-1 chromosome, complete genome	4108100	528452	539142	4108100	transposase,holin	Bacillus_phage(75.0%)	10	NA	NA
AYK85532.1|528452_529889_-	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	30.6	2.6e-07
AYK85533.1|530016_530574_+	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	95.7	7.0e-102
AYK85534.1|530672_532475_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	87.0	1.3e-218
AYK85535.1|532484_532943_+	antitoxin YobK	NA	NA	NA	NA	NA
AYK85536.1|533035_533494_+	SMI1/KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	85.5	2.8e-72
AYK85537.1|533549_534104_+	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	91.3	4.3e-96
AYK85538.1|534163_534697_+	N-acetyltransferase	NA	O64026	Bacillus_phage	97.2	2.9e-97
AYK85539.1|534985_535069_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AYK85540.1|535328_535688_+	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	98.3	2.2e-61
AYK85541.1|537894_539142_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
>prophage 3
CP032861	Bacillus subtilis subsp. subtilis strain N1-1 chromosome, complete genome	4108100	632197	708243	4108100	head,portal,plate,tail,holin,terminase,integrase,protease,coat,capsid,transposase	Bacillus_phage(54.35%)	86	665786:665801	709632:709647
AYK85618.1|632197_633550_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK85619.1|633711_634110_-	hypothetical protein	NA	NA	NA	NA	NA
AYK85620.1|634363_634552_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
AYK85621.1|634726_634927_+|coat	spore coat protein CotC	coat	NA	NA	NA	NA
AYK85622.1|635172_635529_+	hypothetical protein	NA	NA	NA	NA	NA
AYK85623.1|635688_636408_+	hypothetical protein	NA	NA	NA	NA	NA
AYK85624.1|636450_636738_+	hypothetical protein	NA	NA	NA	NA	NA
AYK85625.1|636860_637700_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	98.2	5.6e-164
AYK85626.1|637974_638139_-	hypothetical protein	NA	NA	NA	NA	NA
AYK85627.1|638269_638494_-	hypothetical protein	NA	NA	NA	NA	NA
AYK85628.1|638545_638809_+	hypothetical protein	NA	NA	NA	NA	NA
AYK85629.1|639409_639844_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1P8CX51	Bacillus_phage	92.3	5.8e-72
AYK85630.1|640762_641188_+	endonuclease	NA	NA	NA	NA	NA
AYK85631.1|641598_642783_+	alanine racemase 2	NA	NA	NA	NA	NA
AYK85632.1|642884_644300_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
AYK85633.1|644712_645348_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	68.5	2.2e-72
AYK85634.1|645477_646725_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK85635.1|647208_648123_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	4.0e-06
AYK85636.1|648119_648437_-|transposase	transposase	transposase	NA	NA	NA	NA
AYK85637.1|648618_650118_-	xylulokinase	NA	NA	NA	NA	NA
AYK85638.1|650268_651606_-	xylose isomerase	NA	NA	NA	NA	NA
AYK85639.1|651843_652998_+	ROK family protein	NA	NA	NA	NA	NA
AYK85640.1|653135_654737_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
AYK85641.1|654875_655790_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
AYK85642.1|655786_656104_-|transposase	transposase	transposase	NA	NA	NA	NA
AYK85643.1|656176_657568_-	MFS transporter	NA	NA	NA	NA	NA
AYK85644.1|658364_658835_-	hypothetical protein	NA	NA	NA	NA	NA
AYK85645.1|658974_659139_-	hypothetical protein	NA	NA	NA	NA	NA
AYK85646.1|660650_660881_-	XRE family transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	75.0	2.1e-20
AYK85647.1|661422_661803_-	hypothetical protein	NA	NA	NA	NA	NA
AYK85648.1|661880_662780_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYK85649.1|662776_663931_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.4e-24
AYK88876.1|664092_665640_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AYK85650.1|665636_666395_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
665786:665801	attL	AAGAAAACGTGAAGTA	NA	NA	NA	NA
AYK88877.1|667437_667872_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AYK85651.1|668055_668307_-	hypothetical protein	NA	NA	NA	NA	NA
AYK85652.1|668605_669457_-	toxin	NA	O64021	Bacillus_phage	60.3	1.4e-85
AYK85653.1|669637_670129_-	hypothetical protein	NA	NA	NA	NA	NA
AYK85654.1|670367_670658_-	hypothetical protein	NA	NA	NA	NA	NA
AYK85655.1|671254_671455_+	hypothetical protein	NA	NA	NA	NA	NA
AYK85656.1|671491_672577_+	DUF4917 family protein	NA	NA	NA	NA	NA
AYK88878.1|672592_672664_-	hypothetical protein	NA	NA	NA	NA	NA
AYK85657.1|672833_674597_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	52.3	3.3e-121
AYK85658.1|674615_675080_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AYK85659.1|675125_676103_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	71.4	2.0e-64
AYK85660.1|676158_676422_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.7	2.7e-24
AYK85661.1|676436_676649_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.9e-15
AYK85662.1|676700_676871_-	XkdX family protein	NA	NA	NA	NA	NA
AYK85663.1|676867_677167_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	2.0e-39
AYK85664.1|677182_678304_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	92.5	9.8e-196
AYK85665.1|679928_681803_-	autolysin	NA	D6R400	Bacillus_phage	27.8	5.5e-50
AYK85666.1|681816_682650_-|tail	phage tail family protein	tail	M4ZS20	Bacillus_phage	34.1	3.5e-33
AYK85667.1|682662_686403_-	hypothetical protein	NA	A0A0S2SXL7	Bacillus_phage	60.4	9.1e-105
AYK85668.1|686465_686648_-	hypothetical protein	NA	NA	NA	NA	NA
AYK85669.1|686659_687022_-	hypothetical protein	NA	NA	NA	NA	NA
AYK85670.1|687081_687666_-|tail	major tail protein	tail	U5U3Z7	Lactobacillus_phage	36.5	9.1e-28
AYK85671.1|687671_688079_-	hypothetical protein	NA	NA	NA	NA	NA
AYK85672.1|688075_688468_-|tail	phage tail protein	tail	A0A0M5M1E5	Enterococcus_phage	37.9	3.0e-11
AYK85673.1|688467_688794_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AYK85674.1|688783_689077_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	33.0	2.6e-07
AYK85675.1|689131_689515_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	56.8	1.4e-05
AYK85676.1|689542_690751_-|capsid	phage major capsid protein	capsid	A0A2H4J824	uncultured_Caudovirales_phage	49.8	4.9e-76
AYK85677.1|690798_691395_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	53.8	3.3e-49
AYK85678.1|691387_692614_-|portal	phage portal protein	portal	A0A1J0MFU3	Staphylococcus_phage	39.4	2.4e-70
AYK85679.1|692618_692825_-	hypothetical protein	NA	NA	NA	NA	NA
AYK85680.1|692841_694575_-|terminase	terminase large subunit	terminase	A0A2H4JCI4	uncultured_Caudovirales_phage	48.9	2.1e-144
AYK85681.1|694564_695050_-|terminase	phage terminase small subunit P27 family	terminase	A0A1Q1PVW3	Staphylococcus_phage	36.0	4.2e-18
AYK85682.1|695288_695495_-	hypothetical protein	NA	NA	NA	NA	NA
AYK88879.1|695497_695881_-	HNH endonuclease	NA	A0A075M5R4	Enterococcus_phage	43.3	1.2e-17
AYK88880.1|696252_696666_-	ArpU family transcriptional regulator	NA	D6R428	Bacillus_phage	97.0	2.1e-63
AYK85683.1|696919_697435_-	hypothetical protein	NA	D6R425	Bacillus_phage	93.0	8.7e-91
AYK85684.1|697469_698009_-	nuclease	NA	Q9ZXC2	Bacillus_phage	96.1	1.8e-94
AYK85685.1|698005_698443_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	91.7	4.8e-74
AYK85686.1|698642_701060_-	DNA primase	NA	D6R422	Bacillus_phage	88.7	0.0e+00
AYK85687.1|701120_701558_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	97.2	1.3e-79
AYK85688.1|701578_701893_-	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	99.0	1.5e-53
