The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024672	Citrobacter freundii strain HM38 chromosome, complete genome	4899014	1276995	1338127	4899014	integrase,tRNA,plate,tail,terminase,holin,portal	Enterobacteria_phage(18.75%)	72	1270118:1270132	1319123:1319137
1270118:1270132	attL	AACTGCCGGAAAAAG	NA	NA	NA	NA
AYL75091.1|1276995_1278114_-|integrase	integrase	integrase	O21940	Phage_21	43.6	1.7e-78
AYL78399.1|1278088_1278352_-	excisionase	NA	NA	NA	NA	NA
AYL75092.1|1278419_1280891_-	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	38.3	1.1e-109
AYL78400.1|1281032_1281359_-	transcriptional regulator	NA	NA	NA	NA	NA
AYL75093.1|1281419_1281632_-	hypothetical protein	NA	NA	NA	NA	NA
AYL75094.1|1281839_1282277_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	61.2	3.3e-38
AYL78401.1|1282366_1282597_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	61.8	2.1e-20
AYL75095.1|1282599_1283154_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	33.0	1.9e-14
AYL75096.1|1284184_1284775_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	78.4	1.3e-69
AYL75097.1|1284790_1285207_+	hypothetical protein	NA	NA	NA	NA	NA
AYL78402.1|1285212_1285551_+	DNA breaking-rejoining protein	NA	H6WRX9	Salmonella_phage	46.7	1.8e-15
AYL75098.1|1285547_1286288_+	site-specific DNA-methyltransferase	NA	A0A0H5BBV5	Pseudomonas_phage	64.9	1.3e-84
AYL75099.1|1286763_1287522_+	hypothetical protein	NA	NA	NA	NA	NA
AYL75100.1|1287832_1288066_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	98.7	8.6e-38
AYL75101.1|1288111_1288357_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	61.6	1.1e-19
AYL75102.1|1288486_1288687_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	61.5	7.2e-17
AYL75103.1|1288689_1289049_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	65.3	1.0e-42
AYL75104.1|1290099_1290531_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	60.0	2.1e-37
AYL75105.1|1290817_1291030_-	cold-shock protein	NA	NA	NA	NA	NA
AYL75106.1|1291326_1291542_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.6	5.9e-25
AYL75107.1|1292862_1293141_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	100.0	3.9e-45
AYL75108.1|1293112_1293661_+	lysozyme	NA	K7PM52	Enterobacteria_phage	96.2	8.4e-100
AYL75109.1|1293657_1294173_+	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	51.5	1.7e-06
AYL75110.1|1294575_1294788_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	74.3	2.1e-22
AYL78403.1|1294798_1294987_+	cold-shock protein	NA	NA	NA	NA	NA
AYL75111.1|1295060_1295291_+	hypothetical protein	NA	NA	NA	NA	NA
AYL75112.1|1295495_1295669_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AYL78404.1|1295958_1296465_+|terminase	terminase	terminase	K7PJY2	Enterobacterial_phage	63.1	9.0e-48
AYL75113.1|1296468_1298586_+	DNA packaging protein	NA	A0A291AWY5	Escherichia_phage	70.6	1.5e-306
AYL75114.1|1298582_1298798_+	hypothetical protein	NA	NA	NA	NA	NA
AYL75115.1|1298806_1300318_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	54.2	2.4e-149
AYL75116.1|1300274_1302377_+	peptidase S14	NA	S5M7Q8	Escherichia_phage	52.5	3.6e-199
AYL75117.1|1302449_1302785_+	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	46.4	1.2e-13
AYL75118.1|1302784_1303141_+	hypothetical protein	NA	NA	NA	NA	NA
AYL75119.1|1303142_1303799_+	hypothetical protein	NA	R9TR34	Vibrio_phage	35.8	7.8e-20
AYL75120.1|1303810_1304365_+	hypothetical protein	NA	NA	NA	NA	NA
AYL75121.1|1304357_1304975_+|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	36.2	3.0e-13
AYL75122.1|1305013_1306483_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	37.8	2.0e-76
AYL75123.1|1306479_1306986_+|tail	phage tail protein	tail	NA	NA	NA	NA
AYL75124.1|1307044_1307344_+|tail	phage tail assembly protein	tail	Q75QK8	Wolbachia_phage	31.6	7.2e-05
AYL75125.1|1307446_1309372_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	35.4	9.3e-29
AYL75126.1|1309368_1309839_+|tail	phage tail protein	tail	R9TMP6	Vibrio_phage	44.3	1.1e-23
AYL75127.1|1309813_1310029_+|tail	phage tail protein	tail	R9TR63	Vibrio_phage	51.4	9.7e-12
AYL75128.1|1310030_1311149_+	late control protein D	NA	R9TNM7	Vibrio_phage	33.1	5.6e-34
AYL75129.1|1311188_1311542_+|plate	baseplate assembly protein	plate	R9TRM1	Vibrio_phage	54.1	5.0e-21
