The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024673	Citrobacter freundii strain UMH19 chromosome, complete genome	4996291	332965	379504	4996291	holin,transposase,integrase,capsid	Escherichia_phage(18.18%)	46	330098:330135	375052:375089
330098:330135	attL	CGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATT	NA	NA	NA	NA
AYL69514.1|332965_333946_+|transposase	IS5/IS1182 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	9.8e-184
AYL73741.1|333984_334104_-	ABC transporter	NA	NA	NA	NA	NA
AYL69515.1|334305_336309_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	2.6e-21
AYL69516.1|336373_337651_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AYL69517.1|337926_338277_+	morphinone reductase	NA	NA	NA	NA	NA
AYL69518.1|339375_339816_-	hypothetical protein	NA	NA	NA	NA	NA
AYL69519.1|339805_340051_-	hypothetical protein	NA	NA	NA	NA	NA
AYL69520.1|340091_340793_-	transcriptional regulator	NA	NA	NA	NA	NA
AYL69521.1|341009_341831_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.3	1.8e-45
AYL69522.1|341922_342786_-	hypothetical protein	NA	NA	NA	NA	NA
AYL69523.1|343227_344133_+	WYL domain-containing protein	NA	NA	NA	NA	NA
AYL69524.1|345277_345646_+	hypothetical protein	NA	Q716C1	Shigella_phage	98.9	1.9e-39
AYL69525.1|345602_346754_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	8.9e-43
AYL69526.1|347121_347553_-	hypothetical protein	NA	NA	NA	NA	NA
AYL69527.1|347846_349370_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.0	2.1e-44
AYL69528.1|349803_350808_-	transcriptional regulator	NA	NA	NA	NA	NA
AYL69529.1|350837_352238_-	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	26.1	2.0e-20
AYL69530.1|352237_353608_-	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
AYL69531.1|353745_355263_-	porin	NA	NA	NA	NA	NA
AYL69532.1|355428_356352_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AYL69533.1|356580_356751_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYL69534.1|356750_356933_-	hypothetical protein	NA	NA	NA	NA	NA
AYL69535.1|357260_357569_+	maltose acetyltransferase	NA	NA	NA	NA	NA
AYL69536.1|357597_358254_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	82.1	6.2e-09
AYL69537.1|358309_358930_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AYL69538.1|359132_359309_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYL69539.1|359391_360156_-	hypothetical protein	NA	NA	NA	NA	NA
AYL69540.1|360290_360512_-	DNA-binding protein	NA	NA	NA	NA	NA
AYL69541.1|360508_360823_-	hypothetical protein	NA	NA	NA	NA	NA
AYL69542.1|361080_362388_-	preprotein translocase	NA	A0A221SAN4	Ralstonia_phage	29.1	3.1e-07
AYL69543.1|363202_363595_+	hypothetical protein	NA	NA	NA	NA	NA
AYL69544.1|365728_366157_+	hypothetical protein	NA	NA	NA	NA	NA
AYL69545.1|366287_366470_+	hypothetical protein	NA	NA	NA	NA	NA
AYL69546.1|366450_367512_+	hypothetical protein	NA	NA	NA	NA	NA
AYL69547.1|367527_368013_+	hypothetical protein	NA	NA	NA	NA	NA
AYL69548.1|368275_368671_+	hypothetical protein	NA	NA	NA	NA	NA
AYL69549.1|368719_370882_+	chemotaxis protein	NA	A0A076G6U4	Escherichia_phage	73.8	2.3e-07
AYL69550.1|371449_371791_+	hypothetical protein	NA	NA	NA	NA	NA
AYL69551.1|371806_372841_+|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYL69552.1|372973_373183_+	hypothetical protein	NA	NA	NA	NA	NA
AYL73742.1|373412_373613_+	glycogen synthesis protein GlgS	NA	NA	NA	NA	NA
AYL69553.1|373733_374936_-|integrase	integrase	integrase	NA	NA	NA	NA
AYL69554.1|376544_377369_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	39.1	2.0e-44
375052:375089	attR	CGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATT	NA	NA	NA	NA
AYL73743.1|377556_377901_+	hypothetical protein	NA	NA	NA	NA	NA
AYL69555.1|377963_378242_+	hypothetical protein	NA	NA	NA	NA	NA
AYL69556.1|378472_379504_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP024673	Citrobacter freundii strain UMH19 chromosome, complete genome	4996291	933191	980669	4996291	plate,terminase,tail,transposase,portal,integrase	Salmonella_phage(70.37%)	56	948410:948426	974707:974723
AYL70055.1|933191_934121_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	49.8	3.2e-67
AYL70056.1|934169_934919_-	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SCZ9	Indivirus	29.3	1.8e-12
AYL70057.1|934918_936154_-	molybdopterin molybdotransferase	NA	NA	NA	NA	NA
AYL70058.1|936329_936692_+	aminoglycoside resistance protein	NA	NA	NA	NA	NA
AYL70059.1|936883_937849_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
AYL70060.1|937835_939707_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	27.2	3.7e-14
AYL70061.1|939735_941274_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
AYL70062.1|941320_942241_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
AYL70063.1|942243_943155_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
AYL70064.1|943212_944538_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AYL70065.1|944767_945151_+	transcriptional regulator	NA	NA	NA	NA	NA
AYL70066.1|945253_946351_+	oxidoreductase	NA	NA	NA	NA	NA
AYL70067.1|946356_946983_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AYL73764.1|947311_948514_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	5.0e-97
948410:948426	attL	CCGTTGATGGTGATGGA	NA	NA	NA	NA
AYL70068.1|948559_949318_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	28.8	3.9e-15
AYL73765.1|949382_949991_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AYL70069.1|950289_951522_+	multidrug transporter MdfA	NA	NA	NA	NA	NA
AYL70070.1|951549_951831_-	hypothetical protein	NA	NA	NA	NA	NA
AYL70071.1|951938_952754_-	HAD family hydrolase	NA	NA	NA	NA	NA
