The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033096	Escherichia coli strain CP53 chromosome, complete genome	4623817	1034008	1047191	4623817		Escherichia_phage(40.0%)	12	NA	NA
AYN89036.1|1034008_1034770_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AYN89037.1|1034763_1035390_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AYN89038.1|1035529_1036669_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AYN89039.1|1036731_1037724_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AYN89040.1|1037817_1039182_-	GntP family transporter	NA	NA	NA	NA	NA
AYN89041.1|1039270_1040047_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AYN89042.1|1040051_1040690_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AYN89043.1|1040686_1041949_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	8.3e-135
AYN89044.1|1041945_1042854_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AYN89045.1|1043049_1043817_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
AYN89046.1|1043867_1044524_-	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.8	3.3e-50
AYN89047.1|1044629_1047191_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
CP033096	Escherichia coli strain CP53 chromosome, complete genome	4623817	1385172	1472591	4623817	tail,lysis,terminase,head,transposase,tRNA,capsid,protease,holin,portal	Enterobacteria_phage(40.91%)	103	NA	NA
AYN89341.1|1385172_1386096_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	3.8e-177
AYN89342.1|1386977_1388123_+	acetyl-CoA--oxalate CoA-transferase	NA	NA	NA	NA	NA
AYN89343.1|1388178_1391772_-	sensor protein EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
AYN89344.1|1391776_1392391_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYN89345.1|1392806_1393970_+	multidrug resistance protein EmrK	NA	NA	NA	NA	NA
AYN89346.1|1393969_1395508_+	multidrug resistance protein EmrY	NA	NA	NA	NA	NA
AYN89347.1|1395615_1396944_-	D-serine dehydratase	NA	NA	NA	NA	NA
AYN89348.1|1396961_1398299_-	DsdX permease	NA	NA	NA	NA	NA
AYN89349.1|1398516_1399452_+	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
AYN89350.1|1399635_1399836_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AYN89351.1|1399893_1400061_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	3.7e-27
AYN92234.1|1399993_1400197_+	hypothetical protein	NA	NA	NA	NA	NA
AYN89352.1|1400161_1400794_-	DUF551 domain-containing protein	NA	A5VWB3	Enterobacteria_phage	60.6	5.0e-64
AYN89353.1|1400790_1400958_-	DUF2737 family protein	NA	K7PJY9	Enterobacterial_phage	100.0	1.3e-24
AYN89354.1|1400974_1401289_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
AYN89355.1|1401300_1401783_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	99.4	8.4e-80
AYN89356.1|1401766_1402678_-	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	99.0	4.8e-169
AYN89357.1|1402674_1402983_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
AYN89358.1|1403067_1403220_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.4e-20
AYN89359.1|1403204_1403339_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	97.7	1.2e-15
AYN89360.1|1403573_1403756_-	hypothetical protein	NA	K7PLQ2	Enterobacteria_phage	96.7	3.0e-30
AYN89361.1|1404046_1404409_-	antitermination protein	NA	G9L671	Escherichia_phage	84.3	1.1e-50
AYN89362.1|1404852_1405473_-	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	100.0	3.3e-52
AYN89363.1|1405469_1405904_-	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	100.0	1.2e-77
AYN89364.1|1406005_1406710_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	99.6	1.9e-133
AYN89365.1|1406823_1407057_+	transcriptional regulator	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
AYN89366.1|1407193_1407490_+	hypothetical protein	NA	Q9MCQ0	Enterobacteria_phage	100.0	1.8e-48
AYN89367.1|1407670_1408561_+	DNA replication protein	NA	G5DA89	Enterobacteria_phage	99.7	3.4e-159
AYN89368.1|1408535_1409987_+	helicase DnaB	NA	Q7Y2K5	Escherichia_phage	99.4	8.6e-277
AYN89369.1|1410068_1410680_+	hypothetical protein	NA	A0A2I6PIF0	Escherichia_phage	100.0	5.6e-113
AYN89370.1|1410740_1410968_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	52.9	6.7e-11
AYN89371.1|1410960_1411383_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	80.7	4.8e-63
AYN89372.1|1411379_1411907_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
AYN89373.1|1411903_1412086_+	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
AYN89374.1|1412082_1412253_+	protein ninF	NA	K7P6X0	Enterobacteria_phage	100.0	5.5e-26
AYN89375.1|1412245_1412971_+	DNA-binding protein	NA	A0A2I6PIF5	Escherichia_phage	98.8	1.0e-129
AYN89376.1|1412970_1413261_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	1.0e-51
AYN89377.1|1413257_1413620_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	98.3	7.8e-62
AYN89378.1|1413616_1413805_+	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
AYN89379.1|1413801_1414425_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	8.9e-114
AYN92235.1|1414566_1414749_-	hypothetical protein	NA	A0A088CPS7	Enterobacteria_phage	94.9	1.0e-25