AYK85689.1|701882_702818_-	hypothetical protein	NA	Q9ZXC7	Bacillus_phage	96.5	2.0e-170
AYK85690.1|702821_703376_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	96.2	3.1e-94
AYK85691.1|703571_703847_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	47.1	1.2e-19
AYK88881.1|703843_704035_-	hypothetical protein	NA	Q9ZXD0	Bacillus_phage	53.1	7.1e-06
AYK85692.1|704095_704407_-	DNA-binding protein	NA	NA	NA	NA	NA
AYK85693.1|704422_705187_-	Rha family transcriptional regulator	NA	A8ATN0	Listeria_phage	49.1	1.0e-47
AYK85694.1|705301_705520_-	XRE family transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	63.2	2.1e-17
AYK85695.1|705644_706031_+	XRE family transcriptional regulator	NA	R9W020	Paenibacillus_phage	31.4	9.0e-08
AYK85696.1|706014_707070_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0F6N3H6	Staphylococcus_phage	24.2	1.7e-08
AYK85697.1|707085_708243_+|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	38.9	8.3e-65
709632:709647	attR	TACTTCACGTTTTCTT	NA	NA	NA	NA
>prophage 4
CP032861	Bacillus subtilis subsp. subtilis strain N1-1 chromosome, complete genome	4108100	712943	719515	4108100		Bacillus_phage(50.0%)	6	NA	NA
AYK85702.1|712943_713912_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
AYK85703.1|714552_715320_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	1.2e-51
AYK85704.1|715383_716004_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
AYK85705.1|716053_717043_-	ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
AYK85706.1|717060_719163_-	ribonucleotide-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
AYK85707.1|719122_719515_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
>prophage 5
CP032861	Bacillus subtilis subsp. subtilis strain N1-1 chromosome, complete genome	4108100	1130869	1204495	4108100	terminase,portal,plate,holin,tail,protease,tRNA,transposase	uncultured_Caudovirales_phage(24.39%)	81	NA	NA
AYK86111.1|1130869_1131829_+|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	49.5	5.6e-75
AYK86112.1|1132244_1134533_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AYK86113.1|1134707_1135178_+|tRNA	tRNA-specific adenosine deaminase	tRNA	S4VYZ2	Pandoravirus	45.8	1.8e-26
AYK86114.1|1135425_1135836_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
AYK86115.1|1135977_1136421_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK86116.1|1136451_1136877_-	organic hydroperoxide resistance protein OhrA	NA	NA	NA	NA	NA
AYK86117.1|1137002_1138250_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.1	4.2e-99
AYK86118.1|1138261_1139359_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.1	4.3e-71
AYK86119.1|1139709_1140612_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AYK86120.1|1140682_1141000_-	multidrug efflux SMR transporter subunit YkkD	NA	NA	NA	NA	NA
AYK86121.1|1140999_1141338_-	multidrug resistance protein YkkC	NA	NA	NA	NA	NA
AYK86122.1|1141559_1142078_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYK86123.1|1142067_1142595_-	DinB family protein	NA	NA	NA	NA	NA
AYK86124.1|1142686_1143418_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AYK86125.1|1143566_1143791_+	hypothetical protein	NA	NA	NA	NA	NA
AYK86126.1|1143867_1145067_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AYK88893.1|1145304_1145823_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AYK86127.1|1146931_1147981_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AYK86128.1|1148023_1149013_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.5	3.2e-17
AYK86129.1|1149025_1149916_-	NlpC/P60 family protein	NA	A0A0A8WIF2	Clostridium_phage	45.8	5.3e-19
AYK86130.1|1149932_1151012_-	dipeptide epimerase	NA	NA	NA	NA	NA
AYK86131.1|1151008_1151968_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AYK88894.1|1152055_1153705_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYK86132.1|1153707_1154715_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	1.8e-15
AYK86133.1|1154719_1155682_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK86134.1|1155687_1156614_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK86135.1|1156630_1157455_-	aminopeptidase	NA	NA	NA	NA	NA
AYK86136.1|1157584_1158403_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AYK86137.1|1158571_1159921_+|protease	serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	34.1	3.4e-25
AYK86138.1|1160420_1161392_-	glycosyltransferase	NA	I1TED8	Salmonella_phage	41.3	2.5e-62
AYK88895.1|1161403_1163554_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AYK86139.1|1163770_1164721_-	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
AYK86140.1|1165109_1166426_+	amino acid permease	NA	NA	NA	NA	NA
AYK86141.1|1166701_1167319_+	DUF47 domain-containing protein	NA	NA	NA	NA	NA
AYK86142.1|1167331_1168333_+	low-affinity inorganic phosphate transporter	NA	NA	NA	NA	NA
AYK86143.1|1168442_1169189_+	type II toxin-antitoxin system SpoIISA family toxin	NA	NA	NA	NA	NA
AYK86144.1|1169188_1169359_+	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
AYK86145.1|1169444_1169582_+	hypothetical protein	NA	NA	NA	NA	NA
AYK86146.1|1170524_1170788_-|holin	holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	6.1e-24
AYK86147.1|1170800_1171070_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	1.4e-23
AYK86148.1|1171122_1171962_-|portal	phage portal protein	portal	NA	NA	NA	NA
AYK86149.1|1172008_1172173_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	1.9e-15
AYK86150.1|1172169_1172499_-|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	40.7	1.3e-15
AYK86151.1|1172510_1174574_-|terminase	terminase	terminase	A0A2H4J4R1	uncultured_Caudovirales_phage	34.5	2.6e-29
AYK86152.1|1174576_1174849_-	hypothetical protein	NA	NA	NA	NA	NA
AYK86153.1|1174845_1175424_-	phage-like element PBSX protein XkdU	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	3.9e-15
AYK86154.1|1175407_1176454_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	1.3e-72
AYK86155.1|1176446_1176872_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	3.0e-12
AYK86156.1|1176929_1177196_-	phage-like element PBSX protein XkdR	NA	S6C459	Thermus_phage	36.4	1.7e-05
AYK86157.1|1177195_1178173_-	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
AYK86158.1|1178188_1178848_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	33.2	1.1e-24
AYK86159.1|1183843_1183984_-	hypothetical protein	NA	NA	NA	NA	NA
AYK86160.1|1184025_1184472_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	36.8	1.0e-10
AYK86161.1|1184563_1185007_-	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	44.5	1.9e-25
AYK86162.1|1185008_1186409_-|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	39.3	3.0e-77
AYK86163.1|1186405_1186624_-	hypothetical protein	NA	NA	NA	NA	NA
AYK86164.1|1186627_1187068_-|portal	phage portal protein	portal	NA	NA	NA	NA
AYK86165.1|1187080_1187566_-	phage-like element PBSX protein XkdI	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
AYK86166.1|1187562_1187919_-	phage-like element PBSX protein XkdH	NA	NA	NA	NA	NA
AYK86167.1|1187915_1188299_-	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
AYK86168.1|1188320_1189256_-	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
AYK86169.1|1189281_1190109_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	59.2	1.6e-54
