The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032872	Bacillus subtilis subsp. subtilis strain 2KL1 chromosome, complete genome	4196696	14615	54186	4196696	holin,transposase,protease	Staphylococcus_phage(28.57%)	34	NA	NA
AYK99026.1|14615_15765_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AYK99027.1|15808_16327_-	acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	25.7	5.6e-05
AYK99028.1|16330_16981_-	pyrophosphatase PpaX	NA	NA	NA	NA	NA
AYK99029.1|16977_17916_-	hypothetical protein	NA	NA	NA	NA	NA
AYK99030.1|17939_18749_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AYK99031.1|18762_19695_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
AYK99032.1|19876_21067_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AYK99033.1|21063_21792_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
AYK99034.1|21809_22541_+	transcriptional regulator	NA	NA	NA	NA	NA
AYK99035.1|22562_26432_-	hypothetical protein	NA	NA	NA	NA	NA
AYK99036.1|26491_26728_-	hypothetical protein	NA	NA	NA	NA	NA
AYK99037.1|26732_28085_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK99038.1|28211_28571_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AYK99039.1|28572_28770_-	PspC domain-containing protein	NA	NA	NA	NA	NA
AYK99040.1|28774_29872_-	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
AYK99041.1|29896_30223_-	hypothetical protein	NA	NA	NA	NA	NA
AYK99042.1|30440_30671_+	hypothetical protein	NA	NA	NA	NA	NA
AYK99043.1|30864_31686_-	flagellin	NA	NA	NA	NA	NA
AYK99044.1|32024_34898_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.4	0.0e+00
AYK99045.1|34905_36891_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AYK99046.1|37076_37307_-	protein CsbA	NA	NA	NA	NA	NA
AYK99047.1|37752_40248_+	phosphotransferase	NA	NA	NA	NA	NA
AYK99048.1|40323_40893_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYK99049.1|40923_42258_+	MFS transporter	NA	NA	NA	NA	NA
AYK99050.1|42305_43499_-|protease	serine protease	protease	NA	NA	NA	NA
AYK99051.1|43577_43931_-	swarming motility protein SwrAA	NA	NA	NA	NA	NA
AYK99052.1|44314_45757_-|protease	carboxy-terminal processing protease CtpB	protease	A0A0R6PIZ1	Moraxella_phage	27.8	6.3e-22
AYL02962.1|45896_46787_-	ABC transporter permease	NA	NA	NA	NA	NA
AYK99053.1|46779_47466_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.0	2.9e-25
AYK99054.1|47699_48038_-	cytochrome c551	NA	NA	NA	NA	NA
AYK99055.1|48086_48971_-	YitT family protein	NA	NA	NA	NA	NA
AYK99056.1|49097_50199_-	peptide chain release factor 2	NA	NA	NA	NA	NA
AYK99057.1|50268_52794_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AYK99058.1|53036_54186_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
>prophage 2
CP032872	Bacillus subtilis subsp. subtilis strain 2KL1 chromosome, complete genome	4196696	237087	257826	4196696	transposase,tRNA,bacteriocin	Shigella_phage(25.0%)	19	NA	NA
AYK99246.1|237087_238277_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.6	1.6e-31
AYK99247.1|238378_239986_-	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.1	1.0e-153
AYK99248.1|240227_240734_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
AYK99249.1|240916_242056_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AYK99250.1|242052_244170_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AYK99251.1|244324_245521_+	cardiolipin synthase	NA	NA	NA	NA	NA
AYK99252.1|245533_246496_+	UV DNA damage repair endonuclease UvsE	NA	A0A127AW32	Bacillus_phage	34.2	1.7e-39
AYK99253.1|246576_246849_+	hypothetical protein	NA	NA	NA	NA	NA
AYK99254.1|248478_250149_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
AYK99255.1|250145_250574_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
AYK99256.1|250888_251020_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
AYK99257.1|250976_251129_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
AYK99258.1|251153_252500_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
AYK99259.1|252512_252674_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
AYK99260.1|252670_253390_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.6e-18
AYK99261.1|253382_254693_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
AYL02969.1|254682_255843_+	insulinase family protein	NA	NA	NA	NA	NA
AYK99262.1|255847_257128_+	insulinase family protein	NA	NA	NA	NA	NA
AYK99263.1|257124_257826_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
>prophage 3
CP032872	Bacillus subtilis subsp. subtilis strain 2KL1 chromosome, complete genome	4196696	267838	318372	4196696	transposase,tRNA,coat,protease	Streptococcus_phage(15.38%)	51	NA	NA
AYK99272.1|267838_268498_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AYK99273.1|268606_268795_+	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
AYK99274.1|268837_269257_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYK99275.1|269376_271293_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.4	1.9e-143
AYK99276.1|271902_272058_-	hypothetical protein	NA	NA	NA	NA	NA
AYK99277.1|272137_273538_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
AYK99278.1|273537_274008_-	transcriptional regulator	NA	NA	NA	NA	NA
AYK99279.1|274119_274620_-	YwgA family protein	NA	NA	NA	NA	NA
AYK99280.1|274655_275957_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
AYK99281.1|276118_276343_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
AYK99282.1|276557_277334_+	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
AYK99283.1|277477_278368_-	DMT family transporter	NA	NA	NA	NA	NA
AYK99284.1|278536_279382_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
AYK99285.1|279430_280330_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
AYK99286.1|280475_281447_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AYK99287.1|281716_282481_+	heme-binding protein	NA	NA	NA	NA	NA
AYK99288.1|282613_283393_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYK99289.1|283408_284623_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AYK99290.1|284623_285808_-	MFS transporter	NA	NA	NA	NA	NA
AYK99291.1|285804_287223_-	alanine-anticapsin ligase BacD	NA	NA	NA	NA	NA
AYL02970.1|287241_288003_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.8e-21
AYK99292.1|288005_288713_-	bacilysin biosynthesis protein BacB	NA	NA	NA	NA	NA
AYK99293.1|288702_289317_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
AYK99294.1|289541_290894_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYK99295.1|291045_292284_-	MFS transporter	NA	NA	NA	NA	NA
AYK99296.1|292493_293906_-	amino acid permease	NA	NA	NA	NA	NA
AYK99297.1|293905_295606_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
AYK99298.1|295679_297227_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYK99299.1|297453_298728_-	catabolic NAD-specific glutamate dehydrogenase RocG	NA	NA	NA	NA	NA
AYK99300.1|298905_299370_-	hypothetical protein	NA	NA	NA	NA	NA
AYK99301.1|299694_300150_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK99302.1|300142_300994_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.3	1.7e-38
AYK99303.1|301007_301955_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
AYK99304.1|301954_302695_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	42.0	7.7e-48
AYK99305.1|302719_303739_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK99306.1|303741_304464_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK99307.1|304456_305578_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYK99308.1|305577_306447_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK99309.1|306447_307617_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	27.2	6.5e-17
AYK99310.1|307637_309059_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
AYK99311.1|309063_309834_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
AYK99312.1|309799_310006_-	hypothetical protein	NA	NA	NA	NA	NA
AYK99313.1|310153_310684_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
AYK99314.1|310727_311099_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
AYK99315.1|311160_312483_-	purine permease	NA	NA	NA	NA	NA
AYK99316.1|312502_312820_-	hypothetical protein	NA	NA	NA	NA	NA
AYK99317.1|312987_314358_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AYK99318.1|314381_315059_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	46.1	8.3e-49
AYK99319.1|315072_315879_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AYK99320.1|316070_316886_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AYK99321.1|317019_318372_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 4
CP032872	Bacillus subtilis subsp. subtilis strain 2KL1 chromosome, complete genome	4196696	532440	587950	4196696	holin,transposase,protease	Klosneuvirus(20.0%)	49	NA	NA
AYK99512.1|532440_532845_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
AYK99513.1|532814_533507_+	LrgB family protein	NA	NA	NA	NA	NA
AYK99514.1|533546_534578_-	general stress protein 30	NA	NA	NA	NA	NA
AYK99515.1|534670_535819_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
AYK99516.1|536014_536746_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYK99517.1|536738_538280_+	gluconokinase	NA	NA	NA	NA	NA
AYK99518.1|538308_539655_+	gluconate permease	NA	NA	NA	NA	NA
AYK99519.1|539677_541084_+	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	30.6	2.3e-32
AYK99520.1|541550_542114_+	peroxiredoxin	NA	NA	NA	NA	NA
AYK99521.1|542127_543657_+	alkyl hydroperoxide reductase subunit F	NA	A0A1V0SIN1	Klosneuvirus	29.3	1.7e-33
AYK99522.1|543759_545199_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AYK99523.1|545284_545464_-	hypothetical protein	NA	NA	NA	NA	NA
AYK99524.1|545770_546481_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYK99525.1|546571_547294_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYK99526.1|547314_547944_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
