The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024675	Citrobacter werkmanii strain UMH18 chromosome, complete genome	5062051	923796	974876	5062051	head,integrase,holin,portal,terminase,tail,capsid,transposase	Cronobacter_phage(71.79%)	60	924751:924766	974640:974655
AYL65355.1|923796_924312_+	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	33.7	1.9e-16
AYL65356.1|924375_925962_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
924751:924766	attL	AAGCTGGCGCAGCAGG	NA	NA	NA	NA
AYL65357.1|926238_926367_-	Mn(2+)-response protein MntS	NA	NA	NA	NA	NA
AYL65358.1|926535_927576_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	62.9	1.1e-119
AYL65359.1|927577_928159_-	phage repressor protein	NA	F1BUS8	Erwinia_phage	40.9	1.4e-33
AYL65360.1|928294_928516_+	regulator	NA	NA	NA	NA	NA
AYL65361.1|928546_929050_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	71.9	1.7e-59
AYL65362.1|929059_929287_+	hypothetical protein	NA	NA	NA	NA	NA
AYL65363.1|929276_929705_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	52.8	5.6e-27
AYL65364.1|929704_930106_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.7e-49
AYL65365.1|930173_930407_+	hypothetical protein	NA	NA	NA	NA	NA
AYL65366.1|930397_930727_+	hypothetical protein	NA	Q7Y4B7	Escherichia_virus	46.4	3.9e-12
AYL65367.1|930716_931586_+	adenine methylase	NA	F1BUN1	Cronobacter_phage	81.7	1.0e-131
AYL65368.1|931582_931795_+	hypothetical protein	NA	NA	NA	NA	NA
AYL65369.1|931760_933812_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.9	2.5e-298
AYL65370.1|933931_934138_+	hypothetical protein	NA	NA	NA	NA	NA
AYL65371.1|934111_934435_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	93.3	4.7e-50
AYL65372.1|934431_935493_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	78.1	3.5e-163
AYL65373.1|935489_937265_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.8	1.8e-292
AYL65374.1|937426_938230_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	56.8	4.4e-81
AYL65375.1|938291_939314_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.8	1.0e-159
AYL65376.1|939317_940019_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	69.4	2.6e-90
AYL65377.1|940064_940568_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	83.3	6.8e-64
AYL65378.1|940564_941071_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	67.5	5.2e-64
AYL65379.1|941067_941775_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	75.2	3.7e-100
AYL65380.1|941771_942899_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	81.6	2.4e-173
AYL65381.1|942895_943351_+	DUF2597 domain-containing protein	NA	F1BUL4	Cronobacter_phage	73.5	1.6e-59
AYL65382.1|943361_943664_+|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	54.3	4.0e-19
AYL65383.1|943650_943992_+	hypothetical protein	NA	F1BUL3	Cronobacter_phage	93.1	1.5e-51
AYL65384.1|943991_944372_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	63.2	1.6e-28
AYL65385.1|944301_944490_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	74.2	7.7e-21
AYL65386.1|944467_944734_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	57.3	5.1e-18
AYL65387.1|944921_946982_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	68.7	3.8e-270
AYL65388.1|946978_947308_+	DUF2590 domain-containing protein	NA	F1BUK8	Cronobacter_phage	68.8	9.3e-38
AYL65389.1|947304_948489_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	80.9	1.0e-182
AYL65390.1|948475_949069_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	4.1e-92
AYL65391.1|949079_951083_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	77.8	8.8e-147
AYL65392.1|951095_951632_+|tail	phage tail protein	tail	F1BUK2	Cronobacter_phage	35.2	5.8e-21
AYL65393.1|951621_952347_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	54.8	2.1e-66
AYL65394.1|952318_952864_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	73.1	3.0e-65
AYL65395.1|952863_954567_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	79.9	4.9e-223
