The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033019	Janthinobacterium agaricidamnosum strain BHSEK chromosome, complete genome	6357735	1033086	1062753	6357735	head,portal,tail,terminase,integrase,plate,capsid	Burkholderia_phage(33.33%)	37	1029725:1029755	1065200:1065230
1029725:1029755	attL	ATTCAGTGGTGGAGACGGCGGGAATCGAACC	NA	NA	NA	NA
AYM75172.1|1033086_1034094_+	2-hydroxyacid dehydrogenase	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	45.1	2.7e-64
AYM75173.1|1034196_1035342_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	62.6	5.2e-136
AYM75174.1|1035221_1035500_-	excisionase	NA	NA	NA	NA	NA
AYM75175.1|1035648_1035888_-	hypothetical protein	NA	NA	NA	NA	NA
AYM75176.1|1036030_1037869_-	replication endonuclease	NA	A4JWW0	Burkholderia_virus	42.4	1.9e-108
AYM75177.1|1037858_1038212_-	hypothetical protein	NA	NA	NA	NA	NA
AYM75178.1|1038313_1038715_-	hypothetical protein	NA	NA	NA	NA	NA
AYM75179.1|1038837_1039101_-	transcriptional regulator	NA	A4JWR6	Burkholderia_virus	45.7	2.0e-14
AYM75180.1|1039097_1039286_-	hypothetical protein	NA	NA	NA	NA	NA
AYM75181.1|1039333_1039537_-	hypothetical protein	NA	E5E3U0	Burkholderia_phage	61.0	9.2e-12
AYM75182.1|1039832_1040276_+	XRE family transcriptional regulator	NA	K4NXA8	Burkholderia_phage	50.7	2.8e-29
AYM75183.1|1040272_1040680_+	hypothetical protein	NA	NA	NA	NA	NA
AYM75184.1|1041445_1042690_-	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	48.6	8.0e-82
AYM75185.1|1042686_1043295_-	oxidoreductase	NA	A0A2H4JG54	uncultured_Caudovirales_phage	58.3	6.5e-37
AYM75186.1|1043309_1046186_-|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	49.6	2.2e-231
AYM75187.1|1046213_1046327_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AYM75188.1|1046335_1046644_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	50.5	4.1e-19
AYM75189.1|1046684_1047194_-|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	56.2	8.7e-51
AYM75190.1|1047262_1048438_-|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	68.5	5.3e-152
AYM75191.1|1048475_1048958_-	hypothetical protein	NA	NA	NA	NA	NA
AYM75192.1|1048960_1050520_-	hypothetical protein	NA	A0A0M3ULH6	Salmonella_phage	63.9	7.3e-56
AYM79406.1|1050516_1051116_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	58.4	1.9e-65
AYM75193.1|1051129_1052041_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	55.2	2.1e-79
AYM75194.1|1052037_1052382_-	oxidoreductase	NA	E5E3V5	Burkholderia_phage	53.0	5.5e-25
AYM75195.1|1052378_1053041_-|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	40.4	4.9e-30
AYM79407.1|1053917_1054385_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	50.7	8.9e-34
AYM75196.1|1054381_1054870_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	50.6	6.6e-32
AYM79408.1|1054853_1055342_-	lysozyme	NA	NA	NA	NA	NA
AYM75197.1|1055362_1055923_-	hypothetical protein	NA	G0YQI3	Erwinia_phage	54.0	3.2e-46
AYM75198.1|1055922_1056294_-	hypothetical protein	NA	NA	NA	NA	NA
AYM75199.1|1056358_1056568_-|tail	phage tail protein	tail	D5LGY2	Escherichia_phage	46.3	1.2e-06
AYM75200.1|1056567_1057071_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	49.7	4.0e-32
AYM75201.1|1057166_1057883_-|integrase	integrase	integrase	A4PE31	Ralstonia_virus	46.6	5.0e-44