AYK99527.1|548434_550360_+	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
AYK99528.1|550810_551161_-	hypothetical protein	NA	NA	NA	NA	NA
AYK99529.1|551641_552082_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	34.4	3.4e-11
AYK99530.1|552082_552262_+	hypothetical protein	NA	NA	NA	NA	NA
AYK99531.1|552501_553260_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
AYL02977.1|553256_554804_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AYK99532.1|554933_555374_-	hypothetical protein	NA	NA	NA	NA	NA
AYK99533.1|555781_557245_+	hypothetical protein	NA	A0A0S2MYH0	Enterococcus_phage	36.0	1.0e-11
AYK99534.1|557479_559363_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	21.8	6.6e-19
AYK99535.1|559343_561377_-	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
AYK99536.1|561893_563044_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	98.9	9.8e-151
AYL02978.1|563742_564006_-	hypothetical protein	NA	NA	NA	NA	NA
AYK99537.1|564389_565304_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	22.9	9.0e-06
AYK99538.1|565300_565618_-|transposase	transposase	transposase	NA	NA	NA	NA
AYK99539.1|565882_569005_-	DEAD/DEAH box helicase	NA	A7WKM3	Acidianus_filamentous_virus	26.4	6.6e-08
AYK99540.1|568961_569870_-	hypothetical protein	NA	NA	NA	NA	NA
AYK99541.1|570157_570637_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AYK99542.1|570717_570888_-	CxxH/CxxC protein	NA	NA	NA	NA	NA
AYK99543.1|571072_571486_+	hypothetical protein	NA	NA	NA	NA	NA
AYK99544.1|571519_572746_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	28.9	1.5e-11
AYK99545.1|572808_572979_-	hypothetical protein	NA	NA	NA	NA	NA
AYK99546.1|573083_573332_-	DUF2651 domain-containing protein	NA	NA	NA	NA	NA
AYK99547.1|575405_575876_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYK99548.1|577083_577200_+	phosphatase RapG inhibitor	NA	NA	NA	NA	NA
AYK99549.1|577435_578326_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	29.1	2.0e-26
AYK99550.1|578398_579802_-	amino-acid permease RocE	NA	NA	NA	NA	NA
AYK99551.1|580024_581230_-	ornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.5	2.0e-29
AYK99552.1|581561_582164_-	sporulation delaying protein family toxin	NA	NA	NA	NA	NA
AYK99553.1|582225_583179_-	hypothetical protein	NA	NA	NA	NA	NA
AYK99554.1|583163_583718_-	SdpA family antimicrobial peptide system protein	NA	NA	NA	NA	NA
AYL02979.1|583901_584537_-	SdpI family protein	NA	NA	NA	NA	NA
AYL02980.1|584536_584821_-	ArsR family transcriptional regulator	NA	A0A218MNF3	uncultured_virus	41.3	2.8e-06
AYK99555.1|585047_586433_+	arginine utilization regulatory protein RocR	NA	NA	NA	NA	NA
AYK99556.1|586747_587950_-|protease	serine protease	protease	W5SAB9	Pithovirus	40.4	5.9e-13
>prophage 5
CP032872	Bacillus subtilis subsp. subtilis strain 2KL1 chromosome, complete genome	4196696	1290132	1383860	4196696	holin,integrase,terminase,transposase,coat,portal,plate,head,tail,tRNA,capsid,protease	uncultured_Caudovirales_phage(27.08%)	103	1300516:1300534	1343777:1343795
AYL00149.1|1290132_1290609_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AYL00150.1|1290589_1291279_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AYL00151.1|1291288_1291744_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AYL00152.1|1291736_1292777_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.9	8.8e-66
AYL00153.1|1292860_1293064_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00154.1|1293002_1294931_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	5.3e-56
AYL00155.1|1295056_1295569_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AYL00156.1|1295565_1296213_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
AYL00157.1|1296234_1296408_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
AYL00158.1|1296414_1297179_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.8	1.5e-22
AYL00159.1|1297144_1297351_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00160.1|1297410_1297602_-	lipoprotein	NA	NA	NA	NA	NA
AYL00161.1|1297598_1298333_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYL00162.1|1298571_1298856_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	2.2e-19
AYL00163.1|1298902_1300534_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.7	3.7e-159
1300516:1300534	attL	TATGGGCGGAATGATGTAA	NA	NA	NA	NA
AYL00164.1|1300623_1301823_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	46.3	4.1e-83
AYL00165.1|1301839_1302346_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	69.9	2.6e-63
AYL00166.1|1302749_1303115_-	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	48.7	1.4e-21
AYL00167.1|1303249_1303486_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYL00168.1|1303498_1303813_+	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	45.3	2.4e-11
AYL00169.1|1303809_1304538_+	phage regulatory protein	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	62.5	5.0e-84
AYL00170.1|1304594_1305164_+	XRE family transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	58.5	4.5e-64
AYL00171.1|1305160_1305418_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	2.2e-10
AYL00172.1|1305414_1305612_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00173.1|1305714_1306065_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00174.1|1306064_1306256_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00175.1|1306252_1307170_+	hypothetical protein	NA	A0A0A7RUE9	Clostridium_phage	62.5	4.7e-87
AYL00176.1|1307189_1307927_+	hypothetical protein	NA	A0A0A7RVR3	Clostridium_phage	44.9	2.3e-52
AYL00177.1|1307926_1308115_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00178.1|1308123_1308816_+	DnaD domain protein	NA	A0A1L2JY26	Aeribacillus_phage	41.0	2.1e-07
AYL00179.1|1308736_1309552_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	48.5	1.8e-61
AYL00180.1|1309782_1310211_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	64.5	6.6e-44
AYL00181.1|1310291_1310498_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	2.1e-19
AYL00182.1|1310529_1310814_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00183.1|1310810_1311059_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	42.3	7.8e-05
AYL00184.1|1311308_1311674_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00185.1|1311687_1312890_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00186.1|1313143_1313329_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00187.1|1313349_1313811_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	46.0	4.1e-23
AYL00188.1|1314093_1314408_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00189.1|1314809_1315175_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	55.0	9.4e-31
AYL00190.1|1315402_1315918_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	43.4	2.8e-33
AYL00191.1|1315914_1317624_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.5	6.0e-205
AYL00192.1|1317636_1317828_+	DUF1056 family protein	NA	NA	NA	NA	NA
AYL00193.1|1317828_1319136_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.4	9.3e-105
AYL00194.1|1319083_1319821_+|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	57.1	2.6e-56
AYL00195.1|1319860_1321147_+|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	45.2	2.7e-80
AYL00196.1|1321173_1321626_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	57.1	1.3e-10
AYL00197.1|1321643_1321946_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	4.7e-12
AYL00198.1|1321935_1322250_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JCB1	uncultured_Caudovirales_phage	37.3	1.3e-12
AYL00199.1|1322249_1322648_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00200.1|1322644_1323037_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AYL00201.1|1323051_1323666_+|tail	phage tail protein	tail	J7KKC8	Streptococcus_phage	35.1	3.7e-11
AYL00202.1|1323730_1324108_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00203.1|1324307_1328795_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	41.5	1.2e-66
AYL00204.1|1328788_1329628_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.6	3.4e-92
AYL00205.1|1329642_1331346_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	55.5	4.3e-179
AYL00206.1|1331397_1332954_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	82.9	1.5e-250
AYL00207.1|1332990_1334112_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	92.5	7.5e-196
AYL00208.1|1334127_1334427_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	2.0e-39
AYL00209.1|1334423_1334594_+	XkdX family protein	NA	NA	NA	NA	NA
AYL00210.1|1334645_1334858_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.9e-15
AYL00211.1|1334872_1335136_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.7	2.1e-24
AYL00212.1|1335193_1336162_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	67.4	1.0e-63
AYL00213.1|1336195_1336612_-	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	57.2	6.7e-41
AYL00214.1|1336623_1338243_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	59.7	4.3e-75
AYL00215.1|1338488_1339148_-	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	32.9	6.7e-11
AYL00216.1|1339312_1339795_-	hypothetical protein	NA	NA	NA	NA	NA
AYL00217.1|1340351_1340582_+	DNA-binding protein	NA	NA	NA	NA	NA
AYL00218.1|1342205_1342640_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00219.1|1342645_1343365_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00220.1|1343383_1343572_-	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	58.3	3.1e-14
AYL00221.1|1344914_1345718_+	hypothetical protein	NA	NA	NA	NA	NA
1343777:1343795	attR	TATGGGCGGAATGATGTAA	NA	NA	NA	NA