AYL70072.1|952753_953962_-	MFS transporter	NA	NA	NA	NA	NA
AYL70073.1|954047_954596_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYL70074.1|954601_955516_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYL70075.1|955618_956533_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AYL70076.1|956545_957343_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AYL70077.1|957498_958710_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	89.4	2.8e-188
AYL70078.1|958876_959089_+	hypothetical protein	NA	NA	NA	NA	NA
AYL70079.1|959155_960208_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	4.7e-107
AYL70080.1|960280_962269_-	hypothetical protein	NA	NA	NA	NA	NA
AYL70081.1|962291_962882_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	39.8	6.8e-39
AYL70082.1|962977_963199_+	regulator	NA	NA	NA	NA	NA
AYL70083.1|963231_963735_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	82.2	1.4e-69
AYL70084.1|963747_963978_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	89.3	8.2e-25
AYL70085.1|964125_964374_-	hypothetical protein	NA	NA	NA	NA	NA
AYL70086.1|964453_964795_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	85.8	1.2e-48
AYL70087.1|964862_965099_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	59.7	2.7e-15
AYL70088.1|965098_965326_+	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	89.3	4.7e-33
AYL70089.1|965322_965733_+	DUF3850 domain-containing protein	NA	A0A1S6KVH3	Escherichia_phage	48.6	2.4e-11
AYL70090.1|965707_968080_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	92.3	0.0e+00
AYL70091.1|968194_968380_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	49.2	7.3e-08
AYL70092.1|968454_968658_+	hypothetical protein	NA	NA	NA	NA	NA
AYL70093.1|968725_969967_+	hypothetical protein	NA	NA	NA	NA	NA
AYL70094.1|969966_971055_+	hypothetical protein	NA	NA	NA	NA	NA
AYL70095.1|971099_972128_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	92.9	3.5e-176
AYL70096.1|972127_972970_-|terminase	terminase-like protein	terminase	E5G6M4	Salmonella_phage	99.6	1.1e-151
AYL70097.1|972912_973350_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	78.6	7.0e-57
AYL70098.1|973363_973807_-	hypothetical protein	NA	NA	NA	NA	NA
AYL70099.1|973891_974470_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	95.8	2.6e-104
AYL70100.1|974466_974826_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	95.0	2.0e-57
974707:974723	attR	TCCATCACCATCAACGG	NA	NA	NA	NA
AYL70101.1|975784_976243_+|tail	phage tail protein	tail	U5P083	Shigella_phage	34.3	2.9e-13
AYL70102.1|976507_977539_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AYL70103.1|977544_978306_-	hypothetical protein	NA	NA	NA	NA	NA
AYL70104.1|978628_978826_+	Hin recombinase	NA	A0A1S6L009	Salmonella_phage	85.1	2.7e-16
AYL70105.1|978909_979653_+	hypothetical protein	NA	A0A1S6KZY7	Salmonella_phage	59.0	1.7e-108
AYL70106.1|979662_980178_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	96.5	7.4e-90
AYL70107.1|980232_980535_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	97.0	6.1e-44
AYL70108.1|980549_980669_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	6.7e-15
>prophage 3
CP024673	Citrobacter freundii strain UMH19 chromosome, complete genome	4996291	1055860	1088836	4996291	tail,integrase,tRNA	Escherichia_phage(27.03%)	45	1042242:1042256	1061224:1061238
1042242:1042256	attL	GCCATTCTGATGGCG	NA	NA	NA	NA
AYL70165.1|1055860_1057261_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	5.0e-80
AYL70166.1|1057428_1058631_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AYL70167.1|1058825_1060118_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	93.7	2.2e-239
AYL70168.1|1060162_1060411_-	excisionase	NA	S4TND0	Salmonella_phage	85.0	1.5e-35
AYL70169.1|1060418_1060565_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	79.2	1.0e-17
AYL70170.1|1060564_1060876_-	hypothetical protein	NA	NA	NA	NA	NA
AYL70171.1|1060875_1061337_-	ATPase	NA	A0A1B5FPC7	Escherichia_phage	53.1	9.3e-44
1061224:1061238	attR	CGCCATCAGAATGGC	NA	NA	NA	NA
AYL70172.1|1061333_1061558_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	44.4	3.6e-09
AYL70173.1|1061557_1062151_-	hypothetical protein	NA	A0A2I7QNC9	Vibrio_phage	28.5	3.1e-07
AYL70174.1|1062161_1062740_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	59.4	3.3e-62
AYL70175.1|1062736_1063144_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	47.8	2.5e-24
AYL70176.1|1063333_1063585_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	71.4	1.9e-27
AYL73766.1|1063584_1063941_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	50.4	7.7e-22
AYL70177.1|1064059_1064329_-	hypothetical protein	NA	NA	NA	NA	NA
AYL70178.1|1064390_1064816_-	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	50.0	2.4e-06
AYL70179.1|1064812_1065004_-	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	63.0	3.3e-11
AYL70180.1|1065004_1065217_-	hypothetical protein	NA	NA	NA	NA	NA
AYL70181.1|1065409_1066099_-	XRE family transcriptional regulator	NA	K7PK07	Enterobacteria_phage	64.8	2.7e-71
AYL70182.1|1066209_1066437_+	transcriptional regulator	NA	NA	NA	NA	NA
AYL70183.1|1066438_1066918_+	hypothetical protein	NA	NA	NA	NA	NA
AYL70184.1|1067008_1067920_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	70.9	8.1e-108
AYL70185.1|1067934_1068816_+	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	62.4	8.2e-81
AYL70186.1|1068812_1070171_+	helicase	NA	Q8W640	Enterobacteria_phage	69.6	3.2e-177
AYL70187.1|1070181_1070997_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	73.8	3.1e-114
AYL70188.1|1071217_1071622_+	hypothetical protein	NA	NA	NA	NA	NA