AYK86170.1|1190128_1191616_-	phage-like element PBSX protein XkdE	NA	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
AYK86171.1|1191619_1192921_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.0	9.1e-153
AYK86172.1|1192917_1193715_-|terminase	PBSX phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
AYK86173.1|1193830_1194340_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	39.2	6.5e-22
AYK86174.1|1194455_1194662_-	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	2.1e-11
AYK86175.1|1194658_1195009_-|portal	phage portal protein	portal	NA	NA	NA	NA
AYK86176.1|1195093_1195261_-	hypothetical protein	NA	NA	NA	NA	NA
AYK86177.1|1195260_1196061_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	1.1e-60
AYK86178.1|1195960_1196797_-|portal	phage portal protein	portal	S6BFM4	Thermus_phage	27.8	6.7e-24
AYK86179.1|1196783_1196963_-	hypothetical protein	NA	NA	NA	NA	NA
AYK86180.1|1197141_1197483_+	transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
AYK86181.1|1197645_1198242_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
AYK86182.1|1198285_1199122_-	manganese catalase family protein	NA	NA	NA	NA	NA
AYK86183.1|1199198_1199801_-	hypothetical protein	NA	F8WQ53	Bacillus_phage	48.7	1.4e-44
AYK86184.1|1199905_1200283_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	7.9e-17
AYK86185.1|1200322_1201276_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	73.8	1.6e-66
AYK86186.1|1201673_1201808_-	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
AYK86187.1|1201797_1202934_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
AYK86188.1|1203345_1204495_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
>prophage 6
CP032861	Bacillus subtilis subsp. subtilis strain N1-1 chromosome, complete genome	4108100	1239204	1288745	4108100	tRNA,coat,transposase	Bacillus_phage(55.56%)	54	NA	NA
AYK86218.1|1239204_1239438_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYK86219.1|1239570_1240551_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AYK86220.1|1240569_1240791_-	hypothetical protein	NA	NA	NA	NA	NA
AYK86221.1|1241099_1241429_+	DUF4306 domain-containing protein	NA	NA	NA	NA	NA
AYK86222.1|1241560_1241755_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
AYK86223.1|1241794_1242274_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AYK86224.1|1242502_1242898_+	hypothetical protein	NA	NA	NA	NA	NA
AYK86225.1|1243116_1243623_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYK86226.1|1243753_1244965_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.8	2.2e-23
AYK86227.1|1245037_1245529_-	DUF2992 family protein	NA	NA	NA	NA	NA
AYK86228.1|1245698_1246646_-	mannose-6-phosphate isomerase ManA	NA	NA	NA	NA	NA
AYK86229.1|1248759_1250706_-	PRD domain-containing protein	NA	NA	NA	NA	NA
AYK86230.1|1251013_1251331_-	hypothetical protein	NA	NA	NA	NA	NA
AYK86231.1|1251445_1251763_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AYK86232.1|1252195_1252387_+	hypothetical protein	NA	NA	NA	NA	NA
AYK86233.1|1252889_1253090_+	hypothetical protein	NA	NA	NA	NA	NA
AYK86234.1|1253218_1253734_+	hypothetical protein	NA	NA	NA	NA	NA
AYK86235.1|1254408_1255002_-	hypothetical protein	NA	NA	NA	NA	NA
AYK86236.1|1255857_1256250_-	hypothetical protein	NA	NA	NA	NA	NA
AYK86237.1|1256264_1256576_-	hypothetical protein	NA	NA	NA	NA	NA
AYK86238.1|1256713_1256953_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK86239.1|1257327_1257615_+	hypothetical protein	NA	NA	NA	NA	NA
AYK86240.1|1257772_1258078_+	hypothetical protein	NA	NA	NA	NA	NA
AYK86241.1|1258121_1259369_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYK86242.1|1259501_1259960_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AYK86243.1|1259962_1261738_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	57.3	5.8e-126
AYK86244.1|1262085_1263201_+	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	71.9	2.4e-146
AYK86245.1|1263558_1263786_+	hypothetical protein	NA	NA	NA	NA	NA
AYK86246.1|1263874_1264141_-	YgiT-type zinc finger protein	NA	NA	NA	NA	NA
AYK86247.1|1264181_1264769_-	hypothetical protein	NA	NA	NA	NA	NA
AYK86248.1|1267135_1267351_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK86249.1|1267416_1268934_+	glycosyltransferase	NA	NA	NA	NA	NA
AYK86250.1|1270630_1271800_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	41.8	2.0e-87
AYK88897.1|1272739_1273015_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK86251.1|1273180_1273552_+	helix-turn-helix domain-containing protein	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	46.8	5.1e-16
AYK86252.1|1273914_1274436_+	hypothetical protein	NA	NA	NA	NA	NA
AYK86253.1|1274448_1274796_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	67.6	8.6e-18
AYK86254.1|1276659_1276839_-	hypothetical protein	NA	NA	NA	NA	NA
AYK86255.1|1276833_1278024_+	DUF819 domain-containing protein	NA	NA	NA	NA	NA
AYK86256.1|1278093_1278639_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYK86257.1|1278671_1279844_-	cystathionine beta-lyase MetC	NA	NA	NA	NA	NA
AYK88898.1|1279836_1280958_-	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	26.3	3.7e-17
AYK86258.1|1281313_1282036_+	esterase family protein	NA	NA	NA	NA	NA
AYK86259.1|1282072_1282588_+	hypothetical protein	NA	NA	NA	NA	NA
AYK86260.1|1282591_1283014_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK86261.1|1283086_1283341_-	hypothetical protein	NA	NA	NA	NA	NA
AYK86262.1|1283457_1285737_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	34.9	3.5e-91
AYK86263.1|1285810_1286065_-	sporulation-specific transcription factor SpoVIF	NA	NA	NA	NA	NA
AYK86264.1|1286197_1286347_-	sporulation protein YjcZ	NA	NA	NA	NA	NA
AYK86265.1|1286428_1286635_-	hypothetical protein	NA	NA	NA	NA	NA
AYK86266.1|1286915_1287272_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
AYK86267.1|1287431_1287818_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYK86268.1|1287857_1288178_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYK86269.1|1288262_1288745_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 7
CP032861	Bacillus subtilis subsp. subtilis strain N1-1 chromosome, complete genome	4108100	1831352	1839718	4108100		Synechococcus_phage(50.0%)	8	NA	NA
AYK86760.1|1831352_1831940_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
AYK86761.1|1831936_1832977_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	1.7e-64
AYK86762.1|1833078_1834509_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
AYK86763.1|1834484_1836713_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	3.8e-159
AYK86764.1|1836696_1837380_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AYK86765.1|1837376_1837631_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AYK86766.1|1837623_1838349_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	1.2e-45
AYK86767.1|1838422_1839718_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
>prophage 8
CP032861	Bacillus subtilis subsp. subtilis strain N1-1 chromosome, complete genome	4108100	2562263	2669666	4108100	holin,protease,bacteriocin,transposase	Bacillus_phage(28.0%)	103	NA	NA
AYK87404.1|2562263_2563388_+|transposase	IS4 family transposase IS4Bsu1	transposase	NA	NA	NA	NA
AYK87405.1|2563658_2564111_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK87406.1|2565350_2566190_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AYK87407.1|2566335_2566725_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AYK87408.1|2566792_2567581_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87409.1|2567618_2568353_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AYK87410.1|2568513_2569824_-	MFS transporter	NA	NA	NA	NA	NA