AYL75130.1|1311525_1312446_+|plate	baseplate assembly protein	plate	A0A088FQL4	Escherichia_phage	49.2	1.3e-65
AYL75131.1|1312435_1312999_+|tail	phage tail protein I	tail	Q6K1H3	Salmonella_virus	36.7	3.1e-25
AYL75132.1|1312991_1314689_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	41.8	1.8e-76
AYL75133.1|1314688_1315267_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	57.1	1.9e-57
AYL75134.1|1315286_1315865_-	serine acetyltransferase	NA	NA	NA	NA	NA
AYL75135.1|1316188_1316302_-	virulence protein	NA	S4TND2	Salmonella_phage	78.4	2.4e-09
AYL75136.1|1318547_1319411_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.8	4.4e-10
1319123:1319137	attR	CTTTTTCCGGCAGTT	NA	NA	NA	NA
AYL75137.1|1319394_1320531_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	40.3	7.2e-29
AYL75138.1|1320781_1322008_+	peptidase T	NA	NA	NA	NA	NA
AYL75139.1|1322110_1323232_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AYL75140.1|1323324_1324788_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AYL75141.1|1324787_1325459_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AYL75142.1|1325623_1326994_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	4.7e-107
AYL78405.1|1326997_1327639_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AYL75143.1|1327673_1328780_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AYL75144.1|1328833_1329295_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AYL75145.1|1329304_1330237_-	hypothetical protein	NA	NA	NA	NA	NA
AYL75146.1|1330271_1330889_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AYL75147.1|1331091_1332342_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	94.4	9.4e-22
AYL75148.1|1332477_1332987_-	DedA family protein	NA	NA	NA	NA	NA
AYL75149.1|1333161_1333404_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
AYL75150.1|1333791_1334490_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	1.3e-89
AYL78406.1|1334575_1334896_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	3.2e-19
AYL75151.1|1334940_1336230_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.4	3.2e-166
AYL75152.1|1336242_1336668_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
AYL75153.1|1336911_1337115_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.2	1.1e-20
AYL78407.1|1337641_1338127_+	hypothetical protein	NA	A0A1B0VBR9	Salmonella_phage	34.9	1.7e-08
>prophage 2
CP024672	Citrobacter freundii strain HM38 chromosome, complete genome	4899014	2072328	2145412	4899014	integrase,tRNA,capsid,holin,protease,tail,terminase,head,portal	Salmonella_phage(23.91%)	88	2105805:2105832	2145543:2145570
AYL75803.1|2072328_2073024_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	A0A0R6PI74	Moraxella_phage	35.4	5.8e-05
AYL75804.1|2073082_2074993_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.1	9.1e-93
AYL75805.1|2075133_2075478_+	RidA family protein	NA	NA	NA	NA	NA
AYL75806.1|2075484_2075664_-	YoaH family protein	NA	NA	NA	NA	NA
AYL75807.1|2075744_2077109_+	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	40.2	8.3e-40
AYL75808.1|2077112_2077691_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
AYL75809.1|2077874_2079239_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AYL75810.1|2079369_2080971_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AYL75811.1|2082995_2083958_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AYL75812.1|2084016_2084817_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AYL75813.1|2084829_2085681_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AYL75814.1|2085741_2086200_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AYL75815.1|2086578_2087199_+	hypothetical protein	NA	NA	NA	NA	NA
AYL75816.1|2087195_2088005_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AYL75817.1|2088068_2089814_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
AYL75818.1|2090033_2090243_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AYL75819.1|2090255_2090399_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AYL75820.1|2090360_2090624_+	hypothetical protein	NA	NA	NA	NA	NA
AYL75821.1|2091035_2091320_-	hypothetical protein	NA	NA	NA	NA	NA