AYL70189.1|1072139_1072409_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	92.1	3.9e-34
AYL70190.1|1072365_1072560_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	90.7	9.1e-17
AYL70191.1|1072697_1072880_+	hypothetical protein	NA	NA	NA	NA	NA
AYL70192.1|1073100_1073562_+	hypothetical protein	NA	K7PH02	Enterobacteria_phage	65.8	4.2e-44
AYL70193.1|1073577_1075035_+	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	91.5	6.4e-272
AYL70194.1|1075016_1075607_+	hypothetical protein	NA	F1C588	Cronobacter_phage	89.8	1.1e-102
AYL70195.1|1075603_1075945_+	HNH endonuclease	NA	K7PM05	Enterobacterial_phage	97.3	2.3e-63
AYL70196.1|1076093_1076432_+|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	99.1	1.9e-62
AYL70197.1|1076428_1077187_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	98.8	5.7e-147
AYL70198.1|1077188_1077899_+	peptidase P60	NA	K7PGV2	Enterobacterial_phage	97.0	1.1e-144
AYL70199.1|1077928_1078276_+	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	32.4	3.4e-06
AYL70200.1|1078282_1078618_+	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	47.7	1.2e-21
AYL70201.1|1078673_1079273_+|tail	phage tail protein	tail	K7PM97	Enterobacterial_phage	77.9	1.8e-79
AYL70202.1|1082025_1082343_+	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	54.0	1.1e-22
AYL70203.1|1082343_1083018_+	hypothetical protein	NA	O64337	Escherichia_phage	52.0	3.8e-54
AYL70204.1|1083126_1083366_+	cor protein	NA	K7PLZ0	Enterobacterial_phage	57.1	7.0e-19
AYL70205.1|1083424_1084573_+	hypothetical protein	NA	Q5G8V6	Enterobacteria_phage	74.7	2.0e-156
AYL70206.1|1084718_1084958_-	virulence protein MsgA	NA	K7PKM2	Enterobacterial_phage	92.4	2.6e-34
AYL70207.1|1085384_1087997_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.4	2.7e-18
AYL70208.1|1088068_1088836_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.1	1.7e-29
>prophage 4
CP024673	Citrobacter freundii strain UMH19 chromosome, complete genome	4996291	1311707	1318657	4996291		uncultured_Caudovirales_phage(50.0%)	9	NA	NA
AYL70413.1|1311707_1312958_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	94.4	9.4e-22
AYL70414.1|1313092_1313602_-	DedA family protein	NA	NA	NA	NA	NA
AYL70415.1|1313776_1314019_-	DNA-damage-inducible protein I	NA	Q6UAW0	Klebsiella_phage	76.6	3.4e-29
AYL70416.1|1314097_1314331_+	DNA polymerase V	NA	A0A222YZE2	Escherichia_phage	83.3	1.0e-22
AYL70417.1|1314407_1315106_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	67.7	3.8e-89
AYL73778.1|1315191_1315512_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	2.5e-19
AYL70418.1|1315555_1316845_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.2	2.7e-165
AYL70419.1|1316857_1317283_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
AYL73779.1|1318171_1318657_+	hypothetical protein	NA	A0A1B0VBR9	Salmonella_phage	34.9	2.3e-08
>prophage 5
CP024673	Citrobacter freundii strain UMH19 chromosome, complete genome	4996291	1414692	1430903	4996291	tRNA	Escherichia_phage(15.38%)	18	NA	NA
AYL70505.1|1414692_1415145_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	55.8	1.2e-27
AYL70506.1|1415269_1415437_+	Arc family DNA binding domain-containing protein	NA	G9L6D7	Escherichia_phage	70.9	2.5e-15
AYL70507.1|1415423_1416095_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	45.5	2.7e-31
AYL70508.1|1416154_1416934_+	phage antirepressor Ant	NA	H6WRU9	Salmonella_phage	63.5	4.3e-73
AYL70509.1|1417315_1419244_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	4.4e-127
AYL70510.1|1419247_1419790_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
AYL70511.1|1419886_1420084_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AYL70512.1|1420139_1420496_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AYL70513.1|1420865_1421849_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AYL70514.1|1421864_1424252_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYL70515.1|1424256_1424556_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AYL70516.1|1424709_1425690_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	1.5e-14
AYL70517.1|1425750_1426302_+	glutathione peroxidase	NA	NA	NA	NA	NA
AYL70518.1|1426301_1427051_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
AYL70519.1|1427128_1427593_+	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
AYL70520.1|1427909_1428623_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYL70521.1|1428684_1430127_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	7.7e-52
AYL70522.1|1430123_1430903_-	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.4	6.7e-10
>prophage 6
CP024673	Citrobacter freundii strain UMH19 chromosome, complete genome	4996291	2052609	2143289	4996291	protease,capsid,holin,terminase,head,tRNA,tail,portal,integrase	Enterobacteria_phage(40.62%)	109	2061738:2061752	2139555:2139569
AYL71080.1|2052609_2053491_-|protease	protease HtpX	protease	NA	NA	NA	NA
AYL71081.1|2053683_2055732_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	1.2e-87
AYL71082.1|2055751_2056438_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYL71083.1|2056534_2057032_-	Free methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AYL71084.1|2057160_2058444_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYL71085.1|2058412_2061046_+	MCE family protein	NA	NA	NA	NA	NA
AYL71086.1|2061125_2062547_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
2061738:2061752	attL	GCGCTAAAAAACTGG	NA	NA	NA	NA
AYL71087.1|2062644_2062884_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AYL71088.1|2062986_2063178_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AYL71089.1|2063178_2063820_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	5.1e-56
