The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024676	Citrobacter pasteurii strain UMH17 chromosome, complete genome	4654874	1054451	1063576	4654874	protease	Bacillus_phage(28.57%)	7	NA	NA
AYL61047.1|1054451_1056398_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.2	2.8e-41
AYL61048.1|1056482_1056707_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	2.8e-17
AYL61049.1|1057029_1057350_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
AYL61050.1|1057380_1059657_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	1.4e-164
AYL61051.1|1059926_1061288_-	U32 family peptidase	NA	Q6DW11	Phage_TP	93.4	1.7e-205
AYL61052.1|1061453_1062176_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
AYL61053.1|1062172_1063576_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	29.2	3.0e-32
>prophage 2
CP024676	Citrobacter pasteurii strain UMH17 chromosome, complete genome	4654874	1353228	1359856	4654874		Brazilian_cedratvirus(33.33%)	8	NA	NA
AYL61307.1|1353228_1353528_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AYL61308.1|1353648_1354629_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.1	3.3e-14
AYL61309.1|1354703_1355255_+	glutathione peroxidase	NA	NA	NA	NA	NA
AYL61310.1|1355254_1356004_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	7.1e-09
AYL61311.1|1356081_1356546_+	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
AYL61312.1|1356862_1357573_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYL61313.1|1357637_1359080_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	3.4e-52
AYL61314.1|1359076_1359856_-	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.4	1.9e-12
>prophage 3
CP024676	Citrobacter pasteurii strain UMH17 chromosome, complete genome	4654874	2074653	2094036	4654874	tail,integrase,holin	Escherichia_phage(27.78%)	24	2071861:2071920	2094095:2094218
2071861:2071920	attL	ACAAAAAAACCACCCGTAGGTGGTTTCACGACACTGCTTATTGCTTTGATTATTCTGTTC	NA	NA	NA	NA
AYL61976.1|2074653_2075043_-	DNA polymerase V	NA	Q71TH8	Escherichia_phage	72.1	2.3e-51
AYL61977.1|2075121_2075364_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	4.4e-29
AYL61978.1|2075498_2076743_-|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	46.3	5.7e-96
AYL61979.1|2076752_2077697_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	67.1	1.6e-119
AYL61980.1|2077699_2080909_-	host specificity protein	NA	O64335	Escherichia_phage	83.9	0.0e+00
AYL61981.1|2080963_2081554_-|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	78.5	6.9e-76
AYL61982.1|2081609_2082035_-	hypothetical protein	NA	K7PLY8	Enterobacterial_phage	36.9	3.9e-12
AYL61983.1|2082145_2082889_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	53.1	6.1e-61
AYL64348.1|2082966_2083548_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	39.4	2.0e-27
AYL61984.1|2083621_2083789_-	Arc family DNA binding domain-containing protein	NA	G9L6D7	Escherichia_phage	72.7	6.6e-16
AYL61985.1|2083908_2084352_+	Rha family transcriptional regulator	NA	G9L6D6	Escherichia_phage	60.7	4.9e-34
AYL61986.1|2084358_2085069_-	peptidase P60	NA	K7PGR2	Enterobacteria_phage	90.6	4.7e-135
AYL61987.1|2085070_2085826_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	88.0	1.0e-132
AYL61988.1|2085822_2086170_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	69.6	5.2e-39
AYL64349.1|2086934_2087126_-	DNA-packaging protein	NA	NA	NA	NA	NA
AYL61989.1|2087182_2087710_-	hypothetical protein	NA	NA	NA	NA	NA
AYL61990.1|2088025_2088562_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AYL61991.1|2088558_2089008_-	muraminidase	NA	A0A0M4R365	Salmonella_phage	77.9	2.7e-64
AYL61992.1|2088997_2089315_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	74.8	1.5e-37
AYL61993.1|2089469_2089658_-	hypothetical protein	NA	NA	NA	NA	NA
AYL61994.1|2089971_2091180_-	DNA-binding protein	NA	NA	NA	NA	NA