AYL75822.1|2091394_2091538_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
AYL75823.1|2091702_2091942_+	hypothetical protein	NA	NA	NA	NA	NA
AYL75824.1|2092056_2092848_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AYL75825.1|2093022_2094396_+	MFS transporter	NA	NA	NA	NA	NA
AYL75826.1|2094442_2095324_-|protease	protease HtpX	protease	NA	NA	NA	NA
AYL75827.1|2095516_2097565_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	1.2e-87
AYL75828.1|2097584_2098271_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYL75829.1|2098367_2098865_-	Free methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AYL75830.1|2098993_2100277_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYL75831.1|2100245_2102879_+	MCE family protein	NA	NA	NA	NA	NA
AYL75832.1|2102958_2104380_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AYL75833.1|2104477_2104717_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AYL75834.1|2104819_2105011_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AYL75835.1|2105011_2105653_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.5	8.7e-56
2105805:2105832	attL	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
AYL75836.1|2106400_2106910_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
AYL78444.1|2107089_2107581_-	hypothetical protein	NA	K7PM75	Enterobacteria_phage	56.7	1.8e-45
AYL75837.1|2108190_2109135_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	65.2	8.4e-116
AYL75838.1|2109134_2111855_-|tail	phage tail protein	tail	S4TTF5	Salmonella_phage	92.2	0.0e+00
AYL75839.1|2111854_2112253_-	hypothetical protein	NA	S4TR39	Salmonella_phage	91.7	2.7e-68
AYL75840.1|2112259_2112844_-	hypothetical protein	NA	S4TND4	Salmonella_phage	95.4	4.3e-102
AYL75841.1|2112843_2113437_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	94.9	2.0e-107
AYL75842.1|2113603_2113816_+	hypothetical protein	NA	NA	NA	NA	NA
AYL75843.1|2113999_2116474_-|tail	phage tail tape measure protein	tail	K7PM62	Enterobacteria_phage	63.0	2.8e-251
AYL75844.1|2116529_2116817_-	hypothetical protein	NA	NA	NA	NA	NA
AYL75845.1|2116884_2117187_-|tail	phage tail protein	tail	Q9MCU7	Escherichia_phage	61.6	4.7e-28
AYL75846.1|2117171_2117552_-|tail	phage tail protein	tail	K7PJU9	Enterobacteria_phage	77.4	3.4e-44
AYL75847.1|2117604_2118096_-|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	70.8	1.2e-62
AYL75848.1|2118154_2118520_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	69.4	1.7e-48
AYL75849.1|2118516_2119056_-	hypothetical protein	NA	K7PM60	Enterobacteria_phage	86.6	1.5e-80
AYL75850.1|2119048_2119381_-|head,tail	head-tail adaptor protein	head,tail	K7PH08	Enterobacteria_phage	91.8	1.9e-54
AYL75851.1|2119382_2119616_-	hypothetical protein	NA	NA	NA	NA	NA
AYL75852.1|2119685_2120003_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	53.9	3.7e-23
AYL75853.1|2120080_2121319_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	68.0	2.1e-154
AYL75854.1|2121328_2121928_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	83.0	1.2e-91
AYL75855.1|2121920_2123147_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	86.5	6.2e-212
AYL75856.1|2123294_2125052_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	90.7	0.0e+00
AYL75857.1|2125051_2125549_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	73.9	9.7e-63
AYL75858.1|2125705_2126056_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	79.8	3.0e-50
AYL75859.1|2126425_2126821_-	hypothetical protein	NA	NA	NA	NA	NA
AYL75860.1|2126951_2127152_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	75.6	1.6e-13
AYL75861.1|2127108_2127378_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	67.4	4.9e-21
AYL75862.1|2127385_2128000_-	endolysin	NA	Q8HA86	Salmonella_phage	80.9	4.2e-92
AYL75863.1|2128155_2128437_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	47.1	7.0e-18
AYL75864.1|2128423_2128810_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	91.4	1.8e-56
AYL75865.1|2128899_2129088_-	hypothetical protein	NA	NA	NA	NA	NA
AYL75866.1|2129310_2129817_-	hypothetical protein	NA	NA	NA	NA	NA
AYL75867.1|2129828_2130125_-	hypothetical protein	NA	NA	NA	NA	NA
AYL75868.1|2130337_2131168_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	42.8	6.6e-56