AYL71090.1|2064232_2064571_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AYL71091.1|2064591_2065464_-	hypothetical protein	NA	NA	NA	NA	NA
AYL71092.1|2065467_2065842_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AYL71093.1|2065985_2066216_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
AYL71094.1|2066322_2066979_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AYL71095.1|2067002_2067665_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	30.6	4.1e-08
AYL71096.1|2067655_2069734_-	oligopeptidase B	NA	NA	NA	NA	NA
AYL71097.1|2069796_2070456_-	DUF533 domain-containing protein	NA	NA	NA	NA	NA
AYL71098.1|2070550_2070904_-	hypothetical protein	NA	NA	NA	NA	NA
AYL71099.1|2071025_2071316_-	damage-inducible protein YebG	NA	NA	NA	NA	NA
AYL71100.1|2071447_2072626_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AYL71101.1|2072694_2073336_-	keto-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
AYL71102.1|2073370_2075182_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AYL71103.1|2075415_2076891_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	8.3e-78
AYL73818.1|2076863_2077043_+	hypothetical protein	NA	NA	NA	NA	NA
AYL73819.1|2077258_2078128_+	transcriptional regulator HexR	NA	NA	NA	NA	NA
AYL71104.1|2078246_2079689_+	pyruvate kinase	NA	NA	NA	NA	NA
AYL71105.1|2079732_2080704_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AYL71106.1|2080823_2082143_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
AYL71107.1|2082158_2083118_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYL71108.1|2083181_2083937_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.4e-17
AYL71109.1|2083933_2084719_+	zinc ABC transporter permease	NA	NA	NA	NA	NA
AYL71110.1|2084797_2085808_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.6e-08
AYL71111.1|2085816_2086428_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AYL71112.1|2086508_2087030_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
AYL71113.1|2087064_2087808_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYL71114.1|2087836_2088280_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AYL71115.1|2088281_2090054_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AYL71116.1|2090342_2090909_+	hydrolase	NA	NA	NA	NA	NA
AYL73820.1|2090990_2091107_-	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
AYL71117.1|2091241_2091913_+	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	9.0e-80
AYL71118.1|2091905_2093174_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	81.0	8.4e-204
AYL71119.1|2093175_2093595_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	54.3	5.2e-33
AYL71120.1|2093672_2093915_+	DNA-damage-inducible protein I	NA	Q6UAW0	Klebsiella_phage	76.6	2.6e-29
AYL71121.1|2094060_2095209_-	hypothetical protein	NA	Q5G8V6	Enterobacteria_phage	75.0	4.5e-156
AYL71122.1|2095267_2095507_-	cor protein	NA	K7PLZ0	Enterobacterial_phage	57.1	7.0e-19
AYL71123.1|2095615_2096290_-	hypothetical protein	NA	O64337	Escherichia_phage	52.4	2.9e-54
AYL71124.1|2096290_2096605_-	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	57.7	5.4e-27
AYL71125.1|2096604_2099790_-	host specificity protein	NA	O64335	Escherichia_phage	87.7	0.0e+00
AYL71126.1|2099845_2100427_-|tail	phage tail protein	tail	K7PHE5	Enterobacteria_phage	76.7	1.2e-75
AYL73821.1|2100489_2100690_-	hypothetical protein	NA	NA	NA	NA	NA
AYL71127.1|2101002_2101719_-	peptidase P60	NA	K7PJV6	Enterobacteria_phage	90.3	2.3e-134
AYL71128.1|2101720_2102476_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	86.1	3.7e-130
AYL71129.1|2102472_2102820_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	70.4	1.4e-39
AYL71130.1|2102823_2105340_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	68.4	7.3e-308
AYL71131.1|2105317_2105638_-|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	69.8	2.7e-34
AYL71132.1|2105646_2106054_-|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	59.3	2.3e-25
AYL71133.1|2106090_2106828_-|tail	phage tail protein	tail	O64327	Escherichia_phage	60.0	5.4e-78
AYL71134.1|2106835_2107234_-|tail	phage tail protein	tail	K7P7G5	Enterobacteria_phage	81.8	2.8e-60
AYL71135.1|2107230_2107785_-|tail	phage tail protein	tail	K7PKQ5	Enterobacteria_phage	91.4	1.6e-74
AYL71136.1|2107794_2108148_-|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	74.4	5.8e-46
AYL71137.1|2108159_2108564_-	DNA-packaging protein	NA	K7P7M3	Enterobacteria_phage	53.5	1.2e-23
AYL71138.1|2108609_2109635_-|capsid	minor capsid protein E	capsid	K7PGW9	Enterobacteria_phage	92.7	4.3e-182
AYL71139.1|2109702_2110035_-|head	head decoration protein	head	E4WL24	Enterobacteria_phage	82.7	5.0e-47
AYL71140.1|2110044_2111382_-|capsid	capsid assembly protein	capsid	O64320	Escherichia_phage	84.1	2.8e-189
AYL71141.1|2111362_2112955_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	92.1	9.7e-290
AYL71142.1|2112951_2113158_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	95.5	3.2e-28
AYL71143.1|2113157_2115080_-|terminase	terminase	terminase	E4WL19	Enterobacteria_phage	97.8	0.0e+00
AYL71144.1|2115054_2115600_-|terminase	terminase small subunit	terminase	E4WL18	Enterobacteria_phage	100.0	1.2e-95
AYL71145.1|2115852_2116512_-	hypothetical protein	NA	NA	NA	NA	NA
AYL71146.1|2116656_2116860_-	hypothetical protein	NA	NA	NA	NA	NA
AYL71147.1|2116921_2117455_-	hypothetical protein	NA	NA	NA	NA	NA
AYL71148.1|2117495_2118023_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	33.9	4.2e-08
AYL71149.1|2118019_2118568_-	lysozyme	NA	K7PM52	Enterobacteria_phage	94.0	4.1e-99