AYL61995.1|2091363_2092053_-	antitermination protein	NA	NA	NA	NA	NA
AYL61996.1|2092074_2093070_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	69.9	1.7e-143
AYL61997.1|2093088_2094036_+|integrase	integrase	integrase	K7PLZ2	Enterobacterial_phage	88.4	5.2e-158
2094095:2094218	attR	ACAAAAAAACCACCCGTAGGTGGTTTCACGACACTGCTTATTGCTTTGATTATTCTGTTCTTTCCCATGGTACCCGGAGTGGGACTTGAACCCACACAGCGCGAACGCCGAGGGATTTTAAATC	NA	NA	NA	NA
>prophage 4
CP024676	Citrobacter pasteurii strain UMH17 chromosome, complete genome	4654874	2131832	2147963	4654874	terminase,integrase,holin	Enterobacteria_phage(30.77%)	23	2133171:2133230	2148016:2148091
AYL62042.1|2131832_2133014_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	4.3e-109
2133171:2133230	attL	AAGTGTTTGAATAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTACT	NA	NA	NA	NA
AYL62043.1|2133678_2134560_+	hypothetical protein	NA	NA	NA	NA	NA
AYL62044.1|2134874_2135489_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AYL64350.1|2135719_2136226_-|terminase	terminase	terminase	K7PJY2	Enterobacterial_phage	62.5	9.0e-48
AYL62045.1|2136515_2136689_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AYL62046.1|2136892_2137123_-	hypothetical protein	NA	NA	NA	NA	NA
AYL64351.1|2137196_2137385_-	cold-shock protein	NA	NA	NA	NA	NA
AYL62047.1|2137395_2137608_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	74.3	2.1e-22
AYL62048.1|2137980_2138517_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	31.8	9.6e-08
AYL62049.1|2138516_2139062_-	lysozyme	NA	K7PM52	Enterobacteria_phage	93.4	5.6e-96
AYL62050.1|2139033_2139312_-|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
AYL62051.1|2139465_2139654_-	hypothetical protein	NA	NA	NA	NA	NA
AYL62052.1|2139949_2140840_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYL62053.1|2141017_2141707_+	aspartate racemase	NA	NA	NA	NA	NA
AYL62054.1|2141904_2142102_-	hypothetical protein	NA	U5P0J0	Shigella_phage	42.4	4.6e-08
AYL62055.1|2142871_2143117_-	hypothetical protein	NA	NA	NA	NA	NA
AYL64352.1|2143242_2143521_-	hypothetical protein	NA	NA	NA	NA	NA
AYL62056.1|2143529_2144021_-	hypothetical protein	NA	G9L6B1	Escherichia_phage	37.1	5.5e-10
AYL64353.1|2144017_2144356_-	DNA breaking-rejoining protein	NA	H6WRX9	Salmonella_phage	46.7	1.3e-15
AYL62057.1|2144797_2145538_-	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	67.9	3.5e-93
AYL62058.1|2145540_2146341_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	47.6	2.3e-58
AYL64354.1|2146395_2146950_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	33.5	6.4e-15
AYL62059.1|2147051_2147963_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	59.3	5.1e-94
2148016:2148091	attR	AAGTGTTTGAATAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTACTCCGGTTTTCGAGACCG	NA	NA	NA	NA
>prophage 5
CP024676	Citrobacter pasteurii strain UMH17 chromosome, complete genome	4654874	3385223	3392880	4654874		Pseudoalteromonas_phage(16.67%)	10	NA	NA
AYL63138.1|3385223_3386201_+	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	22.3	2.1e-05
AYL63139.1|3386214_3387201_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.5e-38
AYL63140.1|3387221_3387788_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.3	4.2e-54
AYL63141.1|3387784_3388360_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AYL63142.1|3388328_3388883_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AYL63143.1|3388889_3389615_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	5.4e-22
AYL63144.1|3389661_3391095_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AYL63145.1|3391117_3391405_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	5.5e-10
AYL63146.1|3391488_3391980_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AYL63147.1|3392025_3392880_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