AYL75869.1|2131185_2132226_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	50.6	2.3e-98
AYL75870.1|2132222_2132582_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	66.1	6.1e-43
AYL75871.1|2132584_2132785_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	63.1	1.9e-17
AYL75872.1|2132914_2133160_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	63.0	8.5e-20
AYL75873.1|2133205_2133439_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	97.4	2.5e-37
AYL78445.1|2134049_2134493_+	hypothetical protein	NA	NA	NA	NA	NA
AYL78446.1|2134716_2134866_-	DNA-binding protein	NA	NA	NA	NA	NA
AYL75874.1|2135193_2135574_+	hypothetical protein	NA	NA	NA	NA	NA
AYL75875.1|2135817_2135931_-	hypothetical protein	NA	A0A192Y6E0	Salmonella_phage	71.4	2.2e-07
AYL75876.1|2136549_2136750_-	hypothetical protein	NA	NA	NA	NA	NA
AYL75877.1|2136754_2136949_-	hypothetical protein	NA	NA	NA	NA	NA
AYL78447.1|2136945_2137284_-	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	46.7	1.0e-15
AYL75878.1|2137289_2137706_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AYL75879.1|2137721_2138312_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	75.8	1.5e-67
AYL78448.1|2139342_2139897_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	33.5	1.4e-14
AYL75880.1|2139900_2140113_-	XRE family transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	59.7	3.8e-16
AYL75881.1|2140218_2140599_+	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	66.7	6.5e-19
AYL78449.1|2141091_2141418_+	transcriptional regulator	NA	NA	NA	NA	NA
AYL75882.1|2141559_2144031_+	exonuclease	NA	K7P6V4	Enterobacteria_phage	38.0	1.6e-110
AYL75883.1|2144076_2144355_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	40.3	1.9e-12
AYL75884.1|2144332_2145412_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	55.6	2.1e-110
2145543:2145570	attR	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 3
CP024672	Citrobacter freundii strain HM38 chromosome, complete genome	4899014	2231421	2263998	4899014	integrase,capsid,holin,protease,tail,terminase,head	Enterobacterial_phage(30.23%)	53	2223210:2223269	2264057:2264180
2223210:2223269	attL	ACAAAAAAACCACCCGTAGGTGGTTTCACGACACTGCTTATTGCTTTGATTATTCTGTTC	NA	NA	NA	NA
AYL75966.1|2231421_2231820_-	hypothetical protein	NA	S4TR39	Salmonella_phage	91.7	2.7e-68
AYL75967.1|2231826_2232411_-	hypothetical protein	NA	S4TND4	Salmonella_phage	95.4	4.3e-102
AYL75968.1|2232410_2233004_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	94.9	2.0e-107
AYL75969.1|2233170_2233383_+	hypothetical protein	NA	NA	NA	NA	NA
AYL75970.1|2233566_2236041_-|tail	phage tail tape measure protein	tail	K7PM62	Enterobacteria_phage	62.4	5.4e-247
AYL75971.1|2236115_2236634_-	hypothetical protein	NA	NA	NA	NA	NA
AYL75972.1|2236663_2236834_-	hypothetical protein	NA	NA	NA	NA	NA
AYL75973.1|2236896_2237199_-|tail	phage tail protein	tail	Q9MCU7	Escherichia_phage	61.2	8.0e-28
AYL75974.1|2237183_2237564_-|tail	phage tail protein	tail	K7PJU9	Enterobacteria_phage	76.6	1.0e-43
AYL75975.1|2237616_2238108_-|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	70.8	2.8e-62
AYL75976.1|2238166_2238532_-	hypothetical protein	NA	A0A286S1R1	Klebsiella_phage	68.6	3.2e-47
AYL75977.1|2238528_2239068_-	hypothetical protein	NA	K7PM60	Enterobacteria_phage	87.7	2.2e-81
AYL75978.1|2239060_2239393_-|head,tail	head-tail adaptor protein	head,tail	K7PH08	Enterobacteria_phage	90.9	4.2e-54
AYL75979.1|2239394_2239607_-	hypothetical protein	NA	K7PGR0	Enterobacteria_phage	71.4	1.2e-14
AYL75980.1|2239675_2239996_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	38.8	4.1e-14
AYL75981.1|2239992_2240241_-	hypothetical protein	NA	NA	NA	NA	NA
AYL75982.1|2240279_2241488_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	82.7	1.1e-187
AYL75983.1|2241501_2242155_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	85.5	2.3e-104
AYL75984.1|2243369_2243555_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	57.6	2.9e-12
AYL75985.1|2243565_2245323_-|terminase	terminase	terminase	A0A1B5FP96	Escherichia_phage	89.7	0.0e+00
AYL75986.1|2245322_2245820_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	74.5	3.3e-63
AYL75987.1|2245976_2246327_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	79.3	1.7e-50