AYM75202.1|1057882_1058902_-|capsid	phage major capsid protein, P2 family	capsid	A4PE30	Ralstonia_virus	63.1	2.2e-117
AYM75203.1|1058949_1059771_-|capsid	phage capsid protein	capsid	E5FFI7	Burkholderia_phage	48.2	2.6e-57
AYM79409.1|1059874_1061686_+|terminase	terminase	terminase	A4JWQ1	Burkholderia_virus	66.7	1.7e-234
AYM75204.1|1061748_1062753_+|portal	phage portal protein	portal	E5E3X1	Burkholderia_phage	65.7	3.0e-127
1065200:1065230	attR	ATTCAGTGGTGGAGACGGCGGGAATCGAACC	NA	NA	NA	NA
>prophage 2
CP033019	Janthinobacterium agaricidamnosum strain BHSEK chromosome, complete genome	6357735	1404552	1437701	6357735	head,portal,tail,terminase,integrase,plate,capsid	Burkholderia_phage(34.48%)	44	1406740:1406757	1437921:1437938
AYM75463.1|1404552_1405797_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	34.4	8.4e-55
AYM75464.1|1405761_1405941_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AYM75465.1|1405937_1406642_-	hypothetical protein	NA	NA	NA	NA	NA
AYM75466.1|1406679_1406889_-	hypothetical protein	NA	NA	NA	NA	NA
1406740:1406757	attL	GCCGCCGCGCTCTACGGT	NA	NA	NA	NA
AYM79433.1|1406892_1407093_-	hypothetical protein	NA	NA	NA	NA	NA
AYM75467.1|1407182_1407413_-	hypothetical protein	NA	NA	NA	NA	NA
AYM75468.1|1407555_1409394_-	replication endonuclease	NA	A4JWW0	Burkholderia_virus	44.2	1.4e-106
AYM75469.1|1409383_1409761_-	hypothetical protein	NA	NA	NA	NA	NA
AYM75470.1|1409862_1410282_-	hypothetical protein	NA	NA	NA	NA	NA
AYM75471.1|1410403_1410667_-	transcriptional regulator	NA	A4JWR6	Burkholderia_virus	46.9	1.5e-14
AYM75472.1|1410663_1410852_-	hypothetical protein	NA	E5E3T9	Burkholderia_phage	60.3	3.0e-09
AYM75473.1|1410900_1411098_-	hypothetical protein	NA	E5E3U0	Burkholderia_phage	60.4	9.9e-11
AYM75474.1|1411108_1411312_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AYM75475.1|1411385_1411829_+	XRE family transcriptional regulator	NA	K4NXA8	Burkholderia_phage	45.3	2.2e-26
AYM75476.1|1411975_1413100_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	26.7	2.0e-15
AYM75477.1|1413092_1413755_+	hypothetical protein	NA	NA	NA	NA	NA
AYM75478.1|1413812_1415045_-	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	48.9	1.2e-82
AYM75479.1|1415041_1415650_-	oxidoreductase	NA	Q9ZXJ9	Pseudomonas_virus	56.7	1.5e-36
AYM75480.1|1415665_1418518_-|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	48.7	3.3e-224
AYM75481.1|1418545_1418659_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AYM75482.1|1418667_1418976_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	52.1	3.1e-19
AYM75483.1|1419015_1419525_-|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	55.0	8.7e-51
AYM75484.1|1419581_1420757_-|tail	phage tail sheath protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	67.8	4.1e-152
AYM75485.1|1420792_1421275_-	hypothetical protein	NA	NA	NA	NA	NA
AYM75486.1|1421277_1422837_-	hypothetical protein	NA	A0A0M3ULH6	Salmonella_phage	60.8	1.5e-53
AYM79434.1|1422833_1423433_-|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	64.9	8.4e-61
AYM75487.1|1423446_1424358_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	57.0	5.5e-80
AYM75488.1|1424354_1424699_-	oxidoreductase	NA	E5E3V5	Burkholderia_phage	52.1	3.6e-24