AYL00222.1|1345718_1346663_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00223.1|1346978_1349480_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AYL00224.1|1349681_1350743_+	sorbitol dehydrogenase	NA	NA	NA	NA	NA
AYL00225.1|1350816_1352208_+	MFS transporter	NA	NA	NA	NA	NA
AYL00226.1|1352302_1353265_+	carbohydrate kinase	NA	NA	NA	NA	NA
AYL00227.1|1353460_1354144_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
AYL00228.1|1354209_1355235_+	TFIIB-type zinc ribbon-containing protein	NA	NA	NA	NA	NA
AYL00229.1|1355234_1355999_+	YgcG family protein	NA	NA	NA	NA	NA
AYL00230.1|1356029_1357001_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00231.1|1358655_1360077_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
AYL00232.1|1360124_1361165_-	(R,R)-butanediol dehydrogenase	NA	NA	NA	NA	NA
AYL00233.1|1361601_1361973_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00234.1|1362038_1363085_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00235.1|1363198_1364348_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AYL00236.1|1364408_1364567_-	hypothetical protein	NA	NA	NA	NA	NA
AYL00237.1|1364756_1364966_-	hypothetical protein	NA	NA	NA	NA	NA
AYL00238.1|1365048_1365864_-	alpha/beta hydrolase	NA	H9NCP0	Mycobacterium_phage	30.8	2.4e-10
AYL00239.1|1366948_1368490_-|coat	spore coat protein A	coat	NA	NA	NA	NA
AYL00240.1|1368641_1370051_-	GABA permease	NA	NA	NA	NA	NA
AYL00241.1|1370088_1370376_-	hypothetical protein	NA	NA	NA	NA	NA
AYL00242.1|1370449_1371322_+	cation transporter	NA	NA	NA	NA	NA
AYL00243.1|1371472_1372435_+	MoxR family ATPase	NA	NA	NA	NA	NA
AYL00244.1|1372434_1373631_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
AYL00245.1|1373652_1375866_+	DUF4129 domain-containing protein	NA	NA	NA	NA	NA
AYL03008.1|1376028_1377570_+	GMP synthase (glutamine-hydrolyzing)	NA	A0A1V0SH76	Hokovirus	30.5	5.7e-21
AYL00246.1|1377678_1378212_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYL00247.1|1378193_1379660_+	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
AYL00248.1|1380043_1381366_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.0	1.3e-37
AYL00249.1|1381576_1382380_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00250.1|1382507_1383860_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 6
CP032872	Bacillus subtilis subsp. subtilis strain 2KL1 chromosome, complete genome	4196696	1387190	1395556	4196696		Synechococcus_phage(50.0%)	8	NA	NA
AYL00256.1|1387190_1388486_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
AYL00257.1|1388559_1389285_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	1.2e-45
AYL00258.1|1389277_1389532_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AYL00259.1|1389528_1390212_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AYL00260.1|1390195_1392424_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.0	5.5e-158
AYL00261.1|1392399_1393830_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
AYL00262.1|1393931_1394972_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	1.7e-64
AYL00263.1|1394968_1395556_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
>prophage 7
CP032872	Bacillus subtilis subsp. subtilis strain 2KL1 chromosome, complete genome	4196696	1908368	1956741	4196696	transposase,tRNA,coat	Planktothrix_phage(44.44%)	56	NA	NA
AYL00732.1|1908368_1909519_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AYL00733.1|1909696_1909876_+	YjzC family protein	NA	NA	NA	NA	NA
AYL00734.1|1909922_1910108_-	DUF2929 domain-containing protein	NA	NA	NA	NA	NA
AYL00735.1|1910356_1911091_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00736.1|1911172_1911730_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00737.1|1911820_1912774_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYL00738.1|1912788_1912980_+	competence protein ComG	NA	NA	NA	NA	NA
AYL00739.1|1913009_1913249_-	hypothetical protein	NA	NA	NA	NA	NA
AYL00740.1|1913413_1914352_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AYL00741.1|1914374_1915616_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AYL00742.1|1915691_1916477_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00743.1|1916667_1917654_+	oligopeptide transport ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-22
AYL00744.1|1917650_1918640_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	9.4e-17
AYL00745.1|1918727_1920359_+	peptide-binding protein	NA	NA	NA	NA	NA
AYL00746.1|1920434_1921385_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYL00747.1|1921401_1922313_+	ABC transporter permease	NA	NA	NA	NA	NA
AYL03021.1|1922518_1923271_+	DUF3603 family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	5.4e-49
AYL03022.1|1923305_1924298_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AYL00748.1|1925041_1926679_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYL00749.1|1926786_1927722_+	ABC transporter permease	NA	NA	NA	NA	NA
AYL00750.1|1927725_1928643_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AYL00751.1|1928647_1929724_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
AYL00752.1|1929725_1930643_+	oligopeptide transport ATP-binding protein OppF	NA	G9BWD6	Planktothrix_phage	34.8	1.6e-23
AYL03023.1|1930750_1931968_+	MFS transporter	NA	NA	NA	NA	NA
AYL00753.1|1932890_1933286_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AYL00754.1|1933328_1933985_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
AYL00755.1|1934154_1934295_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00756.1|1934261_1934918_+	adaptor protein MecA	NA	NA	NA	NA	NA
AYL00757.1|1934912_1935035_-	hypothetical protein	NA	NA	NA	NA	NA
AYL00758.1|1935078_1936230_+	competence protein CoiA	NA	NA	NA	NA	NA
AYL00759.1|1936276_1938289_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AYL00760.1|1938326_1938494_-	hypothetical protein	NA	NA	NA	NA	NA
AYL00761.1|1938589_1938790_-	hypothetical protein	NA	NA	NA	NA	NA
AYL00762.1|1938808_1939708_-	DsbA family protein	NA	NA	NA	NA	NA
AYL00763.1|1939704_1940103_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
AYL03024.1|1940357_1940903_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	73.7	5.1e-41
AYL00764.1|1941106_1941679_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AYL00765.1|1941803_1942172_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00766.1|1942200_1942836_+	GTP pyrophosphokinase YjbM	NA	NA	NA	NA	NA
AYL00767.1|1942854_1943655_+	NAD(+) kinase	NA	NA	NA	NA	NA
AYL03025.1|1943717_1944569_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AYL00768.1|1944581_1945316_-	bis(5'-nucleosyl)-tetraphosphatase PrpE [asymmetrical]	NA	A8E2N0	Enterococcus_phage	24.8	7.2e-06
AYL00769.1|1945551_1947396_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AYL00770.1|1947644_1948355_+	thiaminase II	NA	NA	NA	NA	NA
AYL00771.1|1948329_1948947_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
AYL00772.1|1948930_1950040_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
AYL03026.1|1950039_1950240_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AYL00773.1|1950236_1951007_+	thiazole synthase	NA	NA	NA	NA	NA
AYL00774.1|1951003_1952014_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
AYL00775.1|1952032_1952848_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AYL00776.1|1952983_1953760_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AYL00777.1|1953860_1954544_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYL00778.1|1954636_1955086_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYL00779.1|1955213_1955702_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYL00780.1|1955853_1956336_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYL00781.1|1956420_1956741_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 8
CP032872	Bacillus subtilis subsp. subtilis strain 2KL1 chromosome, complete genome	4196696	1998362	2087931	4196696	holin,terminase,transposase,coat,portal,plate,tail,tRNA,protease	uncultured_Caudovirales_phage(26.19%)	94	NA	NA
AYL00819.1|1998362_1999574_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.8	2.2e-23
AYL00820.1|1999704_2000211_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYL00821.1|2000429_2000825_-	hypothetical protein	NA	NA	NA	NA	NA
AYL00822.1|2001053_2001533_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AYL00823.1|2001572_2001767_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
AYL00824.1|2001898_2002228_-	DUF4306 domain-containing protein	NA	NA	NA	NA	NA
AYL00825.1|2002776_2003757_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AYL00826.1|2003889_2004123_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYL00827.1|2004375_2005779_+	DUF4163 domain-containing protein	NA	NA	NA	NA	NA
AYL00828.1|2005818_2006292_-	DUF2690 domain-containing protein	NA	NA	NA	NA	NA
AYL00829.1|2006415_2006583_-	putative motility protein	NA	NA	NA	NA	NA
AYL03030.1|2007618_2008017_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
AYL00830.1|2008117_2008693_-	DUF4309 domain-containing protein	NA	NA	NA	NA	NA
AYL00831.1|2008838_2011796_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
AYL00832.1|2011788_2012334_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
AYL00833.1|2012545_2013190_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
AYL00834.1|2013264_2013891_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AYL00835.1|2013921_2014200_-	hypothetical protein	NA	NA	NA	NA	NA
AYL00836.1|2014590_2015781_+	cytochrome P450	NA	NA	NA	NA	NA
AYL00837.1|2015803_2016982_+	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	28.3	5.6e-08
AYL00838.1|2017022_2017211_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	77.6	3.4e-21
AYL00839.1|2017384_2018197_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AYL00840.1|2019826_2020579_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AYL00841.1|2020578_2021331_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	6.4e-18
