The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024679	Citrobacter freundii strain UMH15 chromosome, complete genome	5343952	340717	369906	5343952	transposase,holin,protease	Stx2-converting_phage(30.0%)	26	NA	NA
AYL50331.1|340717_342721_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	2.6e-21
AYL50332.1|342785_344063_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AYL50333.1|344338_344689_+	morphinone reductase	NA	NA	NA	NA	NA
AYL50334.1|345683_347222_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.0	2.4e-269
AYL50335.1|347271_347619_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	94.8	2.0e-59
AYL54890.1|347615_347996_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	88.1	1.6e-57
AYL50336.1|348016_348214_-	hypothetical protein	NA	NA	NA	NA	NA
AYL50337.1|348237_348678_-	hypothetical protein	NA	NA	NA	NA	NA
AYL50338.1|348667_348913_-	hypothetical protein	NA	NA	NA	NA	NA
AYL50339.1|348953_349655_-	transcriptional regulator	NA	NA	NA	NA	NA
AYL50340.1|349871_350693_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	3.6e-46
AYL50341.1|350785_351649_-	hypothetical protein	NA	NA	NA	NA	NA
AYL50342.1|353306_354458_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	1.7e-41
AYL50343.1|355838_356990_-	2-alkenal reductase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	9.9e-26
AYL50344.1|357014_357980_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AYL50345.1|357957_358455_-	phosphate-starvation-inducible E family protein	NA	NA	NA	NA	NA
AYL50346.1|358451_360167_-	sodium:proton exchanger	NA	NA	NA	NA	NA
AYL50347.1|360170_360611_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	37.2	5.8e-11
AYL50348.1|360600_361746_-	hypothetical protein	NA	NA	NA	NA	NA
AYL50349.1|361825_362437_-	hypothetical protein	NA	NA	NA	NA	NA
AYL50350.1|362526_363414_-	hypothetical protein	NA	NA	NA	NA	NA
AYL50351.1|363516_364431_-	hypothetical protein	NA	NA	NA	NA	NA
AYL50352.1|364453_364912_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AYL50353.1|364999_366805_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	39.8	3.9e-93
AYL50354.1|366865_367057_-	hypothetical protein	NA	NA	NA	NA	NA
AYL50355.1|367056_369906_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.2	6.9e-129
>prophage 2
CP024679	Citrobacter freundii strain UMH15 chromosome, complete genome	5343952	1018412	1031695	5343952	transposase,tRNA	Stx2-converting_phage(37.5%)	9	NA	NA
AYL50934.1|1018412_1022474_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	2.9e-88
AYL50935.1|1022585_1023197_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AYL50936.1|1023207_1024551_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	4.3e-81
AYL50937.1|1024643_1025936_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.1	2.5e-94
AYL54911.1|1026176_1026557_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	88.1	1.6e-57
AYL50938.1|1026553_1026901_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	94.8	2.0e-59
AYL50939.1|1026950_1028489_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.0	2.4e-269
AYL50940.1|1028622_1031067_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.6	6.0e-222
AYL50941.1|1031077_1031695_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.1	2.8e-75
>prophage 3
CP024679	Citrobacter freundii strain UMH15 chromosome, complete genome	5343952	1295529	1302553	5343952		uncultured_Caudovirales_phage(50.0%)	9	NA	NA
AYL51180.1|1295529_1296780_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	96.3	1.9e-22
AYL51181.1|1296915_1297425_-	DedA family protein	NA	NA	NA	NA	NA
AYL51182.1|1297599_1297842_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
AYL51183.1|1298229_1298928_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	3.8e-89
AYL54921.1|1298983_1299334_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.3	2.1e-19
AYL51184.1|1299378_1300656_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	69.5	5.2e-161
AYL51185.1|1300668_1301094_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
AYL51186.1|1301337_1301550_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.6e-22
AYL51187.1|1302067_1302553_+	hypothetical protein	NA	A0A1B0VBR9	Salmonella_phage	34.9	3.0e-08
>prophage 4
CP024679	Citrobacter freundii strain UMH15 chromosome, complete genome	5343952	1393695	1437406	5343952	coat,integrase,tail,head,terminase,transposase,holin	Salmonella_phage(25.93%)	64	1393493:1393515	1444703:1444725
1393493:1393515	attL	TCTTTGTATGTGATCTTACGTGT	NA	NA	NA	NA
AYL51275.1|1393695_1394904_+|integrase	integrase	integrase	I6R9B6	Salmonella_phage	76.7	5.6e-181
AYL51276.1|1394861_1395098_-	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	53.7	3.3e-13
AYL51277.1|1395202_1395820_-	Eac protein	NA	A0A220NQT7	Salmonella_phage	77.1	2.7e-91
AYL51278.1|1395920_1396499_-	HNH endonuclease	NA	A0A2H4FNF1	Salmonella_phage	40.9	6.2e-29
AYL51279.1|1396495_1397005_-	SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.7	2.2e-70
AYL51280.1|1397004_1397226_-	conjugal transfer protein TraR	NA	Q9ZXI6	Pseudomonas_virus	48.4	5.1e-08
AYL51281.1|1397206_1397686_-	hypothetical protein	NA	NA	NA	NA	NA
AYL51282.1|1397783_1398002_-	hypothetical protein	NA	NA	NA	NA	NA
AYL51283.1|1397998_1398550_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	58.9	1.8e-54
AYL51284.1|1399004_1399628_-	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	58.8	9.6e-60
AYL51285.1|1399624_1400371_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	65.8	1.8e-65
AYL51286.1|1400389_1400674_-	hypothetical protein	NA	G8C7T1	Escherichia_phage	93.6	5.0e-48
AYL51287.1|1400681_1401653_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	74.6	5.6e-38
AYL51288.1|1401723_1401933_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	92.8	1.7e-32
AYL51289.1|1402084_1402333_-	hypothetical protein	NA	NA	NA	NA	NA
AYL51290.1|1402488_1403067_-	hypothetical protein	NA	NA	NA	NA	NA
AYL51291.1|1403809_1404295_-	hypothetical protein	NA	NA	NA	NA	NA
AYL51292.1|1404332_1405037_-	hypothetical protein	NA	Q76H56	Enterobacteria_phage	78.6	4.7e-103
AYL51293.1|1405148_1405376_+	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	70.4	2.0e-23
AYL51294.1|1405405_1405948_+	regulator	NA	M9NZI6	Enterobacteria_phage	86.1	3.3e-80
AYL51295.1|1406133_1407075_+	replication protein	NA	A5VW95	Enterobacteria_phage	80.3	1.4e-54
AYL51296.1|1407071_1407761_+	phage replication protein	NA	G8C7U6	Escherichia_phage	94.3	3.2e-125
AYL51297.1|1407762_1408062_+	protein ren	NA	M1FPD5	Enterobacteria_phage	51.6	6.3e-17
AYL51298.1|1408450_1408642_+	hypothetical protein	NA	A0A1U8QWK2	Salmonella_phage	60.0	8.4e-07
AYL51299.1|1408634_1408922_+	hypothetical protein	NA	NA	NA	NA	NA
AYL51300.1|1408923_1409112_+	hypothetical protein	NA	A0A1P8DTT1	Salmonella_phage	48.4	2.0e-05
AYL51301.1|1409659_1409911_+	hypothetical protein	NA	A0A2P1MXF0	Escherichia_phage	40.2	5.8e-08
AYL51302.1|1409983_1410241_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	80.3	1.4e-28
AYL51303.1|1410240_1410495_+	hypothetical protein	NA	NA	NA	NA	NA
AYL51304.1|1410694_1411150_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	1.2e-59
AYL51305.1|1411149_1411287_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	93.3	1.6e-15
AYL54929.1|1411316_1411985_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	92.8	5.6e-122