AYL71150.1|2118539_2118818_-|holin	holin	holin	K7PGZ9	Enterobacteria_phage	95.7	4.3e-44
AYL71151.1|2118963_2120016_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	80.7	1.0e-170
AYL71152.1|2120166_2120358_-	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	85.7	1.3e-23
AYL71153.1|2120628_2121510_+	hypothetical protein	NA	NA	NA	NA	NA
AYL71154.1|2121525_2121783_+	hypothetical protein	NA	NA	NA	NA	NA
AYL71155.1|2121779_2122178_+	hypothetical protein	NA	NA	NA	NA	NA
AYL71156.1|2123582_2124266_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	60.0	3.0e-62
AYL71157.1|2124279_2124666_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	89.1	4.1e-61
AYL71158.1|2124662_2125982_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	52.5	5.1e-119
AYL71159.1|2125978_2126836_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	97.4	4.1e-61
AYL71160.1|2126825_2127005_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	2.3e-14
AYL71161.1|2127177_2127729_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	67.8	1.4e-65
AYL71162.1|2127757_2128000_-	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	67.1	1.1e-19
AYL71163.1|2128099_2128810_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	67.0	1.5e-77
AYL71164.1|2128884_2129091_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	4.3e-17
AYL71165.1|2129478_2129679_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	70.6	4.8e-05
AYL71166.1|2129962_2130142_-	hypothetical protein	NA	A5LH65	Enterobacteria_phage	61.9	1.5e-05
AYL71167.1|2130140_2130512_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	92.7	1.1e-58
AYL71168.1|2130568_2131396_+	hypothetical protein	NA	Q8HAA2	Salmonella_phage	90.5	2.5e-140
AYL71169.1|2131524_2132064_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	79.9	1.6e-79
AYL71170.1|2132224_2132479_+	hypothetical protein	NA	NA	NA	NA	NA
AYL71171.1|2132475_2132970_+	hypothetical protein	NA	NA	NA	NA	NA
AYL71172.1|2132966_2133365_+	hypothetical protein	NA	A0A0M4R357	Salmonella_phage	47.4	7.9e-07
AYL71173.1|2133366_2133789_+	HNH endonuclease	NA	C6ZR29	Salmonella_phage	81.4	1.5e-61
AYL73822.1|2134590_2135163_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	81.6	3.0e-92
AYL71174.1|2135200_2135437_+	excisionase	NA	Q8W657	Enterobacteria_phage	92.3	2.1e-39
AYL71175.1|2135495_2136809_+|integrase	integrase	integrase	Q8W658	Enterobacteria_phage	90.4	1.3e-236
AYL71176.1|2136796_2137561_+	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	78.0	1.5e-54
AYL71177.1|2137613_2138009_+	hypothetical protein	NA	NA	NA	NA	NA
AYL71178.1|2138049_2138793_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	31.3	3.2e-25
AYL71179.1|2138789_2139758_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
2139555:2139569	attR	GCGCTAAAAAACTGG	NA	NA	NA	NA
AYL71180.1|2139778_2139967_-	hypothetical protein	NA	NA	NA	NA	NA
AYL71181.1|2140001_2140748_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AYL71182.1|2140750_2141317_-	VOC family protein	NA	NA	NA	NA	NA
AYL71183.1|2141555_2143289_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.4	2.2e-85
>prophage 7
CP024673	Citrobacter freundii strain UMH19 chromosome, complete genome	4996291	2308279	2314573	4996291		Enterobacteria_phage(66.67%)	6	NA	NA
AYL71354.1|2308279_2308828_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.0	3.2e-51
AYL71355.1|2308831_2309710_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.4	2.3e-107
AYL71356.1|2309761_2310661_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	35.3	6.1e-31
AYL71357.1|2310660_2311746_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	3.3e-100
AYL71358.1|2312119_2313013_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.1	2.5e-45
AYL71359.1|2313178_2314573_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	34.9	8.0e-22
>prophage 8
CP024673	Citrobacter freundii strain UMH19 chromosome, complete genome	4996291	2356424	2366002	4996291	protease	Bacillus_phage(28.57%)	8	NA	NA
AYL71389.1|2356424_2357828_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	29.2	5.0e-32
AYL71390.1|2357824_2358547_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
AYL71391.1|2358682_2359015_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AYL71392.1|2359174_2360536_+	U32 family peptidase	NA	Q6DW11	Phage_TP	92.6	6.9e-204
AYL71393.1|2360805_2363082_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
AYL71394.1|2363112_2363433_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
AYL71395.1|2363756_2363981_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AYL71396.1|2364055_2366002_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	2.4e-40
>prophage 9
CP024673	Citrobacter freundii strain UMH19 chromosome, complete genome	4996291	2404059	2412478	4996291	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
AYL71432.1|2404059_2406093_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	3.0e-54
AYL71433.1|2406299_2406758_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	69.3	1.0e-50
AYL73829.1|2406800_2407271_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
AYL71434.1|2407317_2408037_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AYL71435.1|2408033_2409719_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	1.1e-280
AYL71436.1|2409944_2410676_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.0e-105
AYL71437.1|2410727_2410835_+	hypothetical protein	NA	NA	NA	NA	NA
AYL71438.1|2410815_2411547_-	ABC transporter permease	NA	NA	NA	NA	NA
AYL71439.1|2411530_2412478_-	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	1.2e-21
>prophage 10