AYK87411.1|2569924_2570245_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87412.1|2570256_2570703_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87413.1|2570735_2571665_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
AYK87414.1|2571870_2572248_+	HxlR family transcriptional regulator	NA	NA	NA	NA	NA
AYK87415.1|2572907_2573057_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87416.1|2573281_2574211_+	DUF2232 domain-containing protein	NA	NA	NA	NA	NA
AYK87417.1|2574247_2576227_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
AYK87418.1|2576223_2576673_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AYK87419.1|2576709_2578767_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AYK87420.1|2578872_2580081_-	MFS transporter	NA	NA	NA	NA	NA
AYK87421.1|2580153_2580294_-	YycC family protein	NA	NA	NA	NA	NA
AYK87422.1|2580414_2580618_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87423.1|2580665_2580866_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
AYK87424.1|2581035_2582400_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	54.8	3.6e-128
AYK87425.1|2582519_2582939_+	VOC family protein	NA	NA	NA	NA	NA
AYK88941.1|2585466_2586174_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	41.2	3.4e-45
AYK87426.1|2586181_2588017_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.5	4.4e-36
AYK88942.1|2588006_2589374_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87427.1|2589360_2590203_+	two-component system YycFG regulatory protein	NA	NA	NA	NA	NA
AYK87428.1|2590224_2591019_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.6	9.8e-41
AYK87429.1|2591100_2592303_+|protease	serine protease	protease	W5SAB9	Pithovirus	40.4	5.9e-13
AYK87430.1|2592617_2594003_-	arginine utilization regulatory protein RocR	NA	NA	NA	NA	NA
AYK88943.1|2594229_2594514_+	ArsR family transcriptional regulator	NA	A0A218MNF3	uncultured_virus	41.3	2.8e-06
AYK88944.1|2594513_2595149_+	SdpI family protein	NA	NA	NA	NA	NA
AYK87431.1|2595332_2595887_+	SdpA family antimicrobial peptide system protein	NA	NA	NA	NA	NA
AYK87432.1|2595871_2596825_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87433.1|2596886_2597489_+	sporulation delaying protein family toxin	NA	NA	NA	NA	NA
AYK87434.1|2597820_2599026_+	ornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.5	2.0e-29
AYK87435.1|2599248_2600652_+	amino-acid permease RocE	NA	NA	NA	NA	NA
AYK87436.1|2600724_2601615_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	29.1	2.0e-26
AYK87437.1|2601851_2601968_-	phosphatase RapG inhibitor	NA	NA	NA	NA	NA
AYK87438.1|2601968_2603066_-	transcriptional regulator	NA	D6R410	Bacillus_phage	39.3	6.0e-73
AYK87439.1|2603176_2603647_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK87440.1|2603788_2604526_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87441.1|2604536_2605694_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87442.1|2605709_2605958_+	DUF2651 domain-containing protein	NA	NA	NA	NA	NA
AYK87443.1|2606062_2606233_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87444.1|2606295_2607522_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	29.3	1.1e-11
AYK87445.1|2607555_2607969_-	hypothetical protein	NA	NA	NA	NA	NA
AYK87446.1|2608153_2608324_+	CxxH/CxxC protein	NA	NA	NA	NA	NA
AYK87447.1|2608404_2608884_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AYK87448.1|2609171_2610080_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87449.1|2610036_2612871_+	DEAD/DEAH box helicase	NA	A7WKM3	Acidianus_filamentous_virus	26.4	6.0e-08
AYK87450.1|2612957_2613158_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87451.1|2613422_2613740_+|transposase	transposase	transposase	NA	NA	NA	NA
AYK87452.1|2613736_2614651_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	4.0e-06
AYK88945.1|2615034_2615298_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87453.1|2615996_2616275_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	100.0	7.3e-44
AYK87454.1|2616259_2616706_+	hypothetical protein	NA	A0A1P8CWQ3	Bacillus_phage	97.5	3.2e-57
AYK87455.1|2616786_2617701_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	4.0e-06
AYK87456.1|2617697_2618015_-|transposase	transposase	transposase	NA	NA	NA	NA
AYK87457.1|2619072_2621106_+	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
AYK87458.1|2621086_2622970_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	21.8	6.6e-19
AYK87459.1|2623204_2624668_-	hypothetical protein	NA	A0A0S2MYH0	Enterococcus_phage	36.0	1.0e-11
AYK87460.1|2625079_2625466_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88946.1|2625595_2627143_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AYK87461.1|2627139_2627898_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
AYK87462.1|2628137_2628317_-	hypothetical protein	NA	NA	NA	NA	NA
AYK87463.1|2628317_2628758_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	34.4	3.4e-11
AYK87464.1|2629238_2629589_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87465.1|2630039_2631965_-	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
AYK87466.1|2632445_2633075_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
AYK87467.1|2633095_2633818_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYK87468.1|2633908_2634619_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYK87469.1|2635185_2636625_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AYK87470.1|2636735_2638265_-	alkyl hydroperoxide reductase subunit F	NA	A0A1V0SIN1	Klosneuvirus	29.3	1.0e-33
AYK87471.1|2638278_2638842_-	peroxiredoxin	NA	NA	NA	NA	NA
AYK87472.1|2639307_2640714_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	E3SJC4	Synechococcus_phage	30.6	1.7e-32
AYK87473.1|2640736_2642083_-	gluconate permease	NA	NA	NA	NA	NA
AYK87474.1|2642111_2643653_-	gluconokinase	NA	NA	NA	NA	NA
AYK87475.1|2643645_2644377_-	gluconate operon transcriptional regulator	NA	NA	NA	NA	NA
AYK87476.1|2644572_2645721_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.3	1.4e-48
AYK87477.1|2645813_2646845_+	general stress protein 30	NA	NA	NA	NA	NA
AYK87478.1|2646884_2647577_-	LrgB family protein	NA	NA	NA	NA	NA
AYK87479.1|2647546_2647951_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
AYK87480.1|2648177_2648609_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK87481.1|2648667_2649738_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYK87482.1|2649868_2650444_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYK87483.1|2650537_2651572_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AYK87484.1|2651690_2651879_-	hypothetical protein	NA	NA	NA	NA	NA
AYK87485.1|2651980_2653450_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYK87486.1|2653450_2655634_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	30.8	1.7e-50
AYK87487.1|2655797_2656052_-	hypothetical protein	NA	NA	NA	NA	NA
AYK87488.1|2656329_2657454_-|transposase	IS4 family transposase IS4Bsu1	transposase	NA	NA	NA	NA
AYK87489.1|2657775_2657997_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87490.1|2658041_2658260_+|bacteriocin	bacteriocin leader domain-containing protein	bacteriocin	NA	NA	NA	NA