AYM75489.1|1424695_1425340_-|plate	phage baseplate assembly protein V	plate	A0A077K9S0	Ralstonia_phage	40.9	4.5e-28
AYM75490.1|1425570_1426686_-	DUF2806 domain-containing protein	NA	NA	NA	NA	NA
AYM75491.1|1426793_1427261_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	52.6	1.0e-34
AYM75492.1|1427257_1427746_-|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	45.6	6.0e-33
AYM79435.1|1427729_1428218_-	lysozyme	NA	NA	NA	NA	NA
AYM75493.1|1428238_1428799_-	hypothetical protein	NA	G0YQI3	Erwinia_phage	54.0	4.2e-46
AYM75494.1|1428798_1429170_-	hypothetical protein	NA	NA	NA	NA	NA
AYM75495.1|1429235_1429451_-|tail	phage tail protein	tail	D5LGY2	Escherichia_phage	45.1	2.1e-06
AYM75496.1|1429450_1429954_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	50.3	3.1e-32
AYM79436.1|1430048_1430765_-|integrase	integrase	integrase	E5FFI5	Burkholderia_phage	45.4	2.3e-41
AYM75497.1|1430764_1431784_-|capsid	phage major capsid protein, P2 family	capsid	A4PE30	Ralstonia_virus	62.6	1.7e-117
AYM75498.1|1431831_1432620_-|capsid	phage capsid protein	capsid	E5FFI7	Burkholderia_phage	47.3	7.4e-57
AYM79437.1|1432756_1434568_+|terminase	terminase	terminase	A4JWQ1	Burkholderia_virus	66.8	7.7e-235
AYM75499.1|1434483_1435620_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	62.1	3.8e-131
AYM75500.1|1435616_1435832_+	hypothetical protein	NA	NA	NA	NA	NA
AYM75501.1|1437017_1437701_+	SOS response-associated peptidase	NA	A0A218MNF5	uncultured_virus	44.8	1.3e-38
1437921:1437938	attR	ACCGTAGAGCGCGGCGGC	NA	NA	NA	NA
>prophage 3
CP033019	Janthinobacterium agaricidamnosum strain BHSEK chromosome, complete genome	6357735	3259972	3267311	6357735	coat,terminase	Pseudomonas_phage(83.33%)	7	NA	NA
AYM76909.1|3259972_3261307_-|coat	P22 coat - protein 5 family protein	coat	W6EBZ8	Rhizobium_phage	49.6	1.6e-88
AYM76910.1|3261463_3262261_-	hypothetical protein	NA	A0A0S2SY92	Pseudomonas_phage	50.9	1.8e-47
AYM76911.1|3262445_3262715_-	hypothetical protein	NA	NA	NA	NA	NA
AYM76912.1|3263491_3264853_-	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	45.2	7.4e-97
AYM76913.1|3264867_3266193_-|terminase	terminase	terminase	A0A1B0VP58	Pseudomonas_phage	71.6	8.6e-183
AYM76914.1|3266161_3266638_-	DUF2280 domain-containing protein	NA	A0A1B0VMH2	Pseudomonas_phage	61.4	4.6e-46
AYM76915.1|3266669_3267311_-	hypothetical protein	NA	A0A125RNL5	Pseudomonas_phage	63.9	6.6e-72
>prophage 4
CP033019	Janthinobacterium agaricidamnosum strain BHSEK chromosome, complete genome	6357735	3288592	3302213	6357735	integrase	Pseudomonas_phage(36.36%)	17	3299402:3299417	3306519:3306534
AYM76944.1|3288592_3289738_+	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	58.4	5.9e-71
AYM76945.1|3289734_3290382_+	hypothetical protein	NA	F8TUK8	EBPR_podovirus	38.7	5.5e-26
AYM76946.1|3290378_3291650_+	hypothetical protein	NA	F8TUK9	EBPR_podovirus	37.9	1.2e-16
AYM79605.1|3291969_3292392_+	hypothetical protein	NA	NA	NA	NA	NA
AYM76947.1|3292388_3292637_+	hypothetical protein	NA	NA	NA	NA	NA
AYM76948.1|3292633_3293269_+	hypothetical protein	NA	A0A076G7C3	Sinorhizobium_phage	40.3	4.0e-37
AYM76949.1|3293297_3293711_+	hypothetical protein	NA	K4NZ61	Pseudomonas_phage	34.6	1.9e-11