CP024673	Citrobacter freundii strain UMH19 chromosome, complete genome	4996291	2607854	2682936	4996291	tRNA,holin,terminase,head,coat,tail,integrase	Cronobacter_phage(20.0%)	99	2609041:2609057	2680626:2680642
AYL71606.1|2607854_2608667_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AYL71607.1|2608666_2609680_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
2609041:2609057	attL	GCTCTTCACGCACGCTG	NA	NA	NA	NA
AYL71608.1|2609748_2610885_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	26.6	5.2e-19
AYL73839.1|2610993_2611995_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AYL71609.1|2611991_2613170_-	arabinose transporter	NA	NA	NA	NA	NA
AYL73840.1|2613349_2613724_-	hypothetical protein	NA	NA	NA	NA	NA
AYL71610.1|2613895_2614150_+	DNA-binding protein	NA	A0A0M4UV99	Ralstonia_phage	51.3	5.5e-14
AYL71611.1|2614300_2614669_+	hypothetical protein	NA	H6SUH4	Campylobacter_virus	34.6	1.5e-07
AYL71612.1|2614668_2615187_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AYL71613.1|2615236_2616451_-	beta-ketoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
AYL71614.1|2616550_2618611_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AYL71615.1|2618725_2619001_-	YfcL family protein	NA	NA	NA	NA	NA
AYL71616.1|2619033_2619582_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AYL71617.1|2619581_2620391_-	hypothetical protein	NA	NA	NA	NA	NA
AYL71618.1|2620390_2621215_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AYL71619.1|2621218_2622304_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.7	1.7e-88
AYL71620.1|2622343_2623276_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AYL71621.1|2623442_2623994_+	endonuclease SmrB	NA	NA	NA	NA	NA
AYL71622.1|2624074_2624560_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AYL71623.1|2624768_2626916_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AYL71624.1|2626915_2628226_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AYL71625.1|2628402_2628687_-	hypothetical protein	NA	NA	NA	NA	NA
AYL71626.1|2628771_2629023_-	hypothetical protein	NA	NA	NA	NA	NA
AYL71627.1|2629058_2630390_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AYL71628.1|2630449_2631205_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AYL71629.1|2631493_2632435_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	89.3	1.7e-148
AYL71630.1|2632748_2633918_+|integrase	integrase	integrase	C6ZR22	Salmonella_phage	90.2	3.9e-211
AYL71631.1|2636170_2636875_-	transcriptional regulator	NA	A0A0H5AUF7	Pseudomonas_phage	43.4	6.2e-39
AYL71632.1|2636939_2637608_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	45.5	2.6e-31
AYL71633.1|2637594_2637762_-	Arc family DNA binding domain-containing protein	NA	G9L6D7	Escherichia_phage	70.9	2.5e-15
AYL71634.1|2637886_2638339_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	55.8	1.2e-27
AYL71635.1|2638358_2640362_-|tail	phage tail protein	tail	G8GV21	Salmonella_phage	51.9	5.5e-157
AYL71636.1|2640419_2642897_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	87.1	0.0e+00
AYL71637.1|2642883_2643276_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	91.3	2.3e-67
AYL71638.1|2643272_2643737_-	HNH endonuclease	NA	Q6XQF0	Escherichia_phage	40.1	3.4e-25
AYL71639.1|2643813_2644284_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	91.0	6.5e-77
AYL71640.1|2644283_2644781_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	87.3	2.4e-85
AYL71641.1|2644818_2645049_-	hypothetical protein	NA	NA	NA	NA	NA
AYL71642.1|2645057_2647391_-|tail	phage tail tape measure protein	tail	A0A1B1W284	Salmonella_phage	50.6	3.5e-155
AYL71643.1|2647445_2648189_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	50.0	4.4e-59
AYL71644.1|2648239_2648995_-	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	53.4	4.9e-58
AYL71645.1|2649053_2649437_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	56.7	8.3e-38
AYL71646.1|2649433_2649802_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	75.4	2.3e-45
AYL71647.1|2649804_2650155_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	65.2	7.6e-38
AYL71648.1|2650158_2650395_-	hypothetical protein	NA	NA	NA	NA	NA
AYL71649.1|2650398_2650569_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AYL71650.1|2650568_2650949_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	52.4	3.1e-29
AYL71651.1|2650951_2651215_-	hypothetical protein	NA	NA	NA	NA	NA
AYL71652.1|2651247_2652303_-|coat	phage coat protein	coat	R9TMI8	Aeromonas_phage	52.9	5.4e-103
AYL71653.1|2652299_2652761_-	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	2.2e-29
AYL71654.1|2652760_2654131_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	52.3	3.0e-122
AYL71655.1|2654335_2655337_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.5	4.6e-112
AYL71656.1|2655263_2656733_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.0	9.0e-149
AYL71657.1|2656745_2658218_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.9	4.1e-250
AYL71658.1|2658217_2658820_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	81.5	4.9e-77
AYL71659.1|2658831_2659011_-	hypothetical protein	NA	NA	NA	NA	NA
AYL71660.1|2658985_2659204_-	hypothetical protein	NA	NA	NA	NA	NA
AYL71661.1|2659466_2659853_-	DUF2570 domain-containing protein	NA	S5FKR3	Shigella_phage	36.7	7.4e-10
AYL71662.1|2659849_2660299_-	muraminidase	NA	A0A0M4R365	Salmonella_phage	84.6	5.3e-68
AYL71663.1|2660285_2660603_-|holin	holin	holin	E7C9S8	Salmonella_phage	86.7	8.9e-46
AYL71664.1|2661030_2661531_-	antiterminator	NA	G8C7V7	Escherichia_phage	81.1	1.5e-76
AYL71665.1|2661527_2661668_-	hypothetical protein	NA	NA	NA	NA	NA
AYL71666.1|2661664_2661889_-	protein ninY	NA	Q5G8R9	Enterobacteria_phage	81.1	1.4e-29