AYL51306.1|1411977_1412589_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	70.0	3.0e-58
AYL51307.1|1412585_1412726_+	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	74.2	3.0e-06
AYL51308.1|1412722_1413412_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.7	2.1e-55
AYL54930.1|1413896_1414112_+|holin	holin	holin	H9C183	Pectobacterium_phage	81.2	1.8e-26
AYL51309.1|1414111_1414603_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.2	7.1e-74
AYL51310.1|1414599_1414989_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.5	6.5e-22
AYL51311.1|1415295_1415820_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	77.6	4.6e-71
AYL51312.1|1415975_1416194_+	hypothetical protein	NA	NA	NA	NA	NA
AYL51313.1|1416359_1416998_+	hypothetical protein	NA	I6S676	Salmonella_phage	92.5	8.2e-115
AYL51314.1|1417028_1417496_+	hypothetical protein	NA	I6S1P9	Salmonella_phage	65.8	4.0e-50
AYL51315.1|1417479_1418778_+|terminase	PBSX family phage terminase large subunit	terminase	Q5G8Y7	Enterobacteria_phage	95.8	2.7e-245
AYL51316.1|1418790_1420260_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.0	1.1e-149
AYL51317.1|1420186_1421188_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.7	3.0e-111
AYL51318.1|1421237_1421720_+	hypothetical protein	NA	NA	NA	NA	NA
AYL51319.1|1421965_1423336_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	52.5	3.5e-123
AYL51320.1|1423335_1423797_+	hypothetical protein	NA	B1GS72	Salmonella_phage	52.3	2.0e-30
AYL51321.1|1423793_1424849_+|coat	phage coat protein	coat	B1GS73	Salmonella_phage	53.9	1.6e-102
AYL51322.1|1424881_1425109_+	hypothetical protein	NA	NA	NA	NA	NA
AYL51323.1|1425111_1425492_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	1.2e-28
AYL51324.1|1425491_1425665_+	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	49.1	1.3e-11
AYL51325.1|1425664_1426015_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	65.2	3.4e-38
AYL51326.1|1426017_1426482_+	hypothetical protein	NA	A0A291AXD9	Shigella_phage	45.5	1.2e-30
AYL51327.1|1426478_1426862_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	63.8	5.2e-40
AYL51328.1|1426925_1427669_+	DNA breaking-rejoining protein	NA	F1C5E5	Cronobacter_phage	85.4	1.3e-71
AYL51329.1|1427726_1428398_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	49.3	2.2e-54
AYL54931.1|1429238_1431503_+|tail	phage tail tape measure protein	tail	A0A1B1W284	Salmonella_phage	51.8	6.9e-148
AYL51330.1|1431502_1432000_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	89.7	3.9e-88
AYL51331.1|1431999_1432470_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.9	4.1e-79
AYL51332.1|1432432_1432849_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	86.0	2.9e-68
AYL51333.1|1432835_1435313_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	87.4	0.0e+00
AYL51334.1|1435941_1436298_+	hypothetical protein	NA	U5P4I9	Shigella_phage	92.5	2.6e-33
AYL51335.1|1436254_1437406_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	1.7e-41
1444703:1444725	attR	TCTTTGTATGTGATCTTACGTGT	NA	NA	NA	NA
>prophage 5
CP024679	Citrobacter freundii strain UMH15 chromosome, complete genome	5343952	1448303	1458341	5343952	tRNA	Tupanvirus(14.29%)	10	NA	NA
AYL51345.1|1448303_1449287_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AYL51346.1|1449302_1451690_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYL51347.1|1451694_1451994_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AYL51348.1|1452147_1453128_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
AYL51349.1|1453188_1453740_+	glutathione peroxidase	NA	NA	NA	NA	NA
AYL51350.1|1453739_1454489_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	7.1e-09
AYL51351.1|1454566_1455031_+	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
AYL51352.1|1455347_1456061_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYL51353.1|1456122_1457565_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	7.7e-52
AYL51354.1|1457561_1458341_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.7	7.9e-11
>prophage 6
CP024679	Citrobacter freundii strain UMH15 chromosome, complete genome	5343952	2131989	2221638	5343952	plate,tail,tRNA,integrase,head,portal,terminase,capsid,protease,holin	Escherichia_phage(20.45%)	107	2190718:2190731	2219652:2219665
AYL51955.1|2131989_2132871_-|protease	protease HtpX	protease	NA	NA	NA	NA
AYL51956.1|2133063_2135112_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.6	1.8e-86
AYL51957.1|2135131_2135818_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYL51958.1|2135914_2136412_-	Free methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AYL51959.1|2136540_2137824_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYL51960.1|2137792_2140426_+	MCE family protein	NA	NA	NA	NA	NA
AYL51961.1|2140505_2141927_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AYL51962.1|2142024_2142264_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AYL51963.1|2142366_2142558_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AYL51964.1|2142558_2143200_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.0	9.6e-55
AYL51965.1|2143612_2143951_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AYL51966.1|2143971_2144844_-	hypothetical protein	NA	NA	NA	NA	NA
AYL51967.1|2144847_2145222_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AYL51968.1|2145365_2145596_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
AYL51969.1|2145702_2146359_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AYL51970.1|2146382_2147045_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	30.6	9.1e-08
AYL51971.1|2147035_2149114_-	oligopeptidase B	NA	NA	NA	NA	NA
AYL51972.1|2149176_2149836_-	DUF533 domain-containing protein	NA	NA	NA	NA	NA
AYL51973.1|2149930_2150284_-	hypothetical protein	NA	NA	NA	NA	NA
AYL51974.1|2150405_2150696_-	damage-inducible protein YebG	NA	NA	NA	NA	NA
AYL51975.1|2150827_2152006_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AYL51976.1|2152073_2152715_-	keto-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
AYL51977.1|2152749_2154561_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AYL51978.1|2154794_2156270_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	8.3e-78
AYL54969.1|2156242_2156422_+	hypothetical protein	NA	NA	NA	NA	NA
AYL54970.1|2156637_2157507_+	transcriptional regulator HexR	NA	NA	NA	NA	NA
AYL51979.1|2157625_2159068_+	pyruvate kinase	NA	NA	NA	NA	NA
AYL51980.1|2159111_2160083_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AYL51981.1|2160202_2161522_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
AYL51982.1|2161537_2162497_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYL51983.1|2162560_2163316_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	6.5e-18
AYL51984.1|2163312_2164098_+	zinc ABC transporter permease	NA	NA	NA	NA	NA
AYL51985.1|2164176_2165187_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.6e-08
AYL51986.1|2165195_2165807_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AYL51987.1|2165887_2166409_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
AYL51988.1|2166443_2167187_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYL51989.1|2167215_2167659_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AYL51990.1|2167660_2169433_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AYL51991.1|2169698_2170265_+	hydrolase	NA	NA	NA	NA	NA
AYL51992.1|2170859_2171249_-	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.9	4.3e-50