AYL00842.1|2021450_2022425_-	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
AYL00843.1|2023441_2023864_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
AYL00844.1|2023903_2025082_+	NADH dehydrogenase	NA	NA	NA	NA	NA
AYL00845.1|2025279_2026701_+	glucuronate isomerase	NA	NA	NA	NA	NA
AYL00846.1|2028251_2029265_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AYL00847.1|2029270_2030290_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AYL00848.1|2030314_2031394_+	mannonate dehydratase	NA	NA	NA	NA	NA
AYL00849.1|2031390_2032227_+	SDR family NAD(P)-dependent oxidoreductase	NA	M1NMS3	Moumouvirus	30.4	2.7e-09
AYL00850.1|2032274_2033543_+	MFS transporter	NA	NA	NA	NA	NA
AYL00851.1|2033630_2034632_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AYL00852.1|2034707_2036150_+	tagaturonate reductase	NA	NA	NA	NA	NA
AYL00853.1|2036146_2037640_+	altronate dehydratase	NA	NA	NA	NA	NA
AYL00854.1|2037678_2038443_-	anion permease	NA	NA	NA	NA	NA
AYL00855.1|2038753_2040106_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYL00856.1|2040248_2040713_-	hypothetical protein	NA	NA	NA	NA	NA
AYL00857.1|2042003_2043154_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AYL00858.1|2043566_2044703_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
AYL00859.1|2044692_2044827_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
AYL00860.1|2045224_2046178_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	73.8	1.6e-66
AYL00861.1|2046217_2046595_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	7.9e-17
AYL00862.1|2046699_2047302_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	48.7	1.4e-44
AYL00863.1|2047378_2048215_+	manganese catalase family protein	NA	NA	NA	NA	NA
AYL00864.1|2048258_2048855_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
AYL00865.1|2049017_2049359_-	transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
AYL00866.1|2049537_2049717_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00867.1|2049703_2050540_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	27.8	6.7e-24
AYL00868.1|2050439_2051240_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	5.0e-61
AYL00869.1|2051239_2051407_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00870.1|2051491_2051842_+|portal	phage portal protein	portal	NA	NA	NA	NA
AYL00871.1|2051838_2052045_+	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	2.1e-11
AYL00872.1|2052160_2052670_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	39.2	6.5e-22
AYL00873.1|2052785_2053583_+|terminase	PBSX phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
AYL00874.1|2053579_2054881_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.0	9.1e-153
AYL00875.1|2054884_2056372_+	phage-like element PBSX protein XkdE	NA	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
AYL00876.1|2056391_2057219_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	59.2	1.6e-54
AYL00877.1|2057244_2058180_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
AYL00878.1|2058201_2058585_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
AYL00879.1|2058581_2058938_+	phage-like element PBSX protein XkdH	NA	NA	NA	NA	NA
AYL00880.1|2058934_2059420_+	phage-like element PBSX protein XkdI	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
AYL00881.1|2059432_2059873_+	phage-like element PBSX protein XkdJ	NA	NA	NA	NA	NA
AYL00882.1|2059876_2060095_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00883.1|2060091_2061492_+|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	39.3	3.0e-77
AYL00884.1|2061493_2061937_+	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	44.5	1.9e-25
AYL00885.1|2062028_2062475_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	36.8	1.0e-10
AYL00886.1|2062516_2062657_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00887.1|2062657_2067661_+|portal	phage portal protein	portal	A0A2H4JA91	uncultured_Caudovirales_phage	44.8	6.4e-37
AYL00888.1|2067653_2068313_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	33.2	1.1e-24
AYL00889.1|2068328_2069306_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
AYL00890.1|2069305_2069572_+	phage-like element PBSX protein XkdR	NA	S6C459	Thermus_phage	36.4	1.7e-05
AYL00891.1|2069629_2070055_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	3.0e-12
AYL00892.1|2070047_2071094_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	1.3e-72
AYL00893.1|2071077_2071656_+	phage-like element PBSX protein XkdU	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	3.9e-15
AYL00894.1|2071652_2071925_+	hypothetical protein	NA	NA	NA	NA	NA
AYL00895.1|2071927_2073991_+|terminase	terminase	terminase	A0A2H4J4R1	uncultured_Caudovirales_phage	34.5	2.6e-29
AYL00896.1|2074002_2074332_+|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	40.7	1.3e-15
AYL00897.1|2074328_2074493_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	1.9e-15
AYL00898.1|2074539_2075379_+|portal	phage portal protein	portal	NA	NA	NA	NA
AYL00899.1|2075431_2075701_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	1.4e-23
AYL00900.1|2075713_2075977_+|holin	holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	6.1e-24
AYL00901.1|2075989_2076883_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.2	5.2e-83
AYL00902.1|2076920_2077058_-	hypothetical protein	NA	NA	NA	NA	NA
AYL00903.1|2077143_2077314_-	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
AYL00904.1|2077313_2078060_-	type II toxin-antitoxin system SpoIISA family toxin	NA	NA	NA	NA	NA
AYL00905.1|2078169_2079171_-	low-affinity inorganic phosphate transporter	NA	NA	NA	NA	NA
AYL00906.1|2079183_2079801_-	DUF47 domain-containing protein	NA	NA	NA	NA	NA
AYL00907.1|2080076_2081393_-	amino acid permease	NA	NA	NA	NA	NA
AYL00908.1|2081781_2082732_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
AYL03031.1|2082948_2085099_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AYL00909.1|2085110_2086082_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	41.3	2.5e-62
AYL00910.1|2086581_2087931_-|protease	serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	34.1	3.4e-25
>prophage 9
CP032872	Bacillus subtilis subsp. subtilis strain 2KL1 chromosome, complete genome	4196696	2504820	2555272	4196696	terminase,transposase,coat,tRNA,protease	Bacillus_phage(50.0%)	55	NA	NA
AYL01312.1|2504820_2506173_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYL01313.1|2506418_2507948_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AYL01314.1|2507949_2508381_+	hypothetical protein	NA	NA	NA	NA	NA
AYL01315.1|2508642_2509188_+|coat	spore coat protein E	coat	NA	NA	NA	NA
AYL01316.1|2509320_2511897_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	27.7	2.4e-40
AYL01317.1|2511912_2513796_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.3	7.6e-68
AYL01318.1|2514905_2515154_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	44.9	4.6e-05
AYL01319.1|2515204_2515567_-	hypothetical protein	NA	NA	NA	NA	NA
AYL01320.1|2515818_2516589_+	hypothetical protein	NA	NA	NA	NA	NA
AYL01321.1|2516596_2516809_+	hypothetical protein	NA	NA	NA	NA	NA
AYL01322.1|2518732_2519050_+	hypothetical protein	NA	NA	NA	NA	NA
AYL01323.1|2519225_2519471_+	hypothetical protein	NA	NA	NA	NA	NA
AYL01324.1|2519460_2520075_+	hypothetical protein	NA	NA	NA	NA	NA
AYL01325.1|2520087_2520312_+	hypothetical protein	NA	NA	NA	NA	NA
AYL01326.1|2520308_2520683_+	HNH endonuclease	NA	Q38456	Bacillus_phage	87.1	1.3e-64
AYL01327.1|2521062_2521596_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
AYL01328.1|2521846_2523094_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYL03047.1|2524140_2524596_-	hypothetical protein	NA	NA	NA	NA	NA
AYL01329.1|2524750_2525308_-	hypothetical protein	NA	NA	NA	NA	NA
AYL01330.1|2525428_2526043_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYL01331.1|2526181_2526538_-	hypothetical protein	NA	NA	NA	NA	NA
AYL01332.1|2526616_2527441_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYL01333.1|2527551_2528880_-|protease	serine protease	protease	A0A1B0T6A2	Bacillus_phage	33.6	9.3e-28
AYL01334.1|2529104_2529338_+	hypothetical protein	NA	NA	NA	NA	NA
AYL01335.1|2529617_2530325_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	56.9	3.2e-51
AYL01336.1|2530394_2530847_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AYL01337.1|2530860_2531214_-	multidrug resistance protein EbrB	NA	NA	NA	NA	NA
AYL01338.1|2531227_2531545_-	multidrug efflux SMR transporter subunit EbrA	NA	NA	NA	NA	NA
AYL01339.1|2531681_2531957_-	hypothetical protein	NA	NA	NA	NA	NA
AYL01340.1|2532045_2532459_+	hypothetical protein	NA	NA	NA	NA	NA
AYL01341.1|2532558_2533503_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AYL01342.1|2533542_2533764_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AYL01343.1|2533959_2534232_+	hypothetical protein	NA	NA	NA	NA	NA
AYL01344.1|2534313_2534544_+	hypothetical protein	NA	NA	NA	NA	NA
AYL01345.1|2534785_2535178_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
AYL01346.1|2535137_2537240_+	ribonucleotide-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
AYL01347.1|2537257_2538247_+	ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
AYL01348.1|2538296_2538917_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
AYL01349.1|2538980_2539748_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	1.2e-51
AYL01350.1|2540388_2541357_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
AYL01351.1|2541489_2542752_+	GTPase HflX	NA	NA	NA	NA	NA
AYL01352.1|2542769_2544035_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AYL01353.1|2544144_2544552_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