AYM76950.1|3295021_3295360_+	hypothetical protein	NA	NA	NA	NA	NA
AYM76951.1|3295486_3295723_-	hypothetical protein	NA	NA	NA	NA	NA
AYM76952.1|3295810_3296527_+	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	37.6	7.2e-27
AYM76953.1|3296532_3296895_+	hypothetical protein	NA	NA	NA	NA	NA
AYM76954.1|3296891_3298646_+	DEAD/DEAH box helicase	NA	A0A2K8IBK8	Pseudomonas_phage	59.7	9.6e-198
AYM76955.1|3298774_3299095_+	hypothetical protein	NA	Q7Y3W7	Yersinia_phage	33.3	3.6e-10
AYM76956.1|3299091_3299334_+	hypothetical protein	NA	NA	NA	NA	NA
3299402:3299417	attL	GTGGCGGCGCTGGGCG	NA	NA	NA	NA
AYM76957.1|3299607_3300612_+|integrase	site-specific integrase	integrase	A0A0U4IBS1	Pseudomonas_phage	35.8	7.6e-06
AYM76958.1|3300856_3301573_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.7	3.7e-39
AYM76959.1|3301775_3302213_-	ribonuclease HI	NA	A0A1P8DJF0	Virus_Rctr71	48.2	7.8e-32
3306519:3306534	attR	CGCCCAGCGCCGCCAC	NA	NA	NA	NA
>prophage 5
CP033019	Janthinobacterium agaricidamnosum strain BHSEK chromosome, complete genome	6357735	5382518	5436512	6357735	head,portal,tail,terminase,integrase,plate,capsid,tRNA	Burkholderia_phage(26.47%)	58	5383292:5383338	5416716:5416762
AYM78578.1|5382518_5383199_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
5383292:5383338	attL	TGGAGCGGGTGAAGGGAATCGAACCCTCGTCGTAAGCTTGGGAAGCT	NA	NA	NA	NA
AYM78579.1|5383358_5383571_+	hypothetical protein	NA	NA	NA	NA	NA
AYM78580.1|5383672_5384713_+	hypothetical protein	NA	NA	NA	NA	NA
AYM79799.1|5384678_5385332_+	NADAR family protein	NA	E3PZ47	Roseovarius_sp._217_phage	34.9	2.8e-09
AYM78581.1|5385744_5385960_-	hypothetical protein	NA	NA	NA	NA	NA
AYM78582.1|5385956_5387021_-|portal	phage portal protein	portal	E5E3X1	Burkholderia_phage	64.2	1.4e-127
AYM79800.1|5387017_5388829_-|terminase	terminase	terminase	A4JWQ1	Burkholderia_virus	66.8	2.7e-235
AYM78583.1|5388965_5389754_+|capsid	phage capsid protein	capsid	E5FFI7	Burkholderia_phage	49.1	4.3e-57
AYM78584.1|5389801_5390821_+|capsid	phage major capsid protein, P2 family	capsid	A4PE30	Ralstonia_virus	63.2	1.1e-118
AYM78585.1|5390820_5391537_+|integrase	integrase	integrase	A4JWP8	Burkholderia_virus	45.5	9.4e-43
AYM78586.1|5391644_5392148_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	49.7	4.0e-32
AYM78587.1|5392147_5392363_+|tail	phage tail protein	tail	D5LGY2	Escherichia_phage	47.8	1.2e-06
AYM78588.1|5392427_5392799_+	hypothetical protein	NA	NA	NA	NA	NA
AYM78589.1|5392798_5393359_+	hypothetical protein	NA	A0A0B5KTG2	Acinetobacter_phage	50.8	2.5e-43
AYM78590.1|5393355_5393868_+	lysozyme	NA	NA	NA	NA	NA
AYM78591.1|5393851_5394340_+|tail	phage tail protein	tail	E5FFH7	Burkholderia_phage	52.7	1.5e-31
AYM78592.1|5394336_5394804_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	50.7	1.5e-33
AYM79801.1|5396269_5396932_+|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	38.2	1.0e-27
AYM78593.1|5396928_5397273_+	oxidoreductase	NA	E5E3V5	Burkholderia_phage	52.1	1.2e-24
AYM78594.1|5397269_5398181_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	55.5	2.7e-79
AYM79802.1|5398194_5398794_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	60.9	1.6e-67
AYM78595.1|5400352_5400835_+	hypothetical protein	NA	NA	NA	NA	NA