AYN89380.1|1414859_1415183_+|holin	phage holin, lambda family	holin	K7PH31	Enterobacteria_phage	99.1	1.1e-51
AYN89381.1|1415166_1415643_+	lysozyme	NA	K7P7Y6	Enterobacteria_phage	100.0	7.5e-89
AYN89382.1|1415626_1416088_+|lysis	lysis protein	lysis	K7P735	Enterobacteria_phage	99.3	2.9e-77
AYN89383.1|1416286_1416805_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	100.0	3.2e-93
AYN89384.1|1417218_1417569_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	1.5e-62
AYN89385.1|1417685_1418189_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.0e-88
AYN89386.1|1418185_1419919_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.8	0.0e+00
AYN89387.1|1419930_1420113_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	6.5e-25
AYN89388.1|1420112_1421354_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
AYN89389.1|1421295_1421982_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	1.1e-125
AYN89390.1|1421996_1423202_+|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	98.0	8.0e-220
AYN89391.1|1423252_1423441_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	95.2	3.9e-25
AYN89392.1|1423452_1423758_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	87.1	3.9e-38
AYN89393.1|1423767_1424106_+|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	84.8	4.6e-48
AYN89394.1|1424102_1424552_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	78.5	7.4e-62
AYN89395.1|1424548_1424893_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
AYN89396.1|1424952_1425657_+|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	91.0	3.0e-110
AYN89397.1|1425656_1426043_+|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	99.2	2.6e-63
AYN92236.1|1426084_1426345_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	7.8e-40
AYN89398.1|1426390_1429591_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	93.5	0.0e+00
AYN89399.1|1429568_1429925_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
AYN89400.1|1429924_1430623_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	1.2e-132
AYN89401.1|1430628_1431372_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.4e-150
AYN89402.1|1431269_1431917_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	4.4e-108
AYN89403.1|1431977_1435460_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	88.9	0.0e+00
AYN89404.1|1435526_1436126_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	1.2e-110
AYN89405.1|1436190_1437213_+	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	92.1	6.0e-59
AYN89406.1|1437229_1438549_+	hypothetical protein	NA	A0A1I9KFH7	Aeromonas_phage	58.2	4.2e-105
AYN89407.1|1438746_1439127_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
AYN89408.1|1439404_1439569_-	hypothetical protein	NA	NA	NA	NA	NA
AYN89409.1|1439571_1439685_-	virulence protein	NA	S4TND2	Salmonella_phage	83.8	4.7e-10
AYN89410.1|1439712_1440870_-	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	99.5	1.8e-221
AYN89411.1|1441181_1442114_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	98.7	5.7e-165
AYN89412.1|1442211_1442382_+	hypothetical protein	NA	NA	NA	NA	NA
AYN89413.1|1442407_1443163_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AYN89414.1|1443344_1444403_-	hypothetical protein	NA	NA	NA	NA	NA
AYN89415.1|1444768_1446109_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AYN89416.1|1446480_1446765_+	DUF406 family protein	NA	NA	NA	NA	NA
AYN89417.1|1446945_1448256_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AYN89418.1|1448255_1450400_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AYN89419.1|1450602_1451088_+	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AYN89420.1|1451768_1452332_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYN89421.1|1455078_1455831_+	fimbrial chaperone	NA	NA	NA	NA	NA
AYN89422.1|1455830_1456343_+	hypothetical protein	NA	NA	NA	NA	NA
AYN89423.1|1456339_1456828_+	fimbrial protein	NA	NA	NA	NA	NA
AYN89424.1|1456824_1457364_+	fimbrial protein	NA	NA	NA	NA	NA
AYN89425.1|1457365_1458187_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
AYN89426.1|1458257_1458809_-	endonuclease SmrB	NA	NA	NA	NA	NA
AYN89427.1|1458974_1459907_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AYN89428.1|1459941_1461027_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.5	2.7e-89
AYN89429.1|1461030_1461855_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AYN89430.1|1461854_1462664_+	hypothetical protein	NA	NA	NA	NA	NA
AYN89431.1|1462663_1463212_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AYN89432.1|1463245_1463524_+	YfcL family protein	NA	NA	NA	NA	NA
AYN89433.1|1463644_1465651_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AYN89434.1|1465809_1467030_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
AYN92237.1|1467131_1467353_-	hypothetical protein	NA	NA	NA	NA	NA
AYN89435.1|1467294_1468473_+	MFS transporter	NA	NA	NA	NA	NA
AYN89436.1|1468469_1469465_-	flagella biosynthesis regulator	NA	NA	NA	NA	NA
AYN89437.1|1469563_1470700_+	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