AYL01354.1|2544610_2545945_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
AYL01355.1|2546054_2546180_+	hypothetical protein	NA	NA	NA	NA	NA
AYL01356.1|2546218_2546518_-	hypothetical protein	NA	NA	NA	NA	NA
AYL01357.1|2546571_2546880_-	hypothetical protein	NA	NA	NA	NA	NA
AYL01358.1|2546900_2548784_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	61.3	5.2e-125
AYL01359.1|2549032_2549212_+	hypothetical protein	NA	NA	NA	NA	NA
AYL01360.1|2549875_2550166_+	hypothetical protein	NA	NA	NA	NA	NA
AYL01361.1|2550404_2550896_+	hypothetical protein	NA	NA	NA	NA	NA
AYL01362.1|2551076_2551928_+	toxin	NA	O64021	Bacillus_phage	60.3	1.4e-85
AYL01363.1|2552226_2552478_+	hypothetical protein	NA	NA	NA	NA	NA
AYL03048.1|2552661_2553096_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AYL01364.1|2554024_2555272_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
>prophage 10
CP032872	Bacillus subtilis subsp. subtilis strain 2KL1 chromosome, complete genome	4196696	2690241	2750579	4196696	holin,transposase	Bacillus_phage(66.67%)	61	NA	NA
AYL01485.1|2690241_2691366_-|transposase	IS4 family transposase IS4Bsu1	transposase	NA	NA	NA	NA
AYL01486.1|2691576_2691786_-	hypothetical protein	NA	NA	NA	NA	NA
AYL01487.1|2692111_2693563_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
AYL01488.1|2693599_2694298_-	Expansin-YoaJ	NA	NA	NA	NA	NA
AYL01489.1|2694560_2695238_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
AYL01490.1|2698229_2699411_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AYL01491.1|2699839_2699995_-	hypothetical protein	NA	NA	NA	NA	NA
AYL01492.1|2700525_2701023_-	hypothetical protein	NA	NA	NA	NA	NA
AYL01493.1|2701123_2702035_-	hypothetical protein	NA	NA	NA	NA	NA
AYL01494.1|2702378_2702861_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
AYL01495.1|2702870_2703107_+	transcriptional regulator	NA	NA	NA	NA	NA
AYL01496.1|2703229_2704024_+	DUF817 domain-containing protein	NA	NA	NA	NA	NA
AYL01497.1|2704141_2705014_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYL01498.1|2705114_2705993_+	DMT family transporter	NA	NA	NA	NA	NA
AYL01499.1|2706166_2706598_-	hypothetical protein	NA	NA	NA	NA	NA
AYL01500.1|2706862_2707495_-	glutamine amidotransferase	NA	NA	NA	NA	NA
AYL01501.1|2707750_2708671_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	43.2	1.0e-57
AYL01502.1|2709288_2710413_-|transposase	IS4 family transposase IS4Bsu1	transposase	NA	NA	NA	NA
AYL01503.1|2710527_2710908_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
AYL01504.1|2710968_2711181_-	hypothetical protein	NA	NA	NA	NA	NA
AYL01505.1|2711284_2711548_+	hypothetical protein	NA	NA	NA	NA	NA
AYL01506.1|2711846_2714447_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	34.8	3.3e-45
AYL01507.1|2715113_2715755_-	1,4-beta-xylanase	NA	NA	NA	NA	NA
AYL01508.1|2716382_2716622_-	NINE protein	NA	M4ZS56	Bacillus_phage	67.1	1.4e-19
AYL01509.1|2716792_2717131_+	XRE family transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	31.7	3.5e-08
AYL01510.1|2717180_2717924_-	hypothetical protein	NA	NA	NA	NA	NA
AYL01511.1|2718127_2718328_-	hypothetical protein	NA	NA	NA	NA	NA
AYL01512.1|2718369_2718828_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
AYL01513.1|2718864_2719098_-	3-ketosteroid-delta-1-dehydrogenase	NA	NA	NA	NA	NA
AYL01514.1|2719184_2719496_-	hypothetical protein	NA	NA	NA	NA	NA
AYL01515.1|2719512_2719644_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	93.0	2.7e-17
AYL03052.1|2719913_2721461_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AYL01516.1|2721457_2722216_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
AYL01517.1|2722366_2722618_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	96.4	1.0e-36
AYL03053.1|2722986_2724414_-	serine hydrolase	NA	NA	NA	NA	NA
AYL01518.1|2724547_2724778_+	hypothetical protein	NA	NA	NA	NA	NA
AYL01519.1|2724787_2725180_-	UPF0715 family protein	NA	O64087	Bacillus_phage	81.4	3.7e-49
AYL01520.1|2725224_2725449_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03054.1|2725483_2725837_-	hypothetical protein	NA	NA	NA	NA	NA
AYL01521.1|2726749_2726998_-	XRE family transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	86.4	2.3e-25
AYL01522.1|2727089_2727527_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03055.1|2727617_2728001_-	hypothetical protein	NA	O64087	Bacillus_phage	34.2	4.0e-08
AYL01523.1|2728593_2729148_-	hypothetical protein	NA	NA	NA	NA	NA
AYL01524.1|2730116_2731364_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYL01525.1|2732084_2732459_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	52.8	1.1e-26
AYL01526.1|2733568_2734729_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	26.0	3.2e-32
AYL01527.1|2734964_2735543_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYL01528.1|2735565_2736417_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYL01529.1|2736590_2737736_-	ThiF family adenylyltransferase	NA	A0A1V0SCZ9	Indivirus	21.1	4.3e-05
AYL01530.1|2737740_2738571_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AYL01531.1|2738582_2739815_-	MFS transporter	NA	NA	NA	NA	NA
AYL01532.1|2739898_2741140_+|transposase	IS256-like element ISBsu2 family transposase	transposase	NA	NA	NA	NA
AYL01533.1|2743346_2743706_-	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	98.3	2.2e-61
AYL01534.1|2743965_2744049_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AYL01535.1|2744337_2744871_-	N-acetyltransferase	NA	O64026	Bacillus_phage	98.9	4.0e-99
AYL01536.1|2744906_2745485_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	93.2	1.4e-100
AYL01537.1|2745540_2745999_-	SMI1/KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	84.9	1.1e-71
AYL01538.1|2746088_2746547_-	antitoxin YobK	NA	NA	NA	NA	NA
AYL01539.1|2746556_2748359_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	87.6	4.9e-221
AYL03056.1|2748457_2749015_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	95.7	7.0e-102
AYL01540.1|2749142_2750579_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	30.6	2.6e-07
>prophage 11
CP032872	Bacillus subtilis subsp. subtilis strain 2KL1 chromosome, complete genome	4196696	2967692	2973787	4196696		Staphylococcus_phage(66.67%)	8	NA	NA
AYL01779.1|2967692_2968286_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.6e-14
AYL03066.1|2968275_2969031_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
AYL01780.1|2969310_2969835_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AYL01781.1|2969848_2970223_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYL01782.1|2970335_2970800_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
AYL01783.1|2970832_2972029_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
AYL01784.1|2972043_2972691_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
AYL01785.1|2972701_2973787_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	5.1e-56
>prophage 12
CP032872	Bacillus subtilis subsp. subtilis strain 2KL1 chromosome, complete genome	4196696	3232254	3275318	4196696	holin,transposase,coat	uncultured_Caudovirales_phage(25.0%)	47	NA	NA
AYL03081.1|3232254_3233802_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AYL02061.1|3233798_3234557_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
AYL02062.1|3235149_3235236_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AYL02063.1|3237346_3237826_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02064.1|3238442_3238709_+	transcriptional regulator	NA	NA	NA	NA	NA
AYL03082.1|3238847_3239000_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	76.0	8.4e-18
AYL02065.1|3240487_3241309_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AYL02066.1|3241425_3242628_+	MFS transporter	NA	NA	NA	NA	NA
AYL02067.1|3242796_3243255_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYL02068.1|3243287_3244535_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
AYL02069.1|3244780_3246085_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AYL02070.1|3246374_3246518_-	YrzO family protein	NA	NA	NA	NA	NA
AYL02071.1|3246535_3247501_-	DMT family transporter	NA	NA	NA	NA	NA
AYL02072.1|3247626_3248493_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYL02073.1|3248612_3249650_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	26.2	4.1e-15
AYL02074.1|3249737_3250673_-	cation transporter	NA	NA	NA	NA	NA
AYL02075.1|3250862_3251987_-|transposase	IS4 family transposase IS4Bsu1	transposase	NA	NA	NA	NA
AYL02076.1|3252765_3254088_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AYL02077.1|3254252_3254585_-	branched-chain amino acid transporter AzlD	NA	NA	NA	NA	NA
AYL02078.1|3254581_3255346_-	azaleucine resistance protein AzlC	NA	NA	NA	NA	NA
AYL02079.1|3255358_3255832_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AYL02080.1|3256165_3256441_-	barnase inhibitor	NA	NA	NA	NA	NA
AYL02081.1|3257112_3257676_-	cysteine hydrolase	NA	NA	NA	NA	NA
AYL03083.1|3257903_3258275_-	DUF2568 domain-containing protein	NA	NA	NA	NA	NA
AYL02082.1|3259086_3259590_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02083.1|3259809_3260661_-	aminoglycoside 6-adenylyltransferase AadK	NA	E4ZFP8	Streptococcus_phage	58.2	9.0e-93
AYL02084.1|3261056_3262100_+	nitronate monooxygenase	NA	NA	NA	NA	NA
AYL02085.1|3262311_3262506_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02086.1|3262447_3263245_+	glutamate racemase	NA	NA	NA	NA	NA
AYL02087.1|3263625_3264333_+	hypothetical protein	NA	NA	NA	NA	NA
AYL03084.1|3264907_3264985_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
AYL02088.1|3265271_3265433_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02089.1|3265496_3266255_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
AYL02090.1|3266388_3266919_-	RNA polymerase sigma factor SigZ	NA	A0A1V0DZZ1	Clostridioides_phage	24.8	2.1e-07