AYL71667.1|2661885_2662473_-	protein NinG	NA	A0A1P8DTE0	Proteus_phage	55.2	1.3e-50
AYL71668.1|2662465_2662636_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	89.3	5.9e-20
AYL71669.1|2662635_2663091_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.9	1.2e-54
AYL71670.1|2663310_2663604_-	DUF4752 domain-containing protein	NA	K7PHN1	Enterobacterial_phage	45.7	1.9e-21
AYL71671.1|2663603_2664632_-	hypothetical protein	NA	K7PGV7	Enterobacterial_phage	59.4	6.1e-19
AYL71672.1|2664628_2665072_-	hypothetical protein	NA	G9L662	Escherichia_phage	47.6	2.1e-16
AYL71673.1|2665068_2665635_-	hypothetical protein	NA	NA	NA	NA	NA
AYL71674.1|2665631_2666171_-	hypothetical protein	NA	A0A193GYL1	Enterobacter_phage	54.7	8.4e-28
AYL71675.1|2666167_2666467_-	protein ren	NA	M1FPD5	Enterobacteria_phage	52.6	8.2e-17
AYL73841.1|2666463_2667243_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	64.6	6.8e-95
AYL71676.1|2667239_2667968_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	66.7	1.5e-35
AYL71677.1|2668101_2668644_-	regulator	NA	M9NZI6	Enterobacteria_phage	87.8	1.0e-81
AYL71678.1|2668674_2668896_-	transcriptional regulator	NA	M9NZA8	Enterobacteria_phage	100.0	3.5e-33
AYL73842.1|2669013_2669724_+	phage repressor protein C	NA	M9NZE3	Enterobacteria_phage	96.2	2.9e-129
AYL71679.1|2669797_2670178_+	hypothetical protein	NA	NA	NA	NA	NA
AYL71680.1|2670219_2670429_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	81.2	2.5e-20
AYL71681.1|2671016_2671466_+	hypothetical protein	NA	G8C7T5	Escherichia_phage	99.3	1.5e-75
AYL71682.1|2671620_2672184_+	hypothetical protein	NA	A5PJ37	Escherichia_virus	37.6	3.8e-23
AYL71683.1|2672219_2672600_+	hypothetical protein	NA	NA	NA	NA	NA
AYL71684.1|2672751_2672961_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	91.3	1.3e-32
AYL71685.1|2673031_2674003_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	98.2	6.7e-84
AYL71686.1|2674010_2674295_+	hypothetical protein	NA	G8C7T1	Escherichia_phage	92.6	3.2e-47
AYL71687.1|2674313_2675159_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.7	8.2e-70
AYL71688.1|2675155_2675362_+	MarR family transcriptional regulator	NA	A0A173GC36	Salmonella_phage	80.0	5.6e-17
AYL71689.1|2675358_2676039_+	exonuclease	NA	M9NZE1	Enterobacteria_phage	93.4	9.3e-125
AYL71690.1|2676496_2677048_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	58.8	8.2e-55
AYL71691.1|2677044_2677263_+	hypothetical protein	NA	NA	NA	NA	NA
AYL71692.1|2677360_2677840_+	hypothetical protein	NA	NA	NA	NA	NA
AYL71693.1|2677820_2678042_+	conjugal transfer protein TraR	NA	Q9ZXI6	Pseudomonas_virus	46.8	8.8e-08
AYL71694.1|2678041_2678419_+	protein ninX	NA	A0A1P8DTT2	Salmonella_phage	44.8	1.3e-19
AYL71695.1|2678627_2678969_+	hypothetical protein	NA	I3PV00	Vibrio_phage	52.9	2.0e-22
AYL71696.1|2679009_2679312_+	hypothetical protein	NA	A0A1B3AZN4	Gordonia_phage	33.3	1.9e-05
AYL71697.1|2679418_2679796_+	hypothetical protein	NA	Q7Y3U8	Yersinia_phage	67.2	8.4e-43
AYL71698.1|2679876_2680080_+	hypothetical protein	NA	I6RSG8	Salmonella_phage	65.7	8.3e-21
AYL71699.1|2680233_2680863_-	DNA-binding protein	NA	NA	NA	NA	NA
2680626:2680642	attR	GCTCTTCACGCACGCTG	NA	NA	NA	NA
AYL71700.1|2681037_2682936_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.0	8.4e-14
>prophage 11
CP024673	Citrobacter freundii strain UMH19 chromosome, complete genome	4996291	3463235	3508938	4996291	transposase,integrase,tRNA	Pseudomonas_phage(12.5%)	41	3472791:3472813	3497342:3497364
AYL72347.1|3463235_3464249_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.8	7.4e-110
AYL72348.1|3464485_3464701_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AYL72349.1|3464798_3464894_-	hypothetical protein	NA	NA	NA	NA	NA
AYL72350.1|3464938_3466684_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	8.4e-77
AYL72351.1|3466927_3468775_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AYL72352.1|3468936_3469986_+	receptor	NA	NA	NA	NA	NA
AYL72353.1|3469996_3471994_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.2	1.9e-08
AYL72354.1|3472024_3472531_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3472791:3472813	attL	GGGTCAGGTAATGGGTCAGGTAA	NA	NA	NA	NA
AYL72355.1|3472834_3473668_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AYL72356.1|3473783_3474125_-	toxin	NA	NA	NA	NA	NA
AYL72357.1|3474145_3474463_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AYL72358.1|3474481_3474703_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
AYL72359.1|3474711_3475188_-	hypothetical protein	NA	NA	NA	NA	NA
AYL72360.1|3475203_3475662_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	34.6	4.8e-16
AYL72361.1|3475740_3475977_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AYL72362.1|3476054_3476465_-	hypothetical protein	NA	A0A1B2IBY1	Erwinia_phage	47.8	5.8e-29
AYL72363.1|3476553_3477168_-	hypothetical protein	NA	NA	NA	NA	NA
AYL72364.1|3477164_3477869_-	transcriptional regulator	NA	NA	NA	NA	NA
AYL72365.1|3478070_3478904_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	4.3e-47
AYL72366.1|3479001_3479865_-	hypothetical protein	NA	NA	NA	NA	NA
AYL72367.1|3480213_3483492_+	helicase	NA	A0A2K5B2B9	Erysipelothrix_phage	42.3	3.8e-232
AYL72368.1|3484211_3486092_+	ATP-dependent endonuclease	NA	E5E3R2	Burkholderia_phage	71.5	1.8e-247
AYL72369.1|3486094_3487504_+	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
AYL72370.1|3487563_3488871_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	42.3	1.2e-64
AYL72371.1|3489032_3489632_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	97.5	9.4e-105