AYL51993.1|2172494_2173070_+	hypothetical protein	NA	NA	NA	NA	NA
AYL51994.1|2173066_2173432_+|tail	phage tail protein	tail	A0A0M4S6V4	Salmonella_phage	61.9	2.6e-33
AYL51995.1|2173463_2174528_-	hypothetical protein	NA	NA	NA	NA	NA
AYL51996.1|2174983_2175577_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
AYL51997.1|2175573_2176716_-|plate	phage baseplate protein	plate	A0A0A8WEY6	Clostridium_phage	34.8	4.7e-12
AYL51998.1|2176717_2177155_-	hypothetical protein	NA	B5TK74	Pseudomonas_phage	45.8	4.0e-12
AYL51999.1|2177151_2177694_-|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	30.8	5.9e-05
AYL52000.1|2177732_2178818_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	31.5	7.6e-44
AYL52001.1|2178814_2180218_-	hypothetical protein	NA	NA	NA	NA	NA
AYL52002.1|2180561_2182421_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	31.6	2.9e-19
AYL52003.1|2182562_2182841_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AYL52004.1|2182842_2183214_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYL52005.1|2183217_2184720_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	42.4	1.9e-101
AYL52006.1|2184716_2184914_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AYL52007.1|2184917_2185463_-	ATP-binding protein	NA	NA	NA	NA	NA
AYL52008.1|2185459_2185819_-	hypothetical protein	NA	NA	NA	NA	NA
AYL52009.1|2185823_2186234_-	hypothetical protein	NA	NA	NA	NA	NA
AYL52010.1|2186205_2187255_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	1.6e-51
AYL52011.1|2187352_2187757_-|head	head decoration protein	head	NA	NA	NA	NA
AYL52012.1|2187756_2188347_-	hypothetical protein	NA	NA	NA	NA	NA
AYL52013.1|2188348_2189215_-	serine peptidase	NA	A0A2D1GN02	Marinobacter_phage	37.9	4.8e-49
AYL52014.1|2189211_2190849_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.2	3.3e-91
2190718:2190731	attL	TTGCCAGTTCGCCA	NA	NA	NA	NA
AYL52015.1|2190848_2191112_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AYL52016.1|2191120_2193244_-|terminase	terminase	terminase	A0A0C5ABH4	Bacteriophage	35.6	1.8e-97
AYL52017.1|2193185_2193755_-	hypothetical protein	NA	NA	NA	NA	NA
AYL52018.1|2194045_2194549_+	hypothetical protein	NA	NA	NA	NA	NA
AYL52019.1|2194559_2195198_-	hypothetical protein	NA	NA	NA	NA	NA
AYL52020.1|2195375_2195615_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
AYL52021.1|2195595_2195823_-	hypothetical protein	NA	NA	NA	NA	NA
AYL52022.1|2196546_2196720_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AYL52023.1|2196924_2197155_-	hypothetical protein	NA	NA	NA	NA	NA
AYL54971.1|2197228_2197417_-	cold-shock protein	NA	NA	NA	NA	NA
AYL52024.1|2197427_2197640_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	4.6e-22
AYL54972.1|2198212_2198410_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	90.8	2.2e-26
AYL52025.1|2198800_2199031_-	hypothetical protein	NA	NA	NA	NA	NA
AYL52026.1|2199027_2199561_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	31.2	6.8e-06
AYL52027.1|2199539_2200088_-	lysozyme	NA	K7PM52	Enterobacteria_phage	95.1	8.4e-100
AYL52028.1|2200059_2200338_-|holin	holin	holin	K7PGZ9	Enterobacteria_phage	95.7	4.3e-44
AYL52029.1|2200782_2201316_-	hypothetical protein	NA	NA	NA	NA	NA
AYL52030.1|2201486_2202323_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	78.5	1.7e-123
AYL52031.1|2202319_2202631_-	hypothetical protein	NA	NA	NA	NA	NA
AYL52032.1|2202641_2204000_-	helicase	NA	Q8W640	Enterobacteria_phage	68.7	1.0e-175
AYL52033.1|2203996_2204878_-	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	62.0	1.5e-79
AYL52034.1|2206970_2207309_+	hypothetical protein	NA	NA	NA	NA	NA
AYL52035.1|2207430_2207691_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	58.9	1.3e-18
AYL52036.1|2207834_2208512_+	hypothetical protein	NA	A0A1B5FPF4	Escherichia_phage	76.3	4.3e-98
AYL54973.1|2208840_2209086_+	hypothetical protein	NA	NA	NA	NA	NA
AYL52037.1|2209147_2209435_+	hypothetical protein	NA	NA	NA	NA	NA
AYL54974.1|2209534_2209891_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	50.4	2.4e-23
AYL52038.1|2209874_2210141_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	77.1	4.3e-25
AYL52039.1|2210327_2210834_+	hypothetical protein	NA	F1C5A2	Cronobacter_phage	57.1	1.9e-53
AYL52040.1|2210845_2211676_+	DNA-binding protein	NA	A0A2L1IV39	Escherichia_phage	66.7	1.9e-31
AYL52041.1|2211672_2212239_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	40.0	7.2e-30
AYL52042.1|2212235_2212460_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	68.1	2.9e-19
AYL52043.1|2212456_2213086_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	81.3	4.6e-94
AYL52044.1|2213085_2213397_+	hypothetical protein	NA	NA	NA	NA	NA
AYL54975.1|2213396_2213543_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	79.2	2.8e-18
AYL52045.1|2213552_2213789_+	excisionase	NA	Q8W657	Enterobacteria_phage	93.6	1.6e-39
AYL52046.1|2213844_2215158_+|integrase	integrase	integrase	Q8W658	Enterobacteria_phage	80.7	2.7e-213
AYL52047.1|2215145_2215910_+	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	79.5	1.6e-56
AYL52048.1|2215962_2216358_+	hypothetical protein	NA	NA	NA	NA	NA
AYL52049.1|2216398_2217142_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	31.3	3.2e-25
AYL52050.1|2217138_2218107_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AYL52051.1|2218127_2218316_-	hypothetical protein	NA	NA	NA	NA	NA
AYL52052.1|2218350_2219097_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AYL52053.1|2219099_2219666_-	VOC family protein	NA	NA	NA	NA	NA
2219652:2219665	attR	TTGCCAGTTCGCCA	NA	NA	NA	NA
AYL52054.1|2219904_2221638_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	1.7e-85
>prophage 7
CP024679	Citrobacter freundii strain UMH15 chromosome, complete genome	5343952	2368007	2385716	5343952		Prochlorococcus_phage(16.67%)	16	NA	NA
AYL52211.1|2368007_2369012_+	NAD-dependent epimerase	NA	A0A0K0KW07	Prochlorococcus_phage	31.3	3.6e-16
AYL52212.1|2369070_2370237_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	55.0	1.1e-114
AYL52213.1|2370435_2371842_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	1.8e-37
AYL52214.1|2371969_2372866_-	alpha-1,2-fucosyltransferase	NA	A0A2H4UUT1	Bodo_saltans_virus	31.7	5.7e-29
AYL52215.1|2372877_2373615_-	glycosyl transferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	31.7	1.8e-09
AYL52216.1|2373617_2374781_-	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
AYL52217.1|2374783_2375437_-	hypothetical protein	NA	M1GXE1	Acanthocystis_turfacea_Chlorella_virus	28.3	6.4e-06
AYL52218.1|2375437_2376706_-	O90/O127 family O-antigen flippase	NA	NA	NA	NA	NA
AYL52219.1|2376718_2378095_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.1	8.4e-32
AYL52220.1|2378098_2379547_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.4	1.4e-56
AYL52221.1|2379539_2380040_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AYL52222.1|2380042_2381008_-	GDP-fucose synthetase	NA	D1LW79	Prochlorococcus_phage	50.8	9.3e-86
AYL52223.1|2381011_2382130_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	66.9	1.5e-132
AYL52224.1|2382140_2383169_-	glycosyl transferase	NA	NA	NA	NA	NA
AYL52225.1|2383590_2384484_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.9	6.2e-44
AYL52226.1|2384720_2385716_-	UDP-N-acetylglucosamine 4-epimerase	NA	A0A0K1L6Z1	Scale_drop_disease_virus	28.1	5.5e-09