AYL02091.1|3267054_3268035_+	aldo/keto reductase	NA	NA	NA	NA	NA
AYL02092.1|3268193_3269009_-	chitosanase	NA	A0A223LHY0	Streptomyces_phage	33.2	3.7e-19
AYL02093.1|3269445_3269709_+	hypothetical protein	NA	NA	NA	NA	NA
AYL02094.1|3269845_3270661_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYL02095.1|3271067_3271424_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYL02096.1|3271476_3271836_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYL02097.1|3272107_3272209_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02098.1|3272351_3272738_-	VOC family protein	NA	NA	NA	NA	NA
AYL02099.1|3273000_3273246_+|coat	spore coat protein F-like protein YraG	coat	NA	NA	NA	NA
AYL02100.1|3273263_3273632_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AYL02101.1|3273650_3274787_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.1	2.2e-14
AYL02102.1|3274805_3275003_+	hypothetical protein	NA	NA	NA	NA	NA
AYL02103.1|3275018_3275318_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 13
CP032872	Bacillus subtilis subsp. subtilis strain 2KL1 chromosome, complete genome	4196696	3366604	3422954	4196696	coat,tRNA,transposase,protease	Faustovirus(12.5%)	53	NA	NA
AYL02190.1|3366604_3367768_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
AYL02191.1|3367884_3368991_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
AYL02192.1|3368977_3369847_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
AYL02193.1|3369800_3371396_-	L-aspartate oxidase	NA	NA	NA	NA	NA
AYL02194.1|3371498_3372686_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A141ZJV0	Faustovirus	27.4	1.7e-33
AYL02195.1|3372645_3373188_+	transcription repressor NadR	NA	NA	NA	NA	NA
AYL02196.1|3373212_3374070_-	prephenate dehydratase	NA	NA	NA	NA	NA
AYL02197.1|3374086_3374530_-	ACT domain-containing protein	NA	NA	NA	NA	NA
AYL02198.1|3374590_3375877_-	GTPase ObgE	NA	NA	NA	NA	NA
AYL02199.1|3375910_3376489_-	sporulation initiation phosphotransferase B	NA	NA	NA	NA	NA
AYL02200.1|3376566_3376689_+	hypothetical protein	NA	NA	NA	NA	NA
AYL02201.1|3376809_3377094_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AYL02202.1|3377106_3377445_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
AYL02203.1|3377447_3377756_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AYL02204.1|3377902_3378769_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
AYL02205.1|3378761_3379556_-	stage IV sporulation protein FA	NA	NA	NA	NA	NA
AYL02206.1|3379705_3380512_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
AYL02207.1|3380513_3381194_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
AYL02208.1|3381246_3381765_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AYL02209.1|3381761_3382634_-	cell shape-determining protein MreC	NA	NA	NA	NA	NA
AYL02210.1|3382664_3383678_-	rod shape-determining protein	NA	NA	NA	NA	NA
AYL02211.1|3383769_3384465_-	JAB domain-containing protein	NA	NA	NA	NA	NA
AYL02212.1|3384501_3385071_-	septum formation protein Maf	NA	NA	NA	NA	NA
AYL02213.1|3385223_3386222_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
AYL02214.1|3386355_3387102_-	prepilin peptidase	NA	NA	NA	NA	NA
AYL02215.1|3387241_3388534_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AYL02216.1|3388593_3391236_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	3.7e-161
AYL02217.1|3391683_3391875_+	hypothetical protein	NA	NA	NA	NA	NA
AYL02218.1|3391893_3392919_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
AYL02219.1|3392951_3394673_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AYL02220.1|3394803_3396096_-	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AYL02221.1|3396125_3397100_-	porphobilinogen synthase	NA	NA	NA	NA	NA
AYL02222.1|3397096_3397885_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AYL02223.1|3397874_3398819_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AYL02224.1|3398851_3399682_-	protein HemX	NA	NA	NA	NA	NA
AYL02225.1|3399689_3401057_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AYL02226.1|3401286_3401784_+	hypothetical protein	NA	NA	NA	NA	NA
AYL02227.1|3401805_3402393_-	GTP-binding protein	NA	NA	NA	NA	NA
AYL02228.1|3402389_3404714_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	2.6e-182
AYL02229.1|3404894_3406553_-|protease	Lon protease 2	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
AYL02230.1|3406706_3407969_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
AYL02231.1|3408240_3409515_-	trigger factor	NA	NA	NA	NA	NA
AYL02232.1|3409742_3410747_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AYL02233.1|3410866_3411466_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AYL02234.1|3411478_3412897_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AYL02235.1|3412946_3414044_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AYL02236.1|3414064_3415621_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	38.5	1.3e-09
AYL02237.1|3415607_3416636_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AYL02238.1|3416659_3417178_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
AYL02239.1|3417174_3418899_-	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.2	2.4e-60
AYL02240.1|3419711_3420047_+	hypothetical protein	NA	NA	NA	NA	NA
AYL02241.1|3420845_3421670_+	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
AYL02242.1|3421804_3422954_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
>prophage 14
CP032872	Bacillus subtilis subsp. subtilis strain 2KL1 chromosome, complete genome	4196696	3845296	3942006	4196696	holin,integrase,terminase,coat,transposase,plate,portal,tail,head,capsid,protease	Bacillus_phage(34.78%)	116	3885988:3886009	3923268:3923289
AYL02611.1|3845296_3846316_-|coat	spore coat protein YutH	coat	NA	NA	NA	NA
AYL02612.1|3846468_3846969_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	56.0	1.2e-41
AYL02613.1|3846995_3847766_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
AYL02614.1|3847794_3848229_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AYL02615.1|3848252_3848528_-	DUF1027 domain-containing protein	NA	NA	NA	NA	NA
AYL02616.1|3848641_3849274_+	hypothetical protein	NA	NA	NA	NA	NA
AYL02617.1|3849289_3850186_-	lipoyl synthase	NA	NA	NA	NA	NA
AYL02618.1|3850420_3851401_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	37.3	3.0e-07
AYL02619.1|3851428_3852196_-	sporulation protein YunB	NA	NA	NA	NA	NA
AYL02620.1|3852268_3852574_-	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
AYL02621.1|3852638_3854027_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AYL02622.1|3854046_3854868_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AYL03107.1|3854885_3855734_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
AYL02623.1|3855771_3856119_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02624.1|3856215_3857556_-	allantoinase	NA	NA	NA	NA	NA
AYL02625.1|3857730_3859326_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
AYL02626.1|3859470_3860820_+	purine permease	NA	Q9KX94	Enterobacteria_phage	28.1	1.2e-25
AYL02627.1|3860825_3862106_+	purine permease	NA	Q9KX94	Enterobacteria_phage	30.0	7.6e-27
AYL02628.1|3862126_3863611_+	urate oxidase	NA	NA	NA	NA	NA
AYL02629.1|3863610_3863955_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AYL02630.1|3864138_3864342_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02631.1|3864376_3864508_+	YhzE/YjcZ family sporulation protein YuzJ	NA	NA	NA	NA	NA
AYL02632.1|3864713_3865235_-	xanthine dehydrogenase subunit E	NA	NA	NA	NA	NA
AYL02633.1|3865225_3867463_-	xanthine dehydrogenase subunit D	NA	NA	NA	NA	NA
AYL02634.1|3867463_3868297_-	xanthine dehydrogenase subunit C	NA	NA	NA	NA	NA
AYL02635.1|3868293_3868911_-	xanthine dehydrogenase accessory protein PucB	NA	NA	NA	NA	NA
AYL02636.1|3868907_3869900_-	XdhC family protein	NA	NA	NA	NA	NA
AYL02637.1|3870126_3871377_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
AYL02638.1|3871393_3872632_-	allantoate amidohydrolase	NA	NA	NA	NA	NA
AYL02639.1|3873077_3873944_+	ribonuclease	NA	NA	NA	NA	NA
AYL02640.1|3874122_3875226_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	29.7	5.0e-19
AYL02641.1|3875407_3876136_+	transcriptional regulator PhoB	NA	NA	NA	NA	NA
AYL02642.1|3876160_3877015_-	fructoselysine 6-kinase	NA	NA	NA	NA	NA
AYL02643.1|3877927_3878806_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AYL02644.1|3878863_3880132_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYL02645.1|3880212_3881199_-	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	23.6	1.9e-09
AYL02646.1|3881413_3881788_-	nucleotide excision repair endonuclease	NA	NA	NA	NA	NA
AYL02647.1|3881890_3883009_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AYL02648.1|3883167_3883314_+	acid-soluble spore protein SspG	NA	NA	NA	NA	NA
AYL02649.1|3883313_3883589_+	hypothetical protein	NA	NA	NA	NA	NA
AYL02650.1|3883646_3884797_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
AYL02651.1|3884942_3885326_-	VOC family protein	NA	NA	NA	NA	NA
AYL02652.1|3885435_3885714_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
3885988:3886009	attL	CCTATAGAACCTTCCATTTCGA	NA	NA	NA	NA
AYL03108.1|3886452_3886641_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	50.0	3.2e-11
AYL02653.1|3886800_3888573_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	54.7	1.6e-120
AYL02654.1|3888585_3889047_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AYL02655.1|3889097_3890039_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	77.1	3.0e-97
AYL02656.1|3890080_3890503_-|holin	holin family protein	holin	D6R405	Bacillus_phage	85.7	3.0e-57
AYL02657.1|3890556_3890727_-	XkdX family protein	NA	NA	NA	NA	NA
AYL02658.1|3890723_3891023_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	1.5e-39