AYL72372.1|3489866_3490547_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AYL72373.1|3490823_3492338_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AYL72374.1|3492397_3492634_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AYL72375.1|3492740_3493814_-	hypothetical protein	NA	NA	NA	NA	NA
AYL72376.1|3494037_3495069_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AYL72377.1|3495202_3495361_+	hypothetical protein	NA	NA	NA	NA	NA
AYL73879.1|3495357_3495912_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
AYL72378.1|3495976_3497293_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.0	1.3e-34
AYL72379.1|3497979_3498843_-	hypothetical protein	NA	NA	NA	NA	NA
3497342:3497364	attR	GGGTCAGGTAATGGGTCAGGTAA	NA	NA	NA	NA
AYL72380.1|3499696_3500848_-|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AYL72381.1|3501294_3501705_-	hypothetical protein	NA	NA	NA	NA	NA
AYL72382.1|3501998_3503522_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AYL72383.1|3504062_3505145_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYL72384.1|3505465_3506536_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYL72385.1|3506889_3508041_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.7	1.1e-98
AYL72386.1|3508233_3508938_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 12
CP024673	Citrobacter freundii strain UMH19 chromosome, complete genome	4996291	4044009	4076287	4996291	transposase,tRNA	Escherichia_phage(40.0%)	37	NA	NA
AYL72876.1|4044009_4045854_-|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	25.5	4.0e-13
AYL72877.1|4045850_4047242_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
AYL72878.1|4047340_4047949_-	glutathione S-transferase	NA	NA	NA	NA	NA
AYL72879.1|4048019_4049156_-	HlyD family secretion protein	NA	NA	NA	NA	NA
AYL73900.1|4049158_4049503_-	hypothetical protein	NA	NA	NA	NA	NA
AYL72880.1|4049550_4050531_-|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AYL72881.1|4050972_4051410_+	hypothetical protein	NA	NA	NA	NA	NA
AYL72882.1|4051413_4051614_-	hypothetical protein	NA	NA	NA	NA	NA
AYL72883.1|4053105_4054335_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AYL72884.1|4054439_4055144_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	5.3e-139
AYL72885.1|4055228_4055786_-|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	81.3	3.4e-48
AYL72886.1|4055915_4056128_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AYL73901.1|4056072_4056210_+	mercury resistance protein	NA	NA	NA	NA	NA
AYL72887.1|4056193_4056430_-	mercury resistance protein	NA	NA	NA	NA	NA
AYL72888.1|4056426_4056792_-	transcriptional regulator	NA	NA	NA	NA	NA
AYL72889.1|4056809_4058495_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
AYL72890.1|4058533_4058959_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AYL72891.1|4058986_4059262_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AYL72892.1|4059277_4059658_-	mercuric transporter	NA	NA	NA	NA	NA
AYL72893.1|4059729_4060185_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AYL72894.1|4060389_4061412_+|transposase	IS110 family transposase IS5708	transposase	NA	NA	NA	NA
AYL72895.1|4061746_4062751_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYL72896.1|4063345_4064395_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
AYL72897.1|4064391_4065612_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
AYL72898.1|4065611_4065851_+	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
AYL72899.1|4065847_4066744_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYL73902.1|4067000_4067534_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYL72900.1|4067560_4068520_+	hypothetical protein	NA	NA	NA	NA	NA
AYL72901.1|4068558_4068945_-	hypothetical protein	NA	NA	NA	NA	NA
AYL72902.1|4069215_4069704_+	hypothetical protein	NA	NA	NA	NA	NA
AYL73903.1|4069762_4069945_+	hypothetical protein	NA	NA	NA	NA	NA
AYL72903.1|4070180_4070756_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYL72904.1|4071152_4072178_-	oxidoreductase	NA	NA	NA	NA	NA
AYL72905.1|4072177_4072771_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AYL72906.1|4072773_4074006_-	OsmC family protein	NA	NA	NA	NA	NA
AYL72907.1|4074150_4075110_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYL72908.1|4075255_4076287_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP024674	Citrobacter freundii strain UMH19 plasmid pUMH19, complete sequence	57161	8175	24747	57161	transposase	Enterobacteria_phage(36.36%)	14	NA	NA
AYL73942.1|8175_8943_-	DUF1883 domain-containing protein	NA	S6BFN8	Thermus_phage	46.4	9.8e-30
AYL73943.1|9111_9726_+	hypothetical protein	NA	NA	NA	NA	NA
AYL73944.1|9766_10474_-	hypothetical protein	NA	NA	NA	NA	NA
AYL73945.1|10501_11068_-	resolvase/recombinase	NA	Q1MVP4	Enterobacteria_phage	82.6	3.5e-77
AYL73946.1|11231_14240_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
AYL73947.1|14810_15233_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
AYL73948.1|15232_16504_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.2	2.7e-157
AYL73949.1|16649_17621_-	chromosome partitioning protein ParB	NA	Q1MVJ4	Enterobacteria_phage	68.9	9.6e-115
AYL73950.1|17617_18823_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
AYL73951.1|19430_21257_+	OLD family endonuclease	NA	E5E3R2	Burkholderia_phage	23.2	1.5e-12
AYL73952.1|21428_21779_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	55.2	2.4e-20
AYL73953.1|21927_22359_-	copper-binding protein	NA	NA	NA	NA	NA
AYL73954.1|22595_24074_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	1.8e-27
AYL73955.1|24066_24747_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.5	1.9e-32