>prophage 8
CP024679	Citrobacter freundii strain UMH15 chromosome, complete genome	5343952	2429109	2438687	5343952	protease	Bacillus_phage(28.57%)	8	NA	NA
AYL52256.1|2429109_2430513_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	29.2	5.0e-32
AYL52257.1|2430509_2431232_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	1.2e-29
AYL52258.1|2431367_2431700_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AYL52259.1|2431859_2433221_+	U32 family peptidase	NA	Q6DW11	Phage_TP	92.9	4.1e-204
AYL52260.1|2433490_2435767_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
AYL52261.1|2435797_2436118_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
AYL52262.1|2436441_2436666_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AYL52263.1|2436740_2438687_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	1.6e-39
>prophage 9
CP024679	Citrobacter freundii strain UMH15 chromosome, complete genome	5343952	2476837	2485256	5343952	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
AYL52300.1|2476837_2478871_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
AYL52301.1|2479077_2479536_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	68.0	5.1e-50
AYL54981.1|2479578_2480049_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
AYL52302.1|2480095_2480815_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AYL52303.1|2480811_2482497_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
AYL52304.1|2482722_2483454_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.8e-105
AYL52305.1|2483505_2483613_+	hypothetical protein	NA	NA	NA	NA	NA
AYL52306.1|2483593_2484325_-	ABC transporter permease	NA	NA	NA	NA	NA
AYL52307.1|2484308_2485256_-	ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.3	1.7e-07
>prophage 10
CP024679	Citrobacter freundii strain UMH15 chromosome, complete genome	5343952	2840169	2911000	5343952	tail,integrase,terminase,capsid,protease,holin	Salmonella_phage(61.11%)	74	2834473:2834491	2909173:2909191
2834473:2834491	attL	CATGACCACCGAGCTGCAT	NA	NA	NA	NA
AYL52624.1|2840169_2841633_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AYL52625.1|2841756_2842116_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
AYL52626.1|2842149_2842875_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
AYL52627.1|2842946_2844236_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.7	1.7e-63
AYL52628.1|2844332_2844959_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AYL52629.1|2845142_2846573_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AYL52630.1|2846582_2846735_-	hypothetical protein	NA	NA	NA	NA	NA
AYL52631.1|2846868_2847906_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.4	6.3e-72
AYL52632.1|2847902_2848544_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.6	4.5e-28
AYL52633.1|2848758_2850825_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AYL52634.1|2850829_2852371_+	exopolyphosphatase	NA	NA	NA	NA	NA
AYL52635.1|2852350_2854621_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AYL52636.1|2854971_2855175_+	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	71.4	5.6e-17
AYL52637.1|2855539_2856418_+	mechanosensitive ion channel protein MscS	NA	NA	NA	NA	NA
AYL52638.1|2856610_2857366_-	hypothetical protein	NA	NA	NA	NA	NA
AYL52639.1|2857362_2857833_-	hypothetical protein	NA	NA	NA	NA	NA
AYL54997.1|2857936_2859382_-	hypothetical protein	NA	NA	NA	NA	NA
AYL52640.1|2860162_2861824_+	hypothetical protein	NA	NA	NA	NA	NA
AYL52641.1|2861827_2862880_+	hypothetical protein	NA	NA	NA	NA	NA
AYL52642.1|2863016_2864021_+	hypothetical protein	NA	NA	NA	NA	NA
AYL52643.1|2864467_2866306_-	ATP-dependent helicase	NA	NA	NA	NA	NA
AYL52644.1|2866307_2867450_-	hypothetical protein	NA	NA	NA	NA	NA
AYL52645.1|2867455_2868232_-|integrase	integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	52.8	1.7e-66
AYL52646.1|2868631_2869132_-	DUF2514 domain-containing protein	NA	A0A193GYU6	Enterobacter_phage	73.9	1.5e-55
AYL52647.1|2869128_2869755_-	endolysin	NA	Q858F0	Salmonella_phage	96.6	6.8e-114
AYL52648.1|2869744_2870053_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	100.0	2.6e-50
AYL52649.1|2870039_2870444_-	hypothetical protein	NA	T1SA79	Salmonella_phage	100.0	9.9e-66
AYL52650.1|2870597_2873309_-	hypothetical protein	NA	T1S9Y2	Salmonella_phage	73.2	1.2e-95
AYL52651.1|2873504_2873765_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	83.3	1.2e-35
AYL52652.1|2874078_2874765_+	BRO-like protein	NA	G9L6E2	Escherichia_phage	68.1	8.1e-84
AYL52653.1|2874801_2875098_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	95.8	8.9e-48
AYL52654.1|2875102_2875414_-	hypothetical protein	NA	NA	NA	NA	NA
AYL52655.1|2875420_2877895_-	hypothetical protein	NA	T1S9I6	Salmonella_phage	95.6	0.0e+00
AYL52656.1|2877899_2879702_-	hypothetical protein	NA	T1SAQ5	Salmonella_phage	83.0	2.5e-257
AYL52657.1|2879698_2882209_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	83.3	0.0e+00
AYL52658.1|2882221_2882764_-	hypothetical protein	NA	Q858G1	Salmonella_phage	83.9	8.9e-70
AYL52659.1|2882763_2883228_-	hypothetical protein	NA	T1SA73	Salmonella_phage	94.8	4.2e-84
AYL52660.1|2883227_2885705_-	hypothetical protein	NA	Q858G3	Salmonella_phage	97.3	0.0e+00
AYL52661.1|2885704_2886310_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	98.5	1.5e-110
AYL52662.1|2886309_2886633_-	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	64.1	2.0e-32
AYL52663.1|2886684_2886969_-	hypothetical protein	NA	T1SA01	Salmonella_phage	96.8	8.0e-46
AYL52664.1|2886961_2887354_-	hypothetical protein	NA	T1SA71	Salmonella_phage	99.2	1.2e-60
AYL52665.1|2887366_2888374_-|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	93.4	1.2e-181
AYL52666.1|2888384_2889083_-	peptidase	NA	T1SAP9	Salmonella_phage	84.5	3.2e-72
AYL52667.1|2889085_2889382_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	81.6	7.6e-39
AYL52668.1|2889378_2891049_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	96.4	1.2e-306
AYL52669.1|2891063_2891270_-	hypothetical protein	NA	T1SA67	Salmonella_phage	100.0	5.7e-09
AYL52670.1|2891360_2891669_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	70.7	3.2e-08
AYL52671.1|2891972_2892395_+	hypothetical protein	NA	A5VWA1	Enterobacteria_phage	75.0	1.2e-53
AYL52672.1|2892438_2893920_-|terminase	terminase	terminase	M1F3C4	Salmonella_phage	97.2	2.8e-291
AYL52673.1|2893916_2894627_-|terminase	terminase small subunit	terminase	M1F219	Salmonella_phage	82.8	7.0e-99
AYL52674.1|2894649_2894988_-	hypothetical protein	NA	Q858C6	Salmonella_phage	87.5	6.4e-50
AYL52675.1|2894980_2895235_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	47.4	1.3e-07
AYL54998.1|2895227_2895743_-	hypothetical protein	NA	A0A1V0E5M5	Salmonella_phage	52.3	1.7e-33
AYL52676.1|2896351_2896816_-	hypothetical protein	NA	G9L661	Escherichia_phage	84.2	5.3e-71
AYL52677.1|2897573_2898068_-	hypothetical protein	NA	A0A193GYL1	Enterobacter_phage	55.9	1.7e-43
AYL52678.1|2898129_2898474_-	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	97.4	2.4e-60
AYL52679.1|2898591_2899377_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	90.4	2.0e-139
AYL52680.1|2899373_2900144_-	primosomal protein	NA	Q286X4	Escherichia_phage	72.2	8.4e-90
AYL52681.1|2900159_2900360_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	74.2	4.3e-22
AYL52682.1|2900507_2900741_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	100.0	1.2e-39