AYL65396.1|954680_955013_+	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	50.9	2.2e-23
AYL65397.1|955586_955811_-	hypothetical protein	NA	NA	NA	NA	NA
AYL65398.1|955749_956388_-	hypothetical protein	NA	NA	NA	NA	NA
AYL65399.1|956433_956697_-	hypothetical protein	NA	NA	NA	NA	NA
AYL65400.1|956734_957334_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AYL65401.1|957537_958011_+	transcriptional regulator MntR	NA	NA	NA	NA	NA
AYL65402.1|958007_959117_+	anion transporter	NA	NA	NA	NA	NA
AYL69072.1|959211_960132_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AYL65403.1|960364_961960_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	1.1e-59
AYL65404.1|961910_962159_-	hypothetical protein	NA	NA	NA	NA	NA
AYL65405.1|962146_964525_-	alpha-glucosidase	NA	NA	NA	NA	NA
AYL65406.1|964527_965829_-	MFS transporter	NA	NA	NA	NA	NA
AYL69073.1|966117_967191_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
AYL65407.1|967187_968450_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
AYL65408.1|968604_969417_-	HAD family hydrolase	NA	NA	NA	NA	NA
AYL65409.1|969639_972072_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	50.9	2.3e-08
AYL65410.1|972077_972977_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AYL65411.1|973109_973772_+	fructose-6-phosphate aldolase	NA	A0A0E3FJJ0	Synechococcus_phage	33.2	2.4e-24
AYL65412.1|973946_974876_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	52.0	1.9e-64
974640:974655	attR	AAGCTGGCGCAGCAGG	NA	NA	NA	NA
>prophage 2
CP024675	Citrobacter werkmanii strain UMH18 chromosome, complete genome	5062051	1283280	1333952	5062051	portal,integrase,tail,tRNA	Enterobacteria_phage(33.33%)	58	1277485:1277503	1298694:1298712
1277485:1277503	attL	GAACGCGCTGATCGTCCAG	NA	NA	NA	NA
AYL65682.1|1283280_1284567_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	50.4	5.5e-110
AYL65683.1|1284566_1284782_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	54.9	1.7e-19
AYL65684.1|1284848_1287329_-	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	38.2	2.6e-108
AYL69088.1|1287470_1287797_-	transcriptional regulator	NA	NA	NA	NA	NA
AYL65685.1|1288082_1288397_+	hypothetical protein	NA	NA	NA	NA	NA
AYL65686.1|1288772_1289153_-	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	66.7	6.5e-19
AYL65687.1|1289258_1289471_+	XRE family transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	59.7	3.8e-16
AYL69089.1|1289474_1290029_+	hypothetical protein	NA	NA	NA	NA	NA
AYL65688.1|1291059_1291650_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	76.8	1.3e-66
AYL65689.1|1291773_1292127_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	4.8e-24
AYL65690.1|1292174_1292537_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AYL65691.1|1292554_1294306_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AYL65692.1|1294352_1295642_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	9.6e-171
AYL65693.1|1295654_1296080_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	4.3e-51
AYL65694.1|1296147_1296444_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYL65695.1|1296542_1297634_+	permease	NA	NA	NA	NA	NA
AYL65696.1|1297920_1298154_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	87.0	3.7e-33
AYL65697.1|1298199_1298445_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	63.0	2.9e-20
AYL65698.1|1298574_1298775_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	60.0	7.2e-17
1298694:1298712	attR	CTGGACGATCAGCGCGTTC	NA	NA	NA	NA
AYL65699.1|1298777_1299137_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	64.4	2.3e-42
AYL65700.1|1299133_1300174_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	50.3	4.3e-97
AYL65701.1|1300185_1300533_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	9.8e-54
AYL65702.1|1300557_1301736_-	hypothetical protein	NA	A0A291AUQ1	Sinorhizobium_phage	32.5	3.3e-53
AYL65703.1|1301725_1302760_-	nucleoid-associated protein	NA	NA	NA	NA	NA
AYL65704.1|1302986_1303295_+	hypothetical protein	NA	O64361	Escherichia_phage	67.3	4.2e-32