AYL75988.1|2246314_2246530_-	hypothetical protein	NA	NA	NA	NA	NA
AYL75989.1|2246745_2247096_+	hypothetical protein	NA	NA	NA	NA	NA
AYL75990.1|2247151_2247382_-	hypothetical protein	NA	NA	NA	NA	NA
AYL75991.1|2247359_2247566_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	80.4	3.9e-18
AYL75992.1|2247522_2247792_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	70.1	1.7e-21
AYL75993.1|2247799_2248426_-	endolysin	NA	F1C591	Cronobacter_phage	74.4	4.6e-86
AYL75994.1|2248425_2248707_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	88.2	4.2e-39
AYL75995.1|2248693_2249089_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	81.7	2.6e-50
AYL75996.1|2249227_2249854_+	hypothetical protein	NA	NA	NA	NA	NA
AYL75997.1|2249926_2250505_-	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	56.1	7.8e-48
AYL75998.1|2250519_2251509_-	hypothetical protein	NA	K7PJS6	Enterobacterial_phage	71.7	2.0e-144
AYL75999.1|2251505_2252231_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	52.7	1.7e-55
AYL76000.1|2252247_2252637_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	88.1	1.6e-60
AYL76001.1|2252636_2252855_-	hypothetical protein	NA	NA	NA	NA	NA
AYL76002.1|2252851_2253511_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	76.8	9.7e-95
AYL76003.1|2253510_2253954_-	hypothetical protein	NA	U5P0U0	Shigella_phage	31.1	6.3e-13
AYL76004.1|2253956_2254877_-	transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	85.2	6.2e-63
AYL76005.1|2254839_2255046_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.9	1.2e-14
AYL76006.1|2255286_2255751_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	90.1	5.8e-70
AYL76007.1|2255770_2255974_-	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	83.1	2.8e-24
AYL76008.1|2256073_2256730_+	LexA family transcriptional repressor	NA	K7PLZ5	Enterobacterial_phage	82.6	6.7e-104
AYL76009.1|2258057_2258417_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	72.9	2.4e-39
AYL76010.1|2258416_2259457_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	87.5	2.3e-162
AYL76011.1|2260054_2260264_+	hypothetical protein	NA	NA	NA	NA	NA
AYL76012.1|2260263_2260860_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	47.2	1.1e-12
AYL76013.1|2260861_2261281_+	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	72.6	4.6e-58
AYL76014.1|2261610_2262060_+	hypothetical protein	NA	G5DA83	Enterobacteria_phage	86.7	3.5e-43
AYL76015.1|2262056_2262446_+	chromosome partitioning protein ParB	NA	S4TTI6	Salmonella_phage	77.3	9.9e-55
AYL76016.1|2262448_2262727_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	56.2	2.8e-19
AYL76017.1|2262760_2262988_+	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	88.0	4.6e-36
AYL76018.1|2262987_2263998_+|integrase	integrase	integrase	K7PLZ2	Enterobacterial_phage	86.9	6.1e-173
2264057:2264180	attR	ACAAAAAAACCACCCGTAGGTGGTTTCACGACACTGCTTATTGCTTTGATTATTCTGTTCTTTCCCATGGTACCCGGAGTGGGACTTGAACCCACACAGCGCGAACGCCGAGGGATTTTAAATC	NA	NA	NA	NA
>prophage 4
CP024672	Citrobacter freundii strain HM38 chromosome, complete genome	4899014	2433915	2443493	4899014	protease	Bacillus_phage(28.57%)	8	NA	NA
AYL76179.1|2433915_2435319_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	29.6	3.9e-32
AYL76180.1|2435315_2436038_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
AYL76181.1|2436173_2436506_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AYL76182.1|2436665_2438027_+	U32 family peptidase	NA	Q6DW11	Phage_TP	92.9	5.3e-204
AYL76183.1|2438296_2440573_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
AYL76184.1|2440603_2440924_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
AYL76185.1|2441247_2441472_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AYL76186.1|2441546_2443493_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	2.4e-40
>prophage 5
CP024672	Citrobacter freundii strain HM38 chromosome, complete genome	4899014	2481739	2490158	4899014	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
AYL76220.1|2481739_2483773_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
AYL76221.1|2483979_2484438_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	68.0	5.1e-50