AYL52683.1|2900896_2901493_+	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	98.0	1.1e-105
AYL52684.1|2901863_2902823_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	75.9	5.5e-54
AYL52685.1|2902830_2903133_+	hypothetical protein	NA	T1SA88	Salmonella_phage	96.0	1.9e-45
AYL52686.1|2903129_2903951_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	97.4	1.1e-159
AYL52687.1|2903947_2904829_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	94.2	2.5e-154
AYL52688.1|2904875_2905124_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	81.7	1.5e-32
AYL52689.1|2905233_2905533_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	99.0	3.1e-48
AYL52690.1|2905525_2905684_+	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	92.3	1.1e-20
AYL52691.1|2905680_2906274_+	adenine methylase	NA	T1SA14	Salmonella_phage	98.5	2.0e-115
AYL52692.1|2906270_2906450_+	hypothetical protein	NA	T1SA82	Salmonella_phage	100.0	2.4e-24
AYL52693.1|2906446_2907700_-|integrase	integrase	integrase	T1S9J3	Salmonella_phage	96.6	5.0e-233
AYL54999.1|2907892_2909470_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
2909173:2909191	attR	CATGACCACCGAGCTGCAT	NA	NA	NA	NA
AYL52694.1|2909533_2911000_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	5.7e-87
>prophage 11
CP024679	Citrobacter freundii strain UMH15 chromosome, complete genome	5343952	3006056	3116342	5343952	plate,tail,tRNA,head,portal,capsid	Salmonella_phage(71.64%)	102	NA	NA
AYL52771.1|3006056_3006794_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
AYL52772.1|3006924_3008253_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.1	2.5e-41
AYL52773.1|3009365_3009749_-	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	70.9	3.6e-33
AYL52774.1|3010066_3010756_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	49.3	7.9e-55
AYL52775.1|3010789_3011869_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AYL52776.1|3012076_3012496_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	36.5	8.3e-15
AYL52777.1|3012565_3013264_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AYL52778.1|3013300_3015961_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AYL52779.1|3016075_3017431_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
AYL55003.1|3017475_3017799_+	hypothetical protein	NA	NA	NA	NA	NA
AYL52780.1|3017795_3019094_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.1	5.3e-44
AYL52781.1|3024924_3027498_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	1.5e-127
AYL52782.1|3027627_3028359_-	laccase domain-containing protein	NA	NA	NA	NA	NA
AYL52783.1|3028355_3029336_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AYL52784.1|3029467_3030205_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AYL52785.1|3030474_3030813_+	ribosomal subunit interface protein	NA	NA	NA	NA	NA
AYL52786.1|3031063_3032224_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AYL52787.1|3032320_3033442_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AYL52788.1|3033452_3034523_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	4.5e-89
AYL52789.1|3034738_3035113_+	hypothetical protein	NA	NA	NA	NA	NA
AYL52790.1|3035271_3035790_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AYL52791.1|3035782_3037009_+	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	37.6	1.1e-06
AYL52792.1|3037021_3037504_+	hypothetical protein	NA	NA	NA	NA	NA
AYL52793.1|3037635_3037983_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AYL52794.1|3038022_3038790_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AYL52795.1|3038834_3039383_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYL52796.1|3039401_3039650_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYL52797.1|3039903_3041265_-	signal recognition particle protein	NA	NA	NA	NA	NA
AYL52798.1|3041430_3042222_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYL52799.1|3042240_3043530_+	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AYL52800.1|3043579_3044173_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYL52801.1|3044169_3044364_-	molecular chaperone GrpE	NA	NA	NA	NA	NA
AYL52802.1|3044295_3045174_+	NAD(+) kinase	NA	NA	NA	NA	NA
AYL52803.1|3045259_3046921_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AYL52804.1|3047070_3047415_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYL52805.1|3047465_3047762_-	RnfH family protein	NA	NA	NA	NA	NA
AYL52806.1|3047745_3048201_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AYL55004.1|3048343_3048826_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.2e-28
AYL52807.1|3049408_3060631_+	large repetitive protein	NA	NA	NA	NA	NA
AYL52808.1|3060731_3062141_+	type I secretion protein TolC	NA	NA	NA	NA	NA
AYL52809.1|3062137_3064324_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	29.8	5.5e-17
AYL55005.1|3064331_3065495_+	secretion protein HlyD	NA	NA	NA	NA	NA
AYL52810.1|3066048_3066267_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
AYL52811.1|3066335_3067436_-	late control protein D	NA	E5G6Q3	Salmonella_phage	95.4	9.3e-191
AYL52812.1|3067432_3067918_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	97.7	2.7e-65
AYL52813.1|3067914_3070851_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	76.2	0.0e+00
AYL52814.1|3070843_3070963_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	6.7e-15
AYL52815.1|3070977_3071280_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	96.0	1.0e-43
AYL52816.1|3071334_3071850_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	96.5	1.3e-89
AYL52817.1|3071859_3073032_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.6	2.5e-210
AYL52818.1|3073115_3073673_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	83.5	2.5e-83
AYL52819.1|3073702_3074083_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	53.8	8.6e-11
AYL52820.1|3074085_3074508_+|tail	phage tail protein	tail	A0A0M4S6V4	Salmonella_phage	76.3	3.1e-25
AYL52821.1|3074479_3074920_-|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	55.5	1.0e-39
AYL52822.1|3074921_3076280_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	72.2	1.6e-136
AYL52823.1|3076276_3076882_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	97.0	1.0e-114
AYL52824.1|3076874_3077783_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	93.4	1.2e-148
AYL52825.1|3077769_3078129_-|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	95.0	1.2e-57
AYL52826.1|3078125_3078704_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.9	4.8e-106
AYL52827.1|3078786_3079992_+	hypothetical protein	NA	NA	NA	NA	NA
AYL52828.1|3080016_3080463_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.5	1.2e-59
AYL52829.1|3080455_3080887_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	89.5	3.5e-69
AYL52830.1|3080849_3081053_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	91.0	1.8e-28
AYL52831.1|3080982_3081411_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	84.3	1.2e-56
AYL52832.1|3081407_3081923_-	lysozyme	NA	E5G6N1	Salmonella_phage	76.5	1.8e-72
AYL52833.1|3081903_3082119_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	66.2	2.0e-20
AYL52834.1|3082122_3082326_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYL52835.1|3082325_3082793_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
AYL52836.1|3082891_3083545_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	55.7	5.7e-55