AYL02659.1|3891038_3892262_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	80.3	9.1e-179
AYL02660.1|3893886_3895761_-	autolysin	NA	D6R400	Bacillus_phage	27.8	5.5e-50
AYL02661.1|3895774_3896608_-|tail	phage tail family protein	tail	M4ZS20	Bacillus_phage	34.1	3.5e-33
AYL02662.1|3896620_3900361_-	hypothetical protein	NA	A0A0S2SXL7	Bacillus_phage	60.4	9.1e-105
AYL02663.1|3900423_3900606_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02664.1|3900617_3900980_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02665.1|3901039_3901624_-|tail	major tail protein	tail	U5U3Z7	Lactobacillus_phage	36.5	9.1e-28
AYL02666.1|3901629_3902037_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02667.1|3902033_3902426_-|tail	phage tail protein	tail	A0A0M5M1E5	Enterococcus_phage	37.9	3.0e-11
AYL02668.1|3902425_3902752_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AYL02669.1|3902741_3903035_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	33.0	2.6e-07
AYL02670.1|3903089_3903473_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	56.8	1.4e-05
AYL02671.1|3903500_3904703_-|capsid	phage major capsid protein	capsid	A0A2H4J824	uncultured_Caudovirales_phage	49.8	8.3e-76
AYL02672.1|3904751_3905348_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	52.7	1.1e-47
AYL02673.1|3905340_3906567_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.8	5.3e-70
AYL02674.1|3906571_3906778_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02675.1|3906794_3908501_-|terminase	terminase large subunit	terminase	A0A2H4JC16	uncultured_Caudovirales_phage	42.8	1.9e-121
AYL02676.1|3908493_3908988_-|terminase	phage terminase small subunit P27 family	terminase	A0A1Q1PVW3	Staphylococcus_phage	36.1	9.1e-21
AYL02677.1|3909221_3909434_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02678.1|3909436_3909820_-	HNH endonuclease	NA	A0A075M5R4	Enterococcus_phage	44.2	1.1e-18
AYL02679.1|3909922_3910537_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02680.1|3910673_3911234_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02681.1|3911491_3912034_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	63.9	5.8e-61
AYL03109.1|3912030_3912483_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	1.7e-37
AYL02682.1|3913092_3913479_-	hypothetical protein	NA	A0A1P8CWX0	Bacillus_phage	36.2	3.8e-14
AYL02683.1|3913475_3913955_-	hypothetical protein	NA	F8WQ59	Bacillus_phage	53.8	1.0e-21
AYL02684.1|3913954_3914647_-	dUTPase	NA	R9TQ23	Paenibacillus_phage	43.7	6.7e-38
AYL02685.1|3914809_3915058_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	44.9	6.0e-05
AYL02686.1|3915054_3915462_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	45.0	2.9e-25
AYL02687.1|3915458_3915743_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02688.1|3915786_3915984_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02689.1|3916231_3916372_-	BH0509 family protein	NA	NA	NA	NA	NA
AYL02690.1|3916479_3917028_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	39.3	4.6e-05
AYL02691.1|3917327_3918182_-	AAA family ATPase	NA	Q4ZAS1	Staphylococcus_virus	29.4	2.2e-22
AYL02692.1|3918132_3918972_-	DNA replication protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	51.4	1.4e-66
AYL02693.1|3918964_3919195_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02694.1|3919218_3919431_-	hypothetical protein	NA	R9TQ08	Paenibacillus_phage	70.7	5.3e-18
AYL02695.1|3919488_3919773_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYL02696.1|3919876_3920272_+	XRE family transcriptional regulator	NA	I3VYZ1	Thermoanaerobacterium_phage	39.1	6.6e-06
AYL02697.1|3920503_3920698_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02698.1|3920694_3921819_-	XRE family transcriptional regulator	NA	A0A1B1P786	Bacillus_phage	24.0	2.8e-09
AYL02699.1|3922151_3923189_+|integrase	site-specific integrase	integrase	A0A223LI82	Staphylococcus_phage	47.1	1.8e-87
AYL02700.1|3923263_3924661_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
3923268:3923289	attR	CCTATAGAACCTTCCATTTCGA	NA	NA	NA	NA
AYL02701.1|3924681_3925125_-	iron-sulfur cluster assembly scaffold protein NifU	NA	A0A2P1CJL8	Mycobacterium_phage	38.7	1.9e-14
AYL02702.1|3925114_3926335_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	47.8	3.4e-117
AYL02703.1|3926334_3927648_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AYL02704.1|3927665_3928451_-	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	23.6	6.5e-05
AYL02705.1|3928484_3928682_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02706.1|3928644_3928782_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02707.1|3928975_3929353_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AYL02708.1|3929437_3930262_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYL02709.1|3930275_3930944_-	methionine import system permease MetP	NA	NA	NA	NA	NA
AYL02710.1|3930936_3931962_-	methionine import ATP-binding protein MetN	NA	G3M9Y6	Bacillus_virus	36.5	1.4e-31
AYL02711.1|3932288_3932633_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02712.1|3932739_3933060_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AYL02713.1|3933061_3933502_-	toprim domain-containing protein	NA	NA	NA	NA	NA
AYL02714.1|3933501_3933738_-	DUF2553 family protein	NA	NA	NA	NA	NA
AYL02715.1|3933793_3934177_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
AYL02716.1|3934243_3934600_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	54.6	1.8e-23
AYL02717.1|3934710_3936495_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AYL02718.1|3936512_3937688_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
AYL03110.1|3937698_3940068_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AYL02719.1|3940242_3940389_+	YuzL family protein	NA	NA	NA	NA	NA
AYL02720.1|3940413_3941322_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	42.2	3.9e-62
AYL02721.1|3941415_3941661_+	hypothetical protein	NA	NA	NA	NA	NA
AYL02722.1|3941673_3942006_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 15
CP032872	Bacillus subtilis subsp. subtilis strain 2KL1 chromosome, complete genome	4196696	4023773	4085047	4196696	holin,integrase,terminase,transposase,plate,portal,head,tail,capsid,protease	Bacillus_phage(65.91%)	71	4023668:4023727	4085094:4086654
4023668:4023727	attL	TTCAGCTTGTAGAGAAAACGACGTTTTTTCTACAAGCTTTTTTGTTTTATACAGTTTCTT	NA	NA	NA	NA
AYL02797.1|4023773_4025126_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
AYL02798.1|4025250_4027662_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.8	1.3e-120
AYL02799.1|4027745_4027955_-	copper resistance protein CopZ	NA	NA	NA	NA	NA
AYL02800.1|4028030_4028336_-	transcriptional regulator	NA	NA	NA	NA	NA
AYL02801.1|4028463_4029540_+	oxidoreductase	NA	NA	NA	NA	NA
AYL02802.1|4030371_4032267_-	FUSC family protein	NA	NA	NA	NA	NA
AYL02803.1|4032429_4032831_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02804.1|4032827_4033187_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AYL02805.1|4033183_4033756_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYL02806.1|4033866_4034661_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYL03115.1|4035170_4035359_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	53.3	1.4e-11
AYL02807.1|4035520_4037104_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	59.7	4.2e-75
AYL02808.1|4037118_4037508_+	hypothetical protein	NA	NA	NA	NA	NA
AYL03116.1|4037850_4038453_+	hypothetical protein	NA	NA	NA	NA	NA
AYL02809.1|4038492_4039434_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	77.1	3.0e-97
AYL02810.1|4039475_4039898_-|holin	holin family protein	holin	D6R405	Bacillus_phage	85.7	3.0e-57
AYL02811.1|4039951_4040122_-	XkdX family protein	NA	NA	NA	NA	NA
AYL02812.1|4040118_4040418_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	1.5e-39
AYL02813.1|4040433_4041657_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	80.3	9.1e-179
AYL02814.1|4041693_4043268_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	88.5	5.3e-264
AYL02815.1|4043304_4045011_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	81.8	9.4e-267
AYL02816.1|4045860_4049739_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	81.0	0.0e+00
AYL02817.1|4049751_4049931_-	hypothetical protein	NA	D6R3Z7	Bacillus_phage	68.5	1.6e-12
AYL02818.1|4049933_4050272_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	70.5	3.0e-39
AYL02819.1|4050326_4050938_-|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	89.7	7.9e-99
AYL02820.1|4050938_4051319_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	66.1	2.6e-39
AYL02821.1|4051315_4051699_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	86.6	2.9e-59
AYL02822.1|4051691_4052063_-|head,tail	head-tail adaptor protein	head,tail	Q9ZXF2	Bacillus_phage	68.3	3.5e-41
AYL02823.1|4051995_4052343_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	87.0	2.0e-51
AYL02824.1|4052358_4052850_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	69.1	1.3e-27
AYL02825.1|4052878_4053193_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	68.8	6.8e-30
AYL02826.1|4053208_4054411_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	71.5	3.3e-157
AYL02827.1|4054447_4055074_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	92.8	1.8e-106
AYL02828.1|4055063_4056311_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	86.5	1.3e-217
AYL02829.1|4056316_4056532_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	80.6	1.3e-24
AYL02830.1|4056544_4058254_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	92.1	0.0e+00
AYL02831.1|4058253_4058787_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
AYL03117.1|4059166_4059541_-	HNH endonuclease	NA	Q38456	Bacillus_phage	82.3	7.5e-60