AYL65705.1|1303287_1303824_+	lysozyme	NA	K7PM52	Enterobacteria_phage	93.6	4.6e-95
AYL65706.1|1303802_1304336_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	39.0	6.2e-07
AYL65707.1|1304332_1304563_+	hypothetical protein	NA	NA	NA	NA	NA
AYL65708.1|1304953_1305151_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	89.2	4.9e-26
AYL65709.1|1305188_1305332_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AYL65710.1|1305722_1305935_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	4.6e-22
AYL69090.1|1305945_1306134_+	cold-shock protein	NA	NA	NA	NA	NA
AYL65711.1|1306207_1306438_+	hypothetical protein	NA	NA	NA	NA	NA
AYL65712.1|1306642_1306816_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AYL65713.1|1307152_1307644_+	DNA breaking-rejoining protein	NA	Q9EYD0	Enterobacteria_phage	56.9	9.9e-44
AYL65714.1|1307630_1309739_+	DNA packaging protein	NA	S5MDQ1	Escherichia_phage	66.1	7.3e-293
AYL65715.1|1309735_1309942_+	primosomal replication protein PriB/PriC domain protein	NA	A5LH28	Enterobacteria_phage	48.6	8.2e-08
AYL65716.1|1309938_1311474_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	63.7	8.7e-179
AYL65717.1|1311391_1313506_+	peptidase S14	NA	A0A291AWT6	Escherichia_phage	71.7	4.0e-275
AYL65718.1|1313594_1313918_+	DUF2190 domain-containing protein	NA	K7PLV6	Enterobacteria_phage	64.2	2.7e-29
AYL65719.1|1313910_1314186_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	42.9	1.3e-13
AYL65720.1|1314189_1314774_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	77.1	6.9e-76
AYL65721.1|1314770_1315172_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	65.4	3.2e-48
AYL65722.1|1315182_1315926_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	75.6	6.2e-98
AYL65723.1|1315971_1316376_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	52.6	4.1e-27
AYL65724.1|1316393_1316711_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	64.2	7.3e-32
AYL65725.1|1316682_1319835_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	53.5	4.8e-264
AYL65726.1|1319844_1320174_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	3.6e-42
AYL65727.1|1320183_1320879_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	70.6	1.3e-94
AYL65728.1|1320890_1321625_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	77.4	1.0e-116
AYL65729.1|1321522_1322200_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	74.2	2.7e-76
AYL65730.1|1322271_1325673_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	70.1	0.0e+00
AYL65731.1|1327612_1328197_+	hypothetical protein	NA	Q7BQC6	Enterobacteria_phage	46.9	4.3e-46
AYL65732.1|1328425_1329196_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	42.9	7.2e-49
AYL65733.1|1329757_1330192_-	aminoglycoside 6'-acetyltransferase	NA	NA	NA	NA	NA
AYL65734.1|1330795_1332166_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	6.1e-107
AYL69091.1|1332169_1332811_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AYL65735.1|1332845_1333952_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 3
CP024675	Citrobacter werkmanii strain UMH18 chromosome, complete genome	5062051	1443228	1453269	5062051	tRNA	Tupanvirus(14.29%)	10	NA	NA
AYL65844.1|1443228_1444212_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AYL65845.1|1444227_1446615_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYL65846.1|1446619_1446919_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AYL65847.1|1447074_1448055_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.1	8.7e-15
AYL65848.1|1448115_1448667_+	glutathione peroxidase	NA	NA	NA	NA	NA
AYL65849.1|1448666_1449416_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	1.6e-08
AYL65850.1|1449493_1449958_+	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
AYL65851.1|1450275_1450989_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYL65852.1|1451050_1452493_+	hypothetical protein	NA	A0A075BSJ0	Microcystis_phage	37.1	1.8e-53
AYL65853.1|1452489_1453269_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.6	3.0e-10