AYM78596.1|5400868_5402044_+|tail	phage tail sheath protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	67.0	4.2e-149
AYM78597.1|5402097_5402607_+|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	55.6	2.5e-50
AYM78598.1|5402641_5402950_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	52.1	3.1e-19
AYM78599.1|5402958_5403072_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AYM78600.1|5403102_5405952_+|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	48.3	6.9e-222
AYM78601.1|5405968_5406577_+	oxidoreductase	NA	A0A2H4JG54	uncultured_Caudovirales_phage	57.6	1.1e-36
AYM78602.1|5406573_5407845_+	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	48.9	2.2e-82
AYM78603.1|5407938_5408187_-	hypothetical protein	NA	NA	NA	NA	NA
AYM78604.1|5408393_5408723_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
AYM78605.1|5408667_5409114_-	XRE family transcriptional regulator	NA	K4NXA8	Burkholderia_phage	44.3	5.0e-26
AYM78606.1|5409426_5409624_+	hypothetical protein	NA	E5E3U0	Burkholderia_phage	52.3	2.3e-12
AYM78607.1|5409663_5409858_+	hypothetical protein	NA	NA	NA	NA	NA
AYM78608.1|5409854_5410118_+	transcriptional regulator	NA	A4JWR6	Burkholderia_virus	46.9	2.0e-14
AYM78609.1|5410241_5410655_+	hypothetical protein	NA	NA	NA	NA	NA
AYM78610.1|5410756_5411134_+	hypothetical protein	NA	NA	NA	NA	NA
AYM78611.1|5411123_5412962_+	replication endonuclease	NA	A4JWW0	Burkholderia_virus	44.4	9.0e-106
AYM78612.1|5413104_5413344_+	hypothetical protein	NA	NA	NA	NA	NA
AYM79803.1|5413409_5413955_+	hypothetical protein	NA	NA	NA	NA	NA
AYM78613.1|5413965_5414190_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AYM78614.1|5414167_5415199_+|integrase	integrase	integrase	C8CLF4	Xylella_phage	45.1	2.3e-58
AYM78615.1|5415217_5416375_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	28.2	4.2e-08
AYM78616.1|5417035_5417908_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.6	1.2e-28
5416716:5416762	attR	TGGAGCGGGTGAAGGGAATCGAACCCTCGTCGTAAGCTTGGGAAGCT	NA	NA	NA	NA
AYM78617.1|5417947_5418493_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.4	2.9e-52
AYM78618.1|5418537_5419431_-	glucose-1-phosphate thymidylyltransferase	NA	K7QKA7	Escherichia_phage	62.9	9.4e-101
AYM78619.1|5419430_5420510_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.5	7.2e-87
AYM78620.1|5420780_5422361_-	sel1 repeat family protein	NA	NA	NA	NA	NA
AYM78621.1|5422357_5424562_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AYM78622.1|5424567_5426733_-	HDOD domain-containing protein	NA	A0A1V0SGX0	Hokovirus	29.9	2.8e-05
AYM78623.1|5426924_5428133_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
AYM78624.1|5428404_5429574_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
AYM78625.1|5429824_5430439_-	2-hydroxychromene-2-carboxylate isomerase	NA	NA	NA	NA	NA
AYM78626.1|5430449_5430887_-	CopD family protein	NA	NA	NA	NA	NA
AYM79804.1|5430957_5432229_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.6	7.2e-86
AYM78627.1|5432252_5433269_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AYM78628.1|5433279_5433870_-	hypothetical protein	NA	NA	NA	NA	NA
AYM78629.1|5433872_5436512_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.0	3.0e-171