AYL52837.1|3083548_3084697_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	69.1	1.6e-132
AYL52838.1|3084712_3085513_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	66.7	2.2e-69
AYL52839.1|3088488_3088686_+	hypothetical protein	NA	NA	NA	NA	NA
AYL52840.1|3093888_3094107_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
AYL52841.1|3094175_3095276_-	late control protein D	NA	E5G6Q3	Salmonella_phage	95.4	9.3e-191
AYL52842.1|3095272_3095758_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	97.7	2.7e-65
AYL52843.1|3095754_3098691_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	76.2	0.0e+00
AYL52844.1|3098683_3098803_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	6.7e-15
AYL52845.1|3098817_3099120_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	96.0	1.0e-43
AYL52846.1|3099174_3099690_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	96.5	1.3e-89
AYL52847.1|3099699_3100872_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.6	2.5e-210
AYL52848.1|3100955_3101513_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	83.5	2.5e-83
AYL52849.1|3101891_3102332_+|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	55.5	1.0e-39
AYL52850.1|3102303_3102726_-|tail	phage tail protein	tail	A0A0M4S6V4	Salmonella_phage	76.3	3.1e-25
AYL52851.1|3102728_3104120_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	71.2	8.8e-138
AYL52852.1|3104116_3104722_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	97.0	1.0e-114
AYL52853.1|3104714_3105623_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	93.4	1.2e-148
AYL52854.1|3105609_3105969_-|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	95.0	1.2e-57
AYL52855.1|3105965_3106544_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.9	4.8e-106
AYL52856.1|3106626_3107832_+	hypothetical protein	NA	NA	NA	NA	NA
AYL52857.1|3107856_3108303_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.5	1.2e-59
AYL52858.1|3108295_3108727_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	89.5	3.5e-69
AYL52859.1|3108689_3108893_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	91.0	1.8e-28
AYL52860.1|3108822_3109251_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	84.3	1.2e-56
AYL52861.1|3109247_3109763_-	lysozyme	NA	E5G6N1	Salmonella_phage	76.5	1.8e-72
AYL52862.1|3109743_3109959_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	66.2	2.0e-20
AYL52863.1|3109962_3110166_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYL52864.1|3110165_3110633_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
AYL52865.1|3110731_3111385_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	55.7	5.7e-55
AYL52866.1|3111388_3112537_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	69.1	1.6e-132
AYL52867.1|3112552_3113380_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	67.1	4.5e-73
AYL52868.1|3113529_3115293_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	87.5	2.3e-311
AYL52869.1|3115292_3116342_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	79.5	1.9e-156
>prophage 12
CP024679	Citrobacter freundii strain UMH15 chromosome, complete genome	5343952	3119974	3129389	5343952	integrase	Salmonella_phage(91.67%)	14	3124983:3124996	3129900:3129913
AYL55006.1|3119974_3120163_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
AYL52872.1|3120321_3122730_-	endonuclease	NA	A0A1S6L028	Salmonella_phage	94.8	0.0e+00
AYL52873.1|3122720_3123581_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	77.6	1.5e-124
AYL52874.1|3123577_3123805_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	92.0	3.3e-34
AYL52875.1|3123804_3124038_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	97.4	8.3e-33
AYL52876.1|3124105_3124447_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	87.6	1.3e-50
AYL52877.1|3124526_3124775_+	hypothetical protein	NA	NA	NA	NA	NA
AYL52878.1|3124818_3125154_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	91.1	4.6e-24
3124983:3124996	attL	TGCGCCATGATTTC	NA	NA	NA	NA
AYL52879.1|3125161_3125671_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	97.6	4.0e-88
AYL52880.1|3125703_3125946_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYL52881.1|3126065_3126698_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	59.5	3.1e-66
AYL52882.1|3126700_3127720_+|integrase	integrase	integrase	A0A1S6L016	Salmonella_phage	95.3	4.6e-192
AYL52883.1|3127721_3128732_+	hypothetical protein	NA	NA	NA	NA	NA
AYL52884.1|3129098_3129389_+	hypothetical protein	NA	A0A1V0E8G8	Vibrio_phage	48.1	8.3e-06
3129900:3129913	attR	TGCGCCATGATTTC	NA	NA	NA	NA
>prophage 13
CP024679	Citrobacter freundii strain UMH15 chromosome, complete genome	5343952	3519178	3577758	5343952	transposase,plate	Bacillus_phage(33.33%)	55	NA	NA
AYL53218.1|3519178_3519883_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYL53219.1|3519916_3520345_-	cytochrome C	NA	NA	NA	NA	NA
AYL53220.1|3520373_3521084_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.7e-31
AYL53221.1|3521085_3522291_-	ABC transporter permease	NA	NA	NA	NA	NA
AYL53222.1|3522287_3523439_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYL53223.1|3523435_3524044_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYL53224.1|3524530_3524965_-	copper-binding protein	NA	NA	NA	NA	NA
AYL53225.1|3525180_3526581_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
AYL53226.1|3526577_3527258_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AYL53227.1|3527312_3528242_-	copper resistance protein D	NA	NA	NA	NA	NA
AYL53228.1|3528246_3528627_-	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AYL53229.1|3528666_3529563_-	copper resistance protein B	NA	NA	NA	NA	NA
AYL53230.1|3529562_3531380_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AYL53231.1|3531614_3532064_+	copper resistance protein	NA	NA	NA	NA	NA
AYL53232.1|3532352_3533090_+	peptidase	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
AYL53233.1|3533123_3533321_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AYL53234.1|3533361_3535821_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.9	7.6e-84
AYL53235.1|3535947_3536388_-	hypothetical protein	NA	NA	NA	NA	NA
AYL53236.1|3536474_3539621_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
AYL53237.1|3539631_3540924_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYL53238.1|3541037_3541391_-	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYL53239.1|3541419_3542805_-	hypothetical protein	NA	NA	NA	NA	NA
AYL53240.1|3542867_3542993_-	outer-membrane efflux lipo domain protein	NA	NA	NA	NA	NA
AYL53241.1|3542994_3543675_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.7	7.8e-31
AYL53242.1|3543667_3545143_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.7	1.8e-27
AYL53243.1|3545393_3545825_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AYL53244.1|3546336_3547488_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	1.7e-41
AYL53245.1|3548743_3549847_+	hypothetical protein	NA	NA	NA	NA	NA
AYL53246.1|3550013_3550901_+	GTP-binding protein HSR1	NA	NA	NA	NA	NA
AYL53247.1|3551106_3551508_+	hypothetical protein	NA	NA	NA	NA	NA
AYL53248.1|3551604_3552072_+	hypothetical protein	NA	NA	NA	NA	NA
AYL53249.1|3552628_3553447_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	1.2e-46
AYL53250.1|3553446_3553710_+	hypothetical protein	NA	NA	NA	NA	NA