>prophage 4
CP024675	Citrobacter werkmanii strain UMH18 chromosome, complete genome	5062051	2388990	2398105	5062051	protease	Bacillus_phage(28.57%)	8	NA	NA
AYL66711.1|2388990_2390394_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	29.9	2.7e-33
AYL66712.1|2390390_2391113_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
AYL66713.1|2391278_2392640_+	U32 family peptidase	NA	Q6DW11	Phage_TP	93.2	2.8e-205
AYL66714.1|2392908_2395185_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	4.8e-165
AYL66715.1|2395215_2395536_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
AYL66716.1|2395859_2396084_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AYL66717.1|2396037_2396238_+	hypothetical protein	NA	NA	NA	NA	NA
AYL66718.1|2396158_2398105_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.2	1.4e-40
>prophage 5
CP024675	Citrobacter werkmanii strain UMH18 chromosome, complete genome	5062051	2438816	2447246	5062051	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
AYL66756.1|2438816_2440850_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.2e-53
AYL66757.1|2441065_2441524_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	68.6	1.3e-50
AYL69132.1|2441568_2442039_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	77.6	2.8e-64
AYL66758.1|2442085_2442805_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AYL66759.1|2442801_2444487_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.8	3.5e-282
AYL66760.1|2444712_2445444_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	92.5	4.0e-105
AYL66761.1|2445495_2445603_+	hypothetical protein	NA	NA	NA	NA	NA
AYL66762.1|2445583_2446315_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AYL66763.1|2446298_2447246_-	ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	6.9e-09
>prophage 6
CP024675	Citrobacter werkmanii strain UMH18 chromosome, complete genome	5062051	3686497	3694148	5062051		Pseudoalteromonas_phage(16.67%)	10	NA	NA
AYL67800.1|3686497_3687475_+	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	22.8	8.1e-05
AYL67801.1|3687488_3688475_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	4.3e-38
AYL67802.1|3688495_3689062_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.3	4.2e-54
AYL67803.1|3689058_3689634_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AYL67804.1|3689602_3690151_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AYL67805.1|3690157_3690883_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
AYL67806.1|3690929_3692363_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
AYL67807.1|3692385_3692673_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	5.5e-10
AYL67808.1|3692756_3693248_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AYL67809.1|3693293_3694148_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
>prophage 7
CP024675	Citrobacter werkmanii strain UMH18 chromosome, complete genome	5062051	4181183	4191159	5062051	integrase,capsid	Enterobacteria_phage(100.0%)	10	4181004:4181029	4193500:4193525
4181004:4181029	attL	ACTCCTGTGATCTTCCGCCAAAATTC	NA	NA	NA	NA
AYL68257.1|4181183_4182386_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	92.7	2.6e-210
AYL68258.1|4182410_4184066_+	hypothetical protein	NA	K7PHD1	Enterobacteria_phage	24.8	1.4e-12
AYL68259.1|4184647_4184962_+	hypothetical protein	NA	NA	NA	NA	NA
AYL68260.1|4185340_4185907_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.4	1.8e-60
AYL68261.1|4185922_4186162_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	61.7	1.7e-20
AYL68262.1|4186165_4187026_-|capsid	capsid protein	capsid	NA	NA	NA	NA
AYL68263.1|4187709_4188261_+	ASH family protein	NA	Q7M2A7	Enterobacteria_phage	73.1	1.9e-35
AYL68264.1|4188257_4188485_+	hypothetical protein	NA	NA	NA	NA	NA
AYL68265.1|4188481_4188802_+	hypothetical protein	NA	NA	NA	NA	NA
AYL68266.1|4188816_4191159_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.2	0.0e+00
4193500:4193525	attR	ACTCCTGTGATCTTCCGCCAAAATTC	NA	NA	NA	NA