AYK87491.1|2658463_2658865_-	hypothetical protein	NA	NA	NA	NA	NA
AYK87492.1|2658882_2659083_-	transcriptional regulator	NA	NA	NA	NA	NA
AYK87493.1|2660274_2660526_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87494.1|2660693_2662574_+	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	33.4	1.1e-93
AYK87495.1|2664119_2664632_-	HPP family protein	NA	NA	NA	NA	NA
AYK87496.1|2665388_2665859_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87497.1|2665962_2666277_-	DUF2628 domain-containing protein	NA	L7TIP7	Escherichia_phage	47.0	1.6e-10
AYK87498.1|2666506_2667439_-	aldo/keto reductase	NA	NA	NA	NA	NA
AYK87499.1|2667492_2668248_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AYK87500.1|2668541_2669666_+|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
>prophage 9
CP032861	Bacillus subtilis subsp. subtilis strain N1-1 chromosome, complete genome	4108100	2816565	2931123	4108100	bacteriocin,holin,lysis,protease,tRNA,coat	Bacillus_phage(23.53%)	113	NA	NA
AYK87631.1|2816565_2817807_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AYK87632.1|2818057_2818573_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK87633.1|2818723_2819437_+	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
AYK87634.1|2819547_2820408_+	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	26.4	1.9e-05
AYK87635.1|2820460_2821303_-	levansucrase and sucrase synthesis operon antiterminator	NA	NA	NA	NA	NA
AYK87636.1|2821356_2822736_-	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
AYK87637.1|2825326_2826649_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
AYK87638.1|2826740_2827418_+	DUF2711 family protein	NA	NA	NA	NA	NA
AYK87639.1|2827456_2827837_-	VOC family protein	NA	NA	NA	NA	NA
AYK87640.1|2827957_2829145_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.0	1.2e-74
AYK87641.1|2829179_2829377_-	YwbE family protein	NA	NA	NA	NA	NA
AYK87642.1|2829410_2830613_-	MFS transporter	NA	NA	NA	NA	NA
AYK87643.1|2830717_2831395_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
AYK87644.1|2831376_2831763_-|holin	holin-like protein CidA	holin	NA	NA	NA	NA
AYK87645.1|2831868_2832774_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYK87646.1|2832781_2833600_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AYK87647.1|2833596_2834265_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AYK87648.1|2834421_2835864_+	iron transporter	NA	NA	NA	NA	NA
AYK87649.1|2835860_2837018_+	Efem/EfeO family lipoprotein	NA	NA	NA	NA	NA
AYK87650.1|2837036_2838287_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
AYK87651.1|2838569_2839172_+	DsbA family protein	NA	NA	NA	NA	NA
AYK87652.1|2839201_2840743_-	cation acetate symporter	NA	NA	NA	NA	NA
AYK87653.1|2840739_2841048_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
AYK87654.1|2841490_2841649_-	DNA-binding anti-repressor SinI	NA	NA	NA	NA	NA
AYK87655.1|2842003_2842675_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYK87656.1|2842692_2843076_+	GtrA family protein	NA	NA	NA	NA	NA
AYK87657.1|2843153_2844326_+	galactokinase	NA	NA	NA	NA	NA
AYK87658.1|2844329_2845871_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
AYK88950.1|2845941_2846187_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AYK88951.1|2846702_2847668_+	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
AYK87659.1|2847695_2849645_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AYK87660.1|2849658_2850273_+	Quinol oxidase subunit 3	NA	NA	NA	NA	NA
AYK87661.1|2850274_2850649_+	quinol oxidase subunit 4	NA	NA	NA	NA	NA
AYK87662.1|2850690_2850954_-	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
AYK87663.1|2851182_2852328_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK87664.1|2852536_2853718_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
AYK87665.1|2853823_2854573_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AYK87666.1|2855784_2858205_-	peptidase S8	NA	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
AYK88952.1|2858734_2859037_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87667.1|2859946_2860717_-	transporter	NA	NA	NA	NA	NA
AYK87668.1|2861018_2862404_+	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
AYK87669.1|2862400_2863840_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.8	3.7e-22
AYK87670.1|2863933_2864182_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87671.1|2864272_2865088_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AYK87672.1|2865279_2866086_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AYK87673.1|2866099_2866777_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	46.1	8.3e-49
AYK87674.1|2866801_2868172_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AYK87675.1|2868339_2868657_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87676.1|2868676_2869999_+	purine permease	NA	NA	NA	NA	NA
AYK87677.1|2870060_2870432_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
AYK87678.1|2870475_2871021_-|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
AYK87679.1|2871168_2871348_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87680.1|2871340_2872111_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	28.6	4.4e-06
AYK87681.1|2872115_2873540_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
AYK87682.1|2873560_2874730_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	28.1	1.2e-15
AYK87683.1|2874730_2875600_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK87684.1|2875599_2876721_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYK87685.1|2876713_2877436_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYK87686.1|2877438_2878458_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYK87687.1|2878482_2879223_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	41.9	4.5e-48
AYK87688.1|2879222_2880170_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
AYK87689.1|2880183_2881035_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	1.3e-38
AYK87690.1|2881027_2881483_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYK87691.1|2881806_2882271_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87692.1|2882448_2883723_+	catabolic NAD-specific glutamate dehydrogenase RocG	NA	NA	NA	NA	NA
AYK87693.1|2883949_2885497_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYK87694.1|2885570_2887271_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
AYK87695.1|2887270_2888683_+	amino acid permease	NA	NA	NA	NA	NA
AYK87696.1|2888892_2890131_+	MFS transporter	NA	NA	NA	NA	NA
AYK87697.1|2890282_2890897_+	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
AYK87698.1|2890886_2891594_+	bacilysin biosynthesis protein BacB	NA	NA	NA	NA	NA
AYK88953.1|2891596_2892358_+	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.8e-21
AYK87699.1|2892376_2893795_+	alanine-anticapsin ligase BacD	NA	NA	NA	NA	NA
AYK87700.1|2893791_2894976_+	MFS transporter	NA	NA	NA	NA	NA
AYK87701.1|2894976_2896191_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AYK87702.1|2896206_2896986_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYK87703.1|2897118_2897883_-	heme-binding protein	NA	NA	NA	NA	NA
AYK87704.1|2898152_2899124_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
AYK87705.1|2899269_2900169_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
AYK87706.1|2900217_2901063_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
AYK87707.1|2901231_2902122_+	DMT family transporter	NA	NA	NA	NA	NA