AYL78459.1|2484480_2484951_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
AYL76222.1|2484997_2485717_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AYL76223.1|2485713_2487399_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
AYL76224.1|2487624_2488356_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.8e-105
AYL76225.1|2488407_2488515_+	hypothetical protein	NA	NA	NA	NA	NA
AYL76226.1|2488495_2489227_-	ABC transporter permease	NA	NA	NA	NA	NA
AYL76227.1|2489210_2490158_-	ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.8	2.0e-08
>prophage 6
CP024672	Citrobacter freundii strain HM38 chromosome, complete genome	4899014	2940195	3033906	4899014	integrase,tRNA,plate,capsid,tail,head,portal	Salmonella_phage(70.83%)	88	2999996:3000041	3035050:3035095
AYL76610.1|2940195_2940933_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
AYL76611.1|2941063_2942392_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.1	2.5e-41
AYL76612.1|2943506_2943890_-	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	70.9	3.6e-33
AYL76613.1|2944207_2944897_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	49.3	7.9e-55
AYL76614.1|2944930_2946010_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AYL76615.1|2946217_2946637_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	36.5	8.3e-15
AYL76616.1|2946706_2947405_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AYL76617.1|2947441_2950102_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AYL76618.1|2950216_2951572_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
AYL78477.1|2951616_2951940_+	hypothetical protein	NA	NA	NA	NA	NA
AYL76619.1|2951936_2953235_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.1	4.1e-44
AYL76620.1|2958682_2958964_+	hypothetical protein	NA	NA	NA	NA	NA
AYL76621.1|2959065_2961639_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	1.5e-127
AYL76622.1|2961768_2962500_-	laccase domain-containing protein	NA	NA	NA	NA	NA
AYL76623.1|2962496_2963477_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AYL76624.1|2963608_2964346_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AYL76625.1|2964615_2964954_+	ribosomal subunit interface protein	NA	NA	NA	NA	NA
AYL76626.1|2965204_2966365_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AYL76627.1|2966461_2967583_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AYL76628.1|2967593_2968664_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	4.5e-89
AYL76629.1|2968878_2969253_+	hypothetical protein	NA	NA	NA	NA	NA
AYL76630.1|2969411_2969930_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AYL76631.1|2969922_2971149_+	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	37.6	1.1e-06
AYL76632.1|2971161_2971644_+	hypothetical protein	NA	NA	NA	NA	NA
AYL76633.1|2971775_2972123_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AYL76634.1|2972162_2972930_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AYL76635.1|2972974_2973523_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYL76636.1|2973541_2973790_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYL76637.1|2974039_2975401_-	signal recognition particle protein	NA	NA	NA	NA	NA
AYL76638.1|2975566_2976358_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYL76639.1|2976376_2977666_+	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AYL76640.1|2977715_2978309_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYL76641.1|2978305_2978500_-	molecular chaperone GrpE	NA	NA	NA	NA	NA
AYL76642.1|2978431_2979310_+	NAD(+) kinase	NA	NA	NA	NA	NA
AYL76643.1|2979395_2981057_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AYL76644.1|2981206_2981551_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYL76645.1|2981591_2981897_-	RnfH family protein	NA	NA	NA	NA	NA
AYL76646.1|2981880_2982336_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AYL78478.1|2982478_2982961_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.2e-28
AYL76647.1|2983544_2994740_+	large repetitive protein	NA	NA	NA	NA	NA
AYL76648.1|2994840_2996250_+	type I secretion protein TolC	NA	NA	NA	NA	NA
AYL76649.1|2996246_2998433_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	29.8	3.2e-17