AYL02832.1|4059590_4060337_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02833.1|4060867_4061497_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02834.1|4061647_4062031_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02835.1|4062683_4063226_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	63.9	5.8e-61
AYL03118.1|4063222_4063675_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	1.7e-37
AYL02836.1|4063957_4064158_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02837.1|4064154_4064574_-	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	61.2	1.6e-42
AYL02838.1|4064570_4064903_-	hypothetical protein	NA	F8WQ59	Bacillus_phage	53.3	8.3e-18
AYL02839.1|4064902_4065559_-	dUTPase	NA	R9TQ23	Paenibacillus_phage	46.0	5.8e-39
AYL02840.1|4065676_4065934_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	41.7	6.6e-07
AYL02841.1|4065930_4066338_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	45.8	1.3e-25
AYL02842.1|4066334_4066652_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02843.1|4066648_4067011_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AYL02844.1|4067053_4067251_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02845.1|4067497_4067638_-	BH0509 family protein	NA	NA	NA	NA	NA
AYL02846.1|4067745_4068294_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02847.1|4068608_4069436_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.9	3.7e-35
AYL02848.1|4069419_4070301_-	replication protein	NA	V9QKF6	Oenococcus_phage	33.1	6.8e-27
AYL02849.1|4070293_4070512_-	hypothetical protein	NA	NA	NA	NA	NA
AYL02850.1|4070536_4070728_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	59.0	1.0e-12
AYL02851.1|4070779_4070983_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYL02852.1|4071217_4071616_+	XRE family transcriptional regulator	NA	S5M5X8	Brevibacillus_phage	33.7	4.3e-05
AYL02853.1|4075044_4075515_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.4	3.2e-47
AYL02854.1|4075659_4077999_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	43.4	1.3e-88
AYL02855.1|4078017_4078758_-	carboxylesterase	NA	NA	NA	NA	NA
AYL02856.1|4078889_4079120_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AYL02857.1|4079268_4080042_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYL02858.1|4080075_4080309_-	transcriptional regulator	NA	NA	NA	NA	NA
AYL02859.1|4080460_4080868_+	transcriptional regulator	NA	S6C481	Thermus_phage	64.8	1.9e-16
AYL02860.1|4080897_4081317_+	XRE family transcriptional regulator	NA	S6C481	Thermus_phage	62.7	5.4e-14
AYL02861.1|4081408_4081735_+	HxlR family transcriptional regulator	NA	NA	NA	NA	NA
AYL02862.1|4081862_4083563_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	8.0e-24
AYL02863.1|4083694_4085047_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
4085094:4086654	attR	AAGAAACTGTATAAAACAAAAAAGCTTGTAGAAAAAACGTCGTTTTCTCTACAAGCTGAAGAGGCTGGACTCCAGCCTCTTTTTTCTATTCTATGCAGCTGATTGAACGTGTTTCGCCCCGGTTCTTTTTTTCTTCACCGGACTTAATATCCGCTCCAGCCAGGCCATGAGTAAATCCGCCCCTACCGCCATTACCGCAGTCGGGATCGCTCCGGCTAGAATAATCGCAGTTCCGTTTGTCGCGTTTGAGCCGCGGACGATCATGTCCCCAAGGCCTCCGGCACCGACAAATGTGCCGATCGCTGTAATTCCAATGGCAATGACGAGAGCCGTGCGAAGGCCCGCCATCATGACAGAAAGTGCGAGCGGGAGCTCAACCATTCTGAGCACTTGGAATTTCGTCATGCCCATTGCTTTACCCGATTCTAAGTAGGTATGTTCAATACTGATAATGCCTGTGTACGTGTTTCGAATAATCGGCAGCAGGGAATACAGAAATAATGATAGAATCACGGTATTTGCGCCGAGCCCCATAACAAGCATTAAGACGGCCAGCATAGCGAGCGCCGGGATTGTTTGAATAACGTTTGTCACGGCAAACACCCAGGCTGACAAACGGCGAAAATGCGCGATGAGGATTCCGACCGGAACCCCGACGACAGCGGCAAACAATACGCCGTAAGCCGACATGAGAAAGTGGCGGCCGAATTCATCCATGACGTAACTGCCATTCTGCGCGTAATACGTCATTAACTGTTCAAGCACGTTCATTGACCTCTTCCCCCTTTCACGATTCGAAATAGCGATGTTTTTCTAAATATTCCTTGGCAACGACAGACGGTTCTTTGAGATTGCCGTCGACTTCATAGTTAAGCTCCTGCATCGTGGCTGTGTCGATTTTTCCGAGCATTTTCTTGATGATGCCTTCAAGTTCAGGATGTTCTTTGAGCACCTTTTCCGGAACAACCGGAGAGCAATCGTACGGCGGGAAAAATTGTTTGTCATCCTTTAGCATTTTGAGACCATAGGACTTGATTCTTCCATCGGTTGAATACGCAAGCACAATGTCCATTTTTCCGCTTTTCACCGCGTCGTACACAAGGCCGATCTGCATCGGATACGTGCCGCCGAATGTCATGCCGTAGGTTTTCGTAAAATCCTGATAGCCGTTTCCTTTGAGCTTCATCCAATAGTTATCAACGCCCAGCTTTAATTGCGGGGCCCATTTTTTAACGTCTGATACGGTCTCTAAATGGTATTGGTCGGCCAGCTCCCTGCTGACTGTAAAGGCATATGTATTATCAAACCCGTAGGAGTCATACCACTTTAAATCATATCTTTTTTTAAACTCCCGCTGAGTAAGCGCCAGCGCTTTGTCCGGGTCTTTTTCCGGTTGCATTCTCAGCGTGCCTGTCAGCGCGTCTCCCGTATATCTTGTGGCCGCAATGTCGATTTCATCATTCATTAAAGCCTGCTGCTGCACCGCGTTGGAGCCAAGATTTTTAATCGTTGTTGTTTTGAGATCAGTATGATGTTCGATCAACTGGCCAAGCATGCTGGC	NA	NA	NA	NA
>prophage 1
CP032873	Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed1, complete sequence	143751	0	703	143751	transposase	Helicobacter_phage(100.0%)	1	NA	NA
AYL03124.1|280_703_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	46.0	3.1e-25
>prophage 2
CP032873	Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed1, complete sequence	143751	11557	12178	143751		Planktothrix_phage(100.0%)	1	NA	NA
AYL03134.1|11557_12178_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	3.8e-24
>prophage 3
CP032873	Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed1, complete sequence	143751	19475	20636	143751		Bacillus_phage(100.0%)	1	NA	NA
AYL03274.1|19475_20636_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	38.9	7.5e-74
>prophage 4
CP032873	Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed1, complete sequence	143751	41051	42299	143751	transposase	uncultured_virus(100.0%)	1	NA	NA
AYL03161.1|41051_42299_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A218MNI5	uncultured_virus	39.3	4.0e-33
>prophage 5
CP032873	Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed1, complete sequence	143751	47869	48154	143751		Paenibacillus_phage(100.0%)	1	NA	NA
AYL03170.1|47869_48154_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	53.8	1.3e-11
>prophage 6
CP032873	Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed1, complete sequence	143751	51896	56486	143751		Bacillus_phage(50.0%)	3	NA	NA
AYL03175.1|51896_55292_-	hypothetical protein	NA	A0A140HLN9	Bacillus_phage	25.6	2.6e-05
AYL03176.1|55501_56002_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03177.1|56063_56486_-	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	39.3	1.1e-11
>prophage 7
CP032873	Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed1, complete sequence	143751	66139	79249	143751	transposase	Bacillus_phage(50.0%)	17	NA	NA
AYL03187.1|66139_67387_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A218MNI5	uncultured_virus	38.8	9.0e-33
AYL03188.1|67521_67818_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03189.1|67945_68368_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03190.1|69052_69277_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03191.1|69437_69698_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03192.1|69851_70313_-	sporulation protein	NA	F8WPS9	Bacillus_phage	49.3	6.3e-32
AYL03193.1|70745_71798_-|transposase	transposase	transposase	A0A0A8WI33	Clostridium_phage	32.1	2.1e-19
AYL03194.1|72427_72706_-	hypothetical protein	NA	A0A1P8CWV2	Bacillus_phage	52.3	1.4e-18
AYL03195.1|72905_73166_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03196.1|73478_74609_-	aspartate phosphatase	NA	A0A1P8CWN8	Bacillus_phage	38.9	3.3e-66
AYL03197.1|74769_75162_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03198.1|75396_75846_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AYL03199.1|76257_76593_+	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	58.2	9.2e-25
AYL03200.1|76630_77248_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03275.1|77785_78094_+	YolD-like family protein	NA	A0A2H4JAP8	uncultured_Caudovirales_phage	39.6	1.1e-13
AYL03201.1|78361_78547_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03202.1|78910_79249_+	hypothetical protein	NA	A0A2K9VCG2	Lactobacillus_phage	33.0	8.4e-10
>prophage 8
CP032873	Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed1, complete sequence	143751	99329	103611	143751	transposase	Clostridium_phage(33.33%)	4	NA	NA
AYL03223.1|99329_100406_+|transposase	transposase	transposase	A0A0A8WI33	Clostridium_phage	32.1	2.2e-19
AYL03224.1|100772_101279_+	hypothetical protein	NA	A0A1Z1LZN4	Bacillus_phage	36.2	2.6e-07
AYL03225.1|101527_101737_-	hypothetical protein	NA	NA	NA	NA	NA
AYL03226.1|102258_103611_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
>prophage 9
CP032873	Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed1, complete sequence	143751	117550	118270	143751		Bacillus_phage(100.0%)	1	NA	NA
AYL03243.1|117550_118270_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1B1P7V3	Bacillus_phage	25.7	5.8e-08
>prophage 10
CP032873	Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed1, complete sequence	143751	122253	123606	143751		Burkholderia_phage(100.0%)	1	NA	NA
AYL03250.1|122253_123606_+	RepB family plasmid replication initiator protein	NA	E5FFJ0	Burkholderia_phage	27.3	1.8e-10
>prophage 11
CP032873	Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed1, complete sequence	143751	131039	131756	143751		Bacillus_phage(100.0%)	1	NA	NA
AYL03260.1|131039_131756_-	hypothetical protein	NA	A0A172JI11	Bacillus_phage	56.4	5.5e-75
>prophage 12
CP032873	Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed1, complete sequence	143751	134908	135679	143751		Bacillus_phage(100.0%)	1	NA	NA
AYL03265.1|134908_135679_+	hypothetical protein	NA	O64016	Bacillus_phage	49.6	3.4e-30
>prophage 13
CP032873	Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed1, complete sequence	143751	139136	142759	143751	transposase	Helicobacter_phage(50.0%)	3	NA	NA
AYL03270.1|139136_139559_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	46.0	2.3e-25
AYL03271.1|139624_141016_+|transposase	transposase	transposase	NA	NA	NA	NA
AYL03272.1|141628_142759_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	71.9	8.4e-155