AYK87708.1|2902265_2903042_-	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
AYK87709.1|2903256_2903481_+	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
AYK87710.1|2903642_2904944_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
AYK87711.1|2904979_2905480_+	YwgA family protein	NA	NA	NA	NA	NA
AYK87712.1|2905591_2906062_+	transcriptional regulator	NA	NA	NA	NA	NA
AYK87713.1|2906061_2907462_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
AYK87714.1|2907541_2907697_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87715.1|2908306_2910223_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.4	1.9e-143
AYK87716.1|2910342_2910762_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK87717.1|2910804_2910993_-	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
AYK87718.1|2911101_2911761_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AYK87719.1|2911774_2912293_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87720.1|2912431_2912866_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87721.1|2912893_2914969_-	penicillin-binding protein	NA	NA	NA	NA	NA
AYK87722.1|2915170_2916001_+	spermidine synthase	NA	NA	NA	NA	NA
AYK87723.1|2916061_2916934_+	agmatinase	NA	NA	NA	NA	NA
AYK87724.1|2916868_2917426_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
AYK87725.1|2917523_2917643_-	phosphatase RapF inhibitor	NA	NA	NA	NA	NA
AYK87726.1|2917626_2918772_-	transcriptional regulator	NA	A0A1P8CWN8	Bacillus_phage	43.5	1.7e-78
AYK87727.1|2919001_2920357_+	YncE family protein	NA	NA	NA	NA	NA
AYK87728.1|2920395_2921772_+	YncE family protein	NA	NA	NA	NA	NA
AYK87729.1|2921777_2922479_-|bacteriocin	bacteriocin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
AYK87730.1|2922475_2923756_-	insulinase family protein	NA	NA	NA	NA	NA
AYK88954.1|2923760_2924921_-	insulinase family protein	NA	NA	NA	NA	NA
AYK87731.1|2924910_2926221_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
AYK87732.1|2926213_2926933_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	1.6e-18
AYK87733.1|2926929_2927091_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
AYK87734.1|2927103_2928450_-	subtilosin maturase AlbA	NA	NA	NA	NA	NA
AYK87735.1|2928474_2928627_-|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
AYK87736.1|2928583_2928715_-|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
AYK87737.1|2929027_2929456_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
AYK87738.1|2929452_2931123_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 10
CP032861	Bacillus subtilis subsp. subtilis strain N1-1 chromosome, complete genome	4108100	3051418	3117745	4108100	holin,protease,coat,transposase	Bacillus_phage(18.18%)	54	NA	NA
AYK87865.1|3051418_3052507_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYK87866.1|3052635_3053763_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
AYK87867.1|3053822_3054500_+	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
AYK87868.1|3054556_3055885_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	28.9	6.4e-45
AYK87869.1|3056095_3057004_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.6	6.8e-14
AYK87870.1|3057161_3058874_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
AYK87871.1|3058935_3059703_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
AYK87872.1|3059800_3060328_+	flavodoxin family protein	NA	NA	NA	NA	NA
AYK87873.1|3060367_3060664_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
AYK87874.1|3060819_3061356_-	cell wall-binding protein	NA	NA	NA	NA	NA
AYK87875.1|3061437_3062355_-	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
AYK87876.1|3062367_3063336_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
AYK87877.1|3063337_3064819_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.0	1.5e-13
AYK87878.1|3064834_3065230_-	D-ribose pyranase	NA	NA	NA	NA	NA
AYK87879.1|3065226_3066108_-	ribokinase	NA	NA	NA	NA	NA
AYK87880.1|3066100_3067090_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AYK87881.1|3067616_3067811_-	hypothetical protein	NA	NA	NA	NA	NA
AYK87882.1|3067871_3069053_+	poly-gamma-glutamate synthase PgsB	NA	NA	NA	NA	NA
AYK87883.1|3069067_3069517_+	poly-gamma-glutamate biosynthesis protein PgsC	NA	NA	NA	NA	NA
AYK87884.1|3069535_3070678_+	PGA biosynthesis protein CapA	NA	NA	NA	NA	NA
AYK87885.1|3070692_3070860_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88961.1|3071000_3072242_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	41.1	1.8e-17
AYK87886.1|3072275_3073136_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AYK87887.1|3073283_3074270_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AYK87888.1|3075954_3077079_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
AYK87889.1|3077075_3078182_-	spore gernimation protein	NA	NA	NA	NA	NA
AYK87890.1|3078187_3079639_-	spore germination protein	NA	NA	NA	NA	NA
AYK87891.1|3079908_3080859_+	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
AYK87892.1|3080988_3083631_+	beta-N-acetylglucosaminidase	NA	Q4ZC50	Staphylococcus_virus	44.9	1.8e-38
AYK87893.1|3083659_3084823_-	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
AYK87894.1|3084842_3085625_-	glycosyltransferase	NA	NA	NA	NA	NA
AYK87895.1|3085987_3086377_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	41.9	2.4e-16
AYK87896.1|3086520_3088656_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
AYK87897.1|3088967_3091544_+	glycosyltransferase	NA	NA	NA	NA	NA
AYK87898.1|3093244_3094072_+	ABC transporter permease	NA	NA	NA	NA	NA
AYK87899.1|3094092_3095004_+	teichoic acids export ABC transporter ATP-binding subunit TagH	NA	NA	NA	NA	NA
AYK87900.1|3096241_3097120_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	53.4	5.7e-82
AYK87901.1|3097449_3098592_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A2P1ELS7	Moumouvirus	29.9	3.8e-30
AYK87902.1|3098720_3100073_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK87903.1|3100199_3100559_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AYK87904.1|3100560_3100758_-	PspC domain-containing protein	NA	NA	NA	NA	NA
AYK87905.1|3100762_3101860_-	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
AYK87906.1|3101884_3102211_-	hypothetical protein	NA	NA	NA	NA	NA
AYK87907.1|3102428_3102659_+	hypothetical protein	NA	NA	NA	NA	NA
AYK87908.1|3102852_3103674_-	flagellin	NA	NA	NA	NA	NA
AYK87909.1|3104012_3106886_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.4	0.0e+00
AYK87910.1|3106893_3108879_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AYK87911.1|3109064_3109295_-	protein CsbA	NA	NA	NA	NA	NA
AYK87912.1|3109740_3112236_+	phosphotransferase	NA	NA	NA	NA	NA
AYK87913.1|3112311_3112881_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYK87914.1|3112911_3114246_+	MFS transporter	NA	NA	NA	NA	NA
AYK87915.1|3114293_3115487_-|protease	serine protease	protease	NA	NA	NA	NA
AYK87916.1|3115565_3115919_-	swarming motility protein SwrAA	NA	NA	NA	NA	NA
AYK87917.1|3116302_3117745_-|protease	carboxy-terminal processing protease CtpB	protease	A0A0R6PIZ1	Moraxella_phage	27.8	6.3e-22
>prophage 11
CP032861	Bacillus subtilis subsp. subtilis strain N1-1 chromosome, complete genome	4108100	3225829	3263411	4108100	portal,plate,tail,integrase,holin,protease,capsid	Bacillus_phage(30.77%)	48	3226722:3226775	3263550:3263603
AYK88016.1|3225829_3226423_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.8	2.6e-54