AYL78479.1|2998440_2999604_+	secretion protein HlyD	NA	NA	NA	NA	NA
2999996:3000041	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
AYL76650.1|3000156_3000375_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
AYL76651.1|3000443_3001544_-	late control protein D	NA	E5G6Q3	Salmonella_phage	95.4	9.3e-191
AYL76652.1|3001540_3002026_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	96.9	4.5e-65
AYL76653.1|3005079_3005199_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	6.7e-15
AYL76654.1|3005213_3005516_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	94.0	5.2e-43
AYL76655.1|3005570_3006086_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.2	1.3e-91
AYL76656.1|3006095_3007268_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	94.1	1.5e-210
AYL76657.1|3007490_3008417_+	acyltransferase	NA	NA	NA	NA	NA
AYL76658.1|3008393_3008825_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	46.7	1.3e-31
AYL76659.1|3010370_3010976_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	97.0	6.6e-114
AYL76660.1|3010968_3011877_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	94.0	5.6e-149
AYL76661.1|3011863_3012223_-|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	95.0	5.2e-58
AYL76662.1|3012219_3012798_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	96.9	1.3e-106
AYL78480.1|3012901_3013495_+	hypothetical protein	NA	NA	NA	NA	NA
AYL76663.1|3013528_3013975_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	85.8	2.4e-60
AYL76664.1|3013967_3014399_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	90.9	2.1e-69
AYL76665.1|3014361_3014565_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	95.5	2.8e-29
AYL76666.1|3014494_3014917_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	78.6	4.0e-49
AYL76667.1|3014913_3015429_-	lysozyme	NA	E5G6N1	Salmonella_phage	79.4	1.3e-75
AYL76668.1|3015409_3015625_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	97.2	8.5e-32
AYL76669.1|3015628_3015832_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	98.5	6.5e-34
AYL76670.1|3015831_3016296_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.8	7.9e-83
AYL76671.1|3016389_3017040_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	99.1	1.9e-114
AYL76672.1|3017043_3018108_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.0	1.7e-194
AYL76673.1|3018124_3018958_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.7	1.2e-126
AYL76674.1|3019100_3020867_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	96.3	0.0e+00
AYL76675.1|3020863_3021925_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.5	3.8e-181
AYL76676.1|3021980_3022652_-	hypothetical protein	NA	NA	NA	NA	NA
AYL76677.1|3023163_3023940_-	hypothetical protein	NA	NA	NA	NA	NA
AYL76678.1|3023950_3024370_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
AYL76679.1|3024381_3024930_+	AAA family ATPase	NA	NA	NA	NA	NA
AYL76680.1|3024939_3025311_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	48.4	1.1e-29
AYL76681.1|3025288_3025870_-	hypothetical protein	NA	NA	NA	NA	NA
AYL76682.1|3025870_3026341_-	GNAT family N-acetyltransferase	NA	Q6SE88	Lactobacillus_prophage	41.3	5.4e-23
AYL76683.1|3026722_3026890_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	94.5	6.8e-21
AYL76684.1|3027051_3029460_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	93.8	0.0e+00
AYL76685.1|3029450_3030308_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	79.3	2.5e-127
AYL76686.1|3030304_3030532_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	88.0	3.1e-32
AYL76687.1|3030531_3030765_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	97.4	3.7e-33
AYL76688.1|3030832_3031174_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYL76689.1|3031137_3031338_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	95.5	1.0e-31
AYL76690.1|3031345_3031855_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	99.4	2.8e-89
AYL76691.1|3031887_3032130_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYL76692.1|3032249_3032882_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	96.2	2.2e-112
AYL76693.1|3032883_3033906_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.0	1.1e-193
3035050:3035095	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