AYL53251.1|3553706_3554183_+	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	31.8	1.2e-09
AYL55023.1|3554235_3554721_+	hypothetical protein	NA	NA	NA	NA	NA
AYL53252.1|3554732_3554954_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
AYL53253.1|3554922_3555336_+	hypothetical protein	NA	NA	NA	NA	NA
AYL53254.1|3555384_3555762_+	toxin CbtA	NA	NA	NA	NA	NA
AYL53255.1|3555758_3556250_+	hypothetical protein	NA	NA	NA	NA	NA
AYL53256.1|3556279_3556474_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AYL53257.1|3556554_3557403_+	restriction endonuclease subunit M	NA	NA	NA	NA	NA
AYL53258.1|3559088_3559946_+	hypothetical protein	NA	NA	NA	NA	NA
AYL53259.1|3560146_3560626_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AYL53260.1|3560628_3561996_-	hypothetical protein	NA	NA	NA	NA	NA
AYL53261.1|3562006_3565531_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AYL53262.1|3565554_3566976_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AYL53263.1|3566980_3567736_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AYL53264.1|3567732_3570468_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.7	8.2e-87
AYL55024.1|3570476_3571244_-	hypothetical protein	NA	NA	NA	NA	NA
AYL53265.1|3571290_3572634_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AYL53266.1|3572636_3573170_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AYL55025.1|3573166_3574465_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AYL53267.1|3574481_3575528_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYL53268.1|3575494_3577330_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYL53269.1|3577332_3577758_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 14
CP024679	Citrobacter freundii strain UMH15 chromosome, complete genome	5343952	4766131	4809082	5343952	plate,tail,integrase,tRNA,head,portal,terminase,capsid,protease,holin	Shigella_phage(36.0%)	59	4803244:4803259	4815974:4815989
AYL54329.1|4766131_4766674_+	DUF4065 domain-containing protein	NA	A0A139ZPG5	Marinitoga_camini_virus	26.8	5.3e-06
AYL54330.1|4766679_4767141_+	hypothetical protein	NA	NA	NA	NA	NA
AYL54331.1|4767175_4767448_-	pyocin activator protein PrtN	NA	S5MQM5	Escherichia_phage	89.8	6.9e-39
AYL54332.1|4767486_4768059_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	81.6	1.1e-91
AYL54333.1|4768986_4769448_-	hypothetical protein	NA	G9L661	Escherichia_phage	86.8	5.6e-73
AYL54334.1|4769448_4769835_-	hypothetical protein	NA	A0A1R3Y5T1	Salmonella_virus	65.5	6.2e-09
AYL54335.1|4769831_4770086_-	hypothetical protein	NA	NA	NA	NA	NA
AYL54336.1|4770246_4770786_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	79.9	3.6e-79
AYL54337.1|4770914_4771742_-	hypothetical protein	NA	Q8HAA2	Salmonella_phage	90.9	2.5e-140
AYL54338.1|4771798_4772170_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	92.7	1.1e-58
AYL54339.1|4772704_4773379_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	82.5	1.9e-109
AYL54340.1|4773467_4773668_+	transcriptional regulator	NA	U5P445	Shigella_phage	86.2	8.4e-26
AYL54341.1|4773711_4774263_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	67.8	3.0e-65
AYL54342.1|4774435_4774615_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	3.0e-14
AYL54343.1|4774604_4775462_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	96.6	5.9e-60
AYL54344.1|4775458_4776340_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	75.6	1.2e-129
AYL54345.1|4776332_4778267_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.8	1.3e-200
AYL54346.1|4778263_4778650_+	hypothetical protein	NA	A0A192Y8N5	Salmonella_phage	88.4	3.5e-60
AYL54347.1|4778663_4779347_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	60.0	3.0e-62
AYL54348.1|4779343_4780339_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	70.5	3.5e-144
AYL54349.1|4780354_4781185_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	46.9	3.5e-57
AYL54350.1|4781576_4781867_-	hypothetical protein	NA	NA	NA	NA	NA
AYL54351.1|4781855_4782191_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	56.1	1.0e-28
AYL54352.1|4782200_4782815_+	endolysin	NA	Q8HA86	Salmonella_phage	79.8	2.3e-90
AYL54353.1|4783031_4783355_+	Rz1 lytic protein	NA	Q8SBD8	Shigella_phage	74.0	1.7e-36
AYL54354.1|4783384_4783582_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	90.8	4.9e-26
AYL54355.1|4783647_4783998_+	endonuclease	NA	M1FQV2	Enterobacteria_phage	81.9	4.1e-52
AYL54356.1|4784115_4784622_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.7	1.9e-82
AYL54357.1|4784618_4786352_+|terminase	terminase	terminase	Q8HAD6	Salmonella_phage	93.9	0.0e+00
AYL54358.1|4786364_4786547_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	61.0	2.3e-14
AYL54359.1|4786546_4787776_+|portal	phage portal protein	portal	U5P411	Shigella_phage	81.2	8.8e-198
AYL54360.1|4787762_4788416_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	85.0	3.9e-104
AYL55067.1|4788432_4789647_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	77.0	3.9e-174
AYL54361.1|4789992_4790319_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	52.8	2.7e-29
AYL54362.1|4790315_4790729_+|head,tail	head-tail adaptor protein	head,tail	U5P0R0	Shigella_phage	71.5	4.1e-51
AYL54363.1|4790703_4791207_+	hypothetical protein	NA	Q8SBH5	Shigella_phage	89.2	1.0e-80
AYL54364.1|4791206_4791767_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	82.3	6.4e-87
AYL54365.1|4791775_4791952_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	78.9	1.7e-17
AYL54366.1|4791941_4793441_+|tail	phage tail protein	tail	S5FKL0	Shigella_phage	86.2	2.1e-241
AYL54367.1|4793440_4793797_+|tail	phage tail protein	tail	U5P076	Shigella_phage	89.8	8.8e-58
AYL54368.1|4793796_4794066_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	80.9	4.9e-37
AYL54369.1|4794032_4794215_+	hypothetical protein	NA	NA	NA	NA	NA
AYL54370.1|4794207_4795998_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	77.1	6.1e-232
AYL54371.1|4796082_4796577_+	hypothetical protein	NA	NA	NA	NA	NA
AYL54372.1|4796631_4797933_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	71.5	2.1e-181
AYL54373.1|4797929_4799009_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	80.5	3.8e-173
AYL54374.1|4799008_4799557_+|plate	baseplate assembly protein	plate	U5P081	Shigella_phage	78.3	8.1e-79
AYL54375.1|4799553_4799982_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	82.3	1.2e-66
AYL54376.1|4799968_4801027_+|plate	phage baseplate protein	plate	M1FQW3	Enterobacteria_phage	79.2	4.6e-163
AYL54377.1|4801017_4801599_+	hypothetical protein	NA	O22003	Shigella_phage	75.6	5.4e-89
AYL54378.1|4802446_4802815_+|tail	phage tail protein	tail	A0A0M4S6V4	Salmonella_phage	68.6	1.9e-39
AYL54379.1|4802827_4803025_+	hypothetical protein	NA	NA	NA	NA	NA
AYL54380.1|4802979_4803222_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	80.5	2.4e-30
4803244:4803259	attL	ATGGATATACAGTATT	NA	NA	NA	NA
AYL54381.1|4803300_4803690_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	73.6	9.3e-53
AYL54382.1|4803721_4804816_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	84.8	4.8e-179
AYL54383.1|4804903_4805941_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AYL54384.1|4806074_4806317_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
AYL55068.1|4806618_4807602_-	quinone oxidoreductase	NA	NA	NA	NA	NA
AYL54385.1|4807666_4809082_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	77.9	1.8e-199