3226722:3226775	attL	GGTTTCCGGTACCACGTCTGTCGGGGGTTCGAATCCCTCCGAGCGCGTCCAATA	NA	NA	NA	NA
AYK88017.1|3226968_3227958_+	DNA integration/recombination/inversion protein	NA	A0A0U4IBS1	Pseudomonas_phage	28.1	2.7e-08
AYK88018.1|3228116_3228848_+	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	32.7	6.7e-20
AYK88019.1|3228878_3229061_-	hypothetical protein	NA	NA	NA	NA	NA
AYK88020.1|3229120_3229354_-	transcriptional regulator	NA	NA	NA	NA	NA
AYK88021.1|3229942_3230278_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88022.1|3230479_3230695_-	XRE family transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	50.8	1.7e-08
AYK88023.1|3230815_3231991_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88024.1|3232524_3233067_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88025.1|3233428_3233770_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88026.1|3233762_3233963_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88027.1|3234594_3234843_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK88028.1|3234839_3235223_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88029.1|3235290_3235662_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
AYK88030.1|3236522_3236801_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88031.1|3236797_3237340_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88032.1|3238384_3238564_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88033.1|3238816_3239128_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88034.1|3239501_3239711_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88035.1|3239740_3240289_-|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	7.0e-38
AYK88036.1|3242148_3242583_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	49.3	1.5e-27
AYK88037.1|3242587_3244258_+|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	55.3	1.5e-155
AYK88038.1|3244257_3245070_+|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	52.7	8.1e-75
AYK88039.1|3245175_3245736_+	ribonucleoside-triphosphate reductase	NA	NA	NA	NA	NA
AYK88040.1|3245767_3246676_+|capsid	phage major capsid protein	capsid	A0A0N9S7T7	Paenibacillus_phage	52.5	1.4e-80
AYK88041.1|3246732_3246924_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88042.1|3246941_3247334_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.5	7.5e-18
AYK88043.1|3247334_3247673_+	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	47.3	8.1e-21
AYK88044.1|3247669_3248077_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	55.5	2.1e-31
AYK88045.1|3248081_3248456_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88046.1|3248496_3249066_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	63.0	1.0e-52
AYK88965.1|3249152_3249509_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88047.1|3249604_3249826_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88048.1|3249830_3252653_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	36.4	6.7e-68
AYK88049.1|3252656_3254075_+|tail	phage tail protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	42.4	1.3e-56
AYK88050.1|3254089_3255484_+	endopeptidase	NA	A6M966	Geobacillus_virus	30.3	3.0e-37
AYK88051.1|3255496_3257074_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	86.8	3.3e-258
AYK88052.1|3257110_3258334_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	74.9	4.1e-163
AYK88053.1|3258349_3258643_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	80.2	1.6e-41
AYK88054.1|3258643_3258814_+	XkdX family protein	NA	M4ZS22	Bacillus_phage	68.1	1.1e-10
AYK88055.1|3258838_3259042_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	46.5	1.9e-09
AYK88056.1|3259114_3260062_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	62.7	2.5e-91
AYK88057.1|3260081_3260339_+|holin	holin	holin	A0A0U4JE55	Bacillus_phage	57.6	5.6e-22
AYK88058.1|3260460_3260763_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88059.1|3260804_3261437_-	hypothetical protein	NA	Q0H249	Geobacillus_phage	57.1	7.2e-63
AYK88060.1|3261423_3262608_-	DNA translocase FtsK	NA	Q0H250	Geobacillus_phage	53.4	1.3e-108
AYK88061.1|3262620_3262899_-	hypothetical protein	NA	NA	NA	NA	NA
AYK88062.1|3263177_3263411_+	helix-turn-helix domain-containing protein	NA	B3RH35	Bacillus_virus	62.0	4.3e-21
3263550:3263603	attR	GGTTTCCGGTACCACGTCTGTCGGGGGTTCGAATCCCTCCGAGCGCGTCCAATA	NA	NA	NA	NA
>prophage 12
CP032861	Bacillus subtilis subsp. subtilis strain N1-1 chromosome, complete genome	4108100	3343195	3400961	4108100	head,terminase,portal,tail,holin,protease,capsid,transposase	Bacillus_phage(68.29%)	68	NA	NA
AYK88133.1|3343195_3343849_+|holin	choline ABC transporter permease	holin	NA	NA	NA	NA
AYK88134.1|3343860_3344781_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYK88135.1|3344797_3345478_+	ABC transporter permease	NA	NA	NA	NA	NA
AYK88136.1|3345518_3347219_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	8.0e-24
AYK88137.1|3347346_3347673_-	HxlR family transcriptional regulator	NA	NA	NA	NA	NA
AYK88138.1|3347764_3348184_-	XRE family transcriptional regulator	NA	S6C481	Thermus_phage	62.7	5.4e-14
AYK88139.1|3348213_3348621_-	transcriptional regulator	NA	S6C481	Thermus_phage	64.8	1.9e-16
AYK88140.1|3348772_3349006_+	transcriptional regulator	NA	NA	NA	NA	NA
AYK88141.1|3349039_3349813_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYK88142.1|3349961_3350192_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AYK88143.1|3350323_3351064_+	carboxylesterase	NA	NA	NA	NA	NA
AYK88144.1|3351082_3353422_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	42.9	2.4e-87
AYK88145.1|3353566_3354037_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.4	3.2e-47
AYK88146.1|3355961_3357062_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK88147.1|3357494_3357893_-	XRE family transcriptional regulator	NA	S5M5X8	Brevibacillus_phage	33.7	4.3e-05
AYK88148.1|3358127_3358331_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYK88149.1|3358382_3358574_+	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	59.0	1.0e-12
AYK88150.1|3358598_3358817_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88151.1|3358809_3359691_+	replication protein	NA	V9QKF6	Oenococcus_phage	33.1	6.8e-27
AYK88152.1|3359674_3360502_+	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.9	3.7e-35
AYK88153.1|3360816_3361365_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88154.1|3361472_3361613_+	BH0509 family protein	NA	NA	NA	NA	NA
AYK88155.1|3361859_3362057_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88156.1|3362099_3362462_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AYK88157.1|3362458_3362776_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88158.1|3362772_3363180_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	45.8	1.3e-25
AYK88159.1|3363176_3363434_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	41.7	6.6e-07
AYK88160.1|3363551_3364208_+	dUTPase	NA	R9TQ23	Paenibacillus_phage	46.0	9.9e-39
AYK88161.1|3364207_3364540_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	53.3	8.3e-18
AYK88162.1|3364536_3364956_+	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	61.2	1.6e-42
AYK88163.1|3364952_3365153_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88164.1|3365406_3365859_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	56.6	3.4e-38
AYK88165.1|3367049_3367433_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88166.1|3367583_3368357_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88167.1|3368747_3369494_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88970.1|3369543_3369918_+	HNH endonuclease	NA	Q38456	Bacillus_phage	82.3	7.5e-60
AYK88168.1|3370297_3370831_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
AYK88169.1|3370830_3372540_+|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	92.3	0.0e+00
AYK88170.1|3372552_3372768_+	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	80.6	1.3e-24
AYK88171.1|3372773_3374021_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	86.5	1.3e-217
AYK88172.1|3374010_3374637_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	92.8	1.8e-106
AYK88173.1|3374673_3375876_+|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	71.5	3.3e-157
AYK88174.1|3375891_3376206_+	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	68.8	6.8e-30
AYK88175.1|3376234_3376726_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	69.1	1.3e-27
AYK88176.1|3376741_3377089_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	87.0	2.0e-51
AYK88177.1|3377021_3377393_+|head,tail	head-tail adaptor protein	head,tail	Q9ZXF2	Bacillus_phage	68.3	3.5e-41
AYK88178.1|3377385_3377769_+	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	86.6	2.9e-59
AYK88179.1|3377765_3378146_+	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	66.1	2.6e-39
AYK88180.1|3378146_3378758_+|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	89.7	7.9e-99
AYK88181.1|3379152_3379332_+	hypothetical protein	NA	D6R3Z7	Bacillus_phage	68.5	1.6e-12
AYK88182.1|3379344_3383223_+|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	81.0	0.0e+00
AYK88183.1|3383222_3384062_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	83.2	8.5e-136
AYK88184.1|3384073_3385780_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	81.8	9.4e-267
AYK88185.1|3385816_3387391_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	88.7	1.1e-264
AYK88186.1|3387427_3388651_+	DUF2479 domain-containing protein	NA	M4ZRP1	Bacillus_phage	79.9	6.5e-177
AYK88187.1|3388666_3388966_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	1.5e-39
AYK88188.1|3388962_3389133_+	XkdX family protein	NA	NA	NA	NA	NA
AYK88189.1|3389186_3389609_+|holin	holin family protein	holin	D6R405	Bacillus_phage	85.7	3.0e-57
AYK88190.1|3389650_3390592_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	77.1	3.0e-97
AYK88971.1|3390631_3391234_-	hypothetical protein	NA	NA	NA	NA	NA
AYK88191.1|3391576_3391966_-	hypothetical protein	NA	NA	NA	NA	NA
AYK88192.1|3391980_3393564_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	59.7	4.2e-75
AYK88972.1|3393725_3393914_-	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	53.3	1.4e-11
AYK88193.1|3394423_3395218_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYK88194.1|3395328_3395901_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYK88195.1|3395897_3396257_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AYK88196.1|3396820_3398707_+	FUSC family protein	NA	NA	NA	NA	NA
AYK88197.1|3399608_3400961_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 13
CP032861	Bacillus subtilis subsp. subtilis strain N1-1 chromosome, complete genome	4108100	3966889	4023997	4108100	integrase,tRNA,protease,coat,transposase	Staphylococcus_phage(20.0%)	47	3966565:3966619	3977965:3978019
3966565:3966619	attL	AGCTGGATAGAGCAACGGCCTTCTAAGCCGTCGGTCGGGAGTTCGAATCTCTCCT	NA	NA	NA	NA
AYK88999.1|3966889_3967777_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AYK88714.1|3968114_3968411_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88715.1|3969199_3970252_+	hypothetical protein	NA	NA	NA	NA	NA
AYK88716.1|3970556_3973763_+	type I restriction-modification system endonuclease	NA	Q5YA94	Bacillus_phage	29.5	1.7e-06
AYK88717.1|3973895_3975326_+	SAM-dependent methyltransferase	NA	A0A220A2U4	Liberibacter_phage	25.9	2.6e-28
AYK88718.1|3975322_3976642_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.9	1.3e-16
AYK88719.1|3978145_3979296_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
3977965:3978019	attR	AGCTGGATAGAGCAACGGCCTTCTAAGCCGTCGGTCGGGAGTTCGAATCTCTCCT	NA	NA	NA	NA
AYK88720.1|3979430_3980255_-	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
AYK88721.1|3981056_3981392_-	hypothetical protein	NA	NA	NA	NA	NA
AYK88722.1|3982204_3983929_+	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.2	2.4e-60
AYK88723.1|3983925_3984444_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
AYK88724.1|3984467_3985496_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AYK88725.1|3985482_3987039_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	39.4	6.0e-10
AYK88726.1|3987059_3988157_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AYK88727.1|3988206_3989625_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AYK88728.1|3989637_3990237_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AYK88729.1|3990356_3991361_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AYK88730.1|3991588_3992863_+	trigger factor	NA	NA	NA	NA	NA
AYK88731.1|3993134_3994397_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
AYK88732.1|3994550_3996209_+|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
AYK88733.1|3996389_3998714_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	2.6e-182
AYK88734.1|3998710_3999298_+	GTP-binding protein	NA	NA	NA	NA	NA
AYK88735.1|3999319_3999817_-	hypothetical protein	NA	NA	NA	NA	NA
AYK88736.1|4000046_4001414_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AYK88737.1|4001421_4002252_+	protein HemX	NA	NA	NA	NA	NA
AYK88738.1|4002284_4003229_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AYK88739.1|4003218_4004007_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AYK88740.1|4004003_4004978_+	porphobilinogen synthase	NA	NA	NA	NA	NA
AYK88741.1|4005007_4006300_+	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AYK88742.1|4006430_4008152_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AYK88743.1|4008184_4009210_+|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
AYK88744.1|4009228_4009420_-	hypothetical protein	NA	NA	NA	NA	NA
AYK88745.1|4009867_4012510_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	3.7e-161
AYK88746.1|4012569_4013862_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AYK88747.1|4014001_4014748_+	prepilin peptidase	NA	NA	NA	NA	NA
AYK88748.1|4014881_4015880_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
AYK88749.1|4016032_4016602_+	septum formation protein Maf	NA	NA	NA	NA	NA
AYK88750.1|4016638_4017334_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AYK88751.1|4017425_4018439_+	rod shape-determining protein	NA	NA	NA	NA	NA
AYK88752.1|4018469_4019342_+	cell shape-determining protein MreC	NA	NA	NA	NA	NA
AYK88753.1|4019338_4019857_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AYK88754.1|4019909_4020590_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
AYK88755.1|4020591_4021398_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
AYK88756.1|4021547_4022342_+	stage IV sporulation protein FA	NA	NA	NA	NA	NA
AYK88757.1|4022334_4023201_+	stage IV sporulation protein FB	NA	NA	NA	NA	NA
AYK88758.1|4023347_4023656_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
AYK88759.1|4023658_4023997_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