4815974:4815989	attR	ATGGATATACAGTATT	NA	NA	NA	NA
>prophage 15
CP024679	Citrobacter freundii strain UMH15 chromosome, complete genome	5343952	5270428	5340328	5343952	plate,tail,tRNA,head,transposase	Pseudomonas_phage(36.84%)	84	NA	NA
AYL54790.1|5270428_5270887_-|tRNA	cys-tRNA(pro)/cys-tRNA(cys) deacylase	tRNA	NA	NA	NA	NA
AYL54791.1|5271253_5272597_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AYL54792.1|5272626_5273415_-	hydroxamate siderophore iron reductase FhuF	NA	NA	NA	NA	NA
AYL54793.1|5273523_5274600_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.2	1.5e-20
AYL55080.1|5274855_5275092_+	DUF1435 domain-containing protein	NA	NA	NA	NA	NA
AYL54794.1|5275671_5276703_-	16S rRNA methyltransferase	NA	NA	NA	NA	NA
AYL54795.1|5276806_5277220_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
AYL54796.1|5277188_5277635_+	ribosomal-protein-alanine N-acetyltransferase RimI	NA	NA	NA	NA	NA
AYL54797.1|5277649_5278330_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
AYL54798.1|5278422_5280012_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.1	1.2e-29
AYL54799.1|5280320_5280938_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
AYL54800.1|5281047_5281227_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	1.8e-11
AYL54801.1|5281348_5282422_+	patatin family protein	NA	NA	NA	NA	NA
AYL54802.1|5282418_5283195_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYL54803.1|5283231_5284095_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
AYL54804.1|5284066_5285617_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
AYL54805.1|5285860_5286658_+	2-deoxyribose-5-phosphate aldolase	NA	NA	NA	NA	NA
AYL54806.1|5286770_5288093_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.3	2.6e-78
AYL54807.1|5288144_5289368_+	phosphopentomutase	NA	NA	NA	NA	NA
AYL54808.1|5289471_5290191_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
AYL54809.1|5290341_5291358_-	lipoate-protein ligase LplA	NA	NA	NA	NA	NA
AYL54810.1|5291395_5292037_-	hypothetical protein	NA	NA	NA	NA	NA
AYL54811.1|5292004_5292118_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
AYL54812.1|5292152_5293121_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
AYL54813.1|5293132_5294515_+	DNA repair protein RadA	NA	NA	NA	NA	NA
AYL54814.1|5294603_5295833_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	5.9e-85
AYL54815.1|5295932_5297600_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	2.4e-41
AYL54816.1|5297834_5298026_+	hypothetical protein	NA	NA	NA	NA	NA
AYL54817.1|5297931_5299869_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.2	1.6e-12
AYL54818.1|5299958_5300285_+	trp operon repressor	NA	NA	NA	NA	NA
AYL54819.1|5300340_5300856_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
AYL54820.1|5300908_5301556_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
AYL54821.1|5301552_5302422_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
AYL54822.1|5302633_5303107_+	hypothetical protein	NA	NA	NA	NA	NA
AYL54823.1|5303562_5304123_-	DNA-invertase	NA	K7PJT4	Enterobacteria_phage	72.4	5.2e-73
AYL54824.1|5304328_5304751_+	hypothetical protein	NA	NA	NA	NA	NA
AYL54825.1|5304887_5305256_-|tail	phage tail protein	tail	A0A0M4S6V4	Salmonella_phage	67.8	9.4e-39
AYL54826.1|5306190_5306763_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	37.3	3.4e-27
AYL54827.1|5306759_5307824_-|tail	phage tail protein	tail	A0A0M3LQN4	Mannheimia_phage	43.8	1.7e-64
AYL54828.1|5307823_5308174_-	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	57.4	9.9e-30
AYL54829.1|5308263_5308851_-|plate	phage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	32.9	1.0e-15
AYL54830.1|5308840_5310097_-|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	34.6	2.3e-68
AYL54831.1|5310080_5311412_-	multidrug DMT transporter permease	NA	F6MIL2	Haemophilus_phage	22.4	1.4e-23
AYL54832.1|5311408_5313565_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
AYL54833.1|5313720_5314089_-	hypothetical protein	NA	NA	NA	NA	NA
AYL54834.1|5314088_5314463_-|tail	phage tail protein	tail	F6MIK8	Haemophilus_phage	57.4	1.5e-31
AYL55081.1|5314476_5316189_-	hypothetical protein	NA	A0A2H4JFT7	uncultured_Caudovirales_phage	40.2	1.4e-07
AYL54835.1|5316419_5317085_-	hypothetical protein	NA	B7SDP5	Haemophilus_phage	38.7	3.1e-24
AYL54836.1|5317084_5317513_-	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
AYL54837.1|5317516_5317957_-	hypothetical protein	NA	NA	NA	NA	NA
AYL54838.1|5317956_5318865_-|head	head protein	head	A0A2H4J778	uncultured_Caudovirales_phage	61.9	2.4e-104
AYL54839.1|5318878_5319286_-	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	43.6	1.7e-20
AYL54840.1|5319285_5320398_-	hypothetical protein	NA	A0A2D1GNS3	Pseudomonas_phage	39.6	6.1e-57
AYL54841.1|5320615_5321158_-	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	37.1	1.6e-23
AYL54842.1|5321154_5322408_-|head	phage head morphogenesis protein	head	Q6TM74	Pseudomonas_phage	36.4	7.6e-56
AYL54843.1|5322394_5323972_-	DUF935 domain-containing protein	NA	A0A125RNC0	Pseudomonas_phage	44.9	2.0e-122
AYL54844.1|5323971_5325636_-	hypothetical protein	NA	H6V8N6	Pseudomonas_phage	67.6	2.2e-215
AYL54845.1|5325625_5325835_-	hypothetical protein	NA	NA	NA	NA	NA
AYL54846.1|5325827_5326328_-	DUF1804 domain-containing protein	NA	L7P7Y5	Pseudomonas_phage	53.4	2.6e-47
AYL54847.1|5326330_5326615_-	hypothetical protein	NA	NA	NA	NA	NA
AYL54848.1|5326611_5326854_-	hypothetical protein	NA	NA	NA	NA	NA
AYL54849.1|5326871_5327501_-	hypothetical protein	NA	NA	NA	NA	NA
AYL54850.1|5327466_5327733_-	hypothetical protein	NA	A0A2D1GNW8	Pseudomonas_phage	62.2	1.1e-15
AYL54851.1|5327723_5328374_-	glycoside hydrolase family 19	NA	A0A2D1GNI0	Pseudomonas_phage	61.0	1.5e-63
AYL54852.1|5328456_5328930_-	hypothetical protein	NA	NA	NA	NA	NA
AYL54853.1|5328938_5329376_-	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	45.5	7.0e-25
AYL54854.1|5329427_5329835_-	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	59.0	1.3e-36
AYL54855.1|5329837_5330224_-	hypothetical protein	NA	O64354	Escherichia_phage	36.0	1.5e-07
AYL54856.1|5330211_5330406_-	hypothetical protein	NA	NA	NA	NA	NA
AYL54857.1|5330426_5330978_-	hypothetical protein	NA	NA	NA	NA	NA
AYL54858.1|5330980_5331169_-	hypothetical protein	NA	NA	NA	NA	NA
AYL54859.1|5331373_5331739_-	hypothetical protein	NA	A0A1V0E824	Vibrio_phage	47.8	1.7e-19
AYL54860.1|5331735_5332455_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	34.2	7.8e-29
AYL54861.1|5332535_5332724_-	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	50.8	2.6e-08
AYL54862.1|5332713_5332938_-	hypothetical protein	NA	NA	NA	NA	NA
AYL54863.1|5332939_5333584_-	DUF3164 domain-containing protein	NA	A4JWM8	Burkholderia_virus	60.5	2.2e-67
AYL54864.1|5333573_5333780_-	hypothetical protein	NA	NA	NA	NA	NA
AYL54865.1|5333792_5334071_-	hypothetical protein	NA	NA	NA	NA	NA
AYL54866.1|5334091_5334985_-	ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	57.7	4.0e-91
AYL55082.1|5335030_5337088_-|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	50.3	8.4e-185
AYL54867.1|5337106_5337373_-	transcriptional regulator	NA	NA	NA	NA	NA
AYL54868.1|5337515_5338109_+	hypothetical protein	NA	NA	NA	NA	NA
AYL54869.1|5338101_5338362_+	hypothetical protein	NA	NA	NA	NA	NA
AYL54870.1|5338903_5340328_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.8	2.3e-08