AYN89438.1|1470765_1471779_+	USG-1 protein	NA	NA	NA	NA	NA
AYN89439.1|1471778_1472591_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 3
CP033096	Escherichia coli strain CP53 chromosome, complete genome	4623817	1685375	1694817	4623817		Enterobacteria_phage(85.71%)	10	NA	NA
AYN89618.1|1685375_1686302_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
AYN89619.1|1686306_1687038_+	ABC transporter permease	NA	NA	NA	NA	NA
AYN89620.1|1687018_1687126_-	protein YohO	NA	NA	NA	NA	NA
AYN89621.1|1687185_1687917_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AYN89622.1|1688138_1689824_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AYN89623.1|1689820_1690540_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYN89624.1|1690586_1691057_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AYN89625.1|1691097_1691559_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
AYN89626.1|1691683_1693684_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
AYN89627.1|1693680_1694817_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.0e-160
>prophage 4
CP033096	Escherichia coli strain CP53 chromosome, complete genome	4623817	2212759	2253715	4623817	integrase,transposase,protease	Escherichia_phage(50.0%)	48	2212723:2212782	2249803:2251002
2212723:2212782	attL	GCTAGGGAAGGTGCGAACAAGTCCCTGATATGAGATCATGTTTGTCATCTGGAGCCATAG	NA	NA	NA	NA
AYN90094.1|2212759_2213776_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AYN90095.1|2214030_2214201_+	hypothetical protein	NA	NA	NA	NA	NA
AYN90096.1|2214307_2214673_+	multidrug transporter subunit MdtJ	NA	NA	NA	NA	NA
AYN90097.1|2214659_2214989_+	spermidine export protein MdtI	NA	NA	NA	NA	NA
AYN90098.1|2215027_2215849_-|protease	serine protease	protease	NA	NA	NA	NA
AYN90099.1|2215948_2216032_-	hypothetical protein	NA	NA	NA	NA	NA
AYN90100.1|2216124_2216460_-	acid shock protein	NA	NA	NA	NA	NA
AYN90101.1|2216856_2218110_-	MFS transporter	NA	NA	NA	NA	NA
AYN90102.1|2218216_2219110_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYN90103.1|2219244_2220465_+	protein mlc	NA	NA	NA	NA	NA
AYN90104.1|2220589_2221285_+	dethiobiotin synthase	NA	NA	NA	NA	NA
AYN90105.1|2221237_2222530_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AYN90106.1|2222688_2223303_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AYN90107.1|2223345_2224200_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AYN90108.1|2224201_2224819_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AYN92269.1|2224829_2227253_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	4.8e-208
AYN90109.1|2227313_2228480_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	46.9	1.6e-84
AYN90110.1|2228669_2230028_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AYN90111.1|2230312_2231526_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
AYN90112.1|2231644_2232112_+	hypothetical protein	NA	NA	NA	NA	NA
AYN92270.1|2232652_2232934_+	hypothetical protein	NA	NA	NA	NA	NA
AYN90113.1|2232923_2233424_+	hypothetical protein	NA	NA	NA	NA	NA
AYN90114.1|2233700_2234192_+	hypothetical protein	NA	NA	NA	NA	NA
AYN90115.1|2234276_2235263_+	hypothetical protein	NA	NA	NA	NA	NA
AYN90116.1|2235717_2235918_+	hypothetical protein	NA	NA	NA	NA	NA
AYN90117.1|2236060_2237518_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	1.3e-120
AYN90118.1|2237716_2238022_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AYN92271.1|2238129_2238810_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AYN90119.1|2238842_2239403_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AYN90120.1|2239437_2239779_-	DUF1283 family protein	NA	NA	NA	NA	NA
AYN90121.1|2239913_2240240_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AYN90122.1|2240445_2241660_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AYN90123.1|2241671_2242691_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	3.7e-16
AYN90124.1|2242748_2242859_+	transporter	NA	NA	NA	NA	NA
AYN90125.1|2242878_2244174_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.1	7.4e-155
AYN90126.1|2244193_2244445_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AYN90127.1|2244517_2246989_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
AYN90128.1|2247082_2247274_-	DUF1482 family protein	NA	NA	NA	NA	NA
AYN90129.1|2247270_2247459_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AYN90130.1|2247874_2248162_+	hypothetical protein	NA	NA	NA	NA	NA
AYN92272.1|2248130_2248496_-	hypothetical protein	NA	NA	NA	NA	NA
AYN90131.1|2248507_2248660_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
AYN90132.1|2248852_2249311_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.8e-24
AYN90133.1|2249337_2249565_+	transcriptional regulator	NA	NA	NA	NA	NA
AYN90134.1|2249839_2250856_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AYN90135.1|2251923_2252103_+	hypothetical protein	NA	NA	NA	NA	NA
2249803:2251002	attR	GCTAGGGAAGGTGCGAACAAGTCCCTGATATGAGATCATGTTTGTCATCTGGAGCCATAGAACAGGGTTCATCATGAGTCATCAACTTACCTTCGCCGACAGTGAATTCAGCAGTAAGCGCCGTCAGACCAGAAAAGAGATTTTCTTGTCCCGCATGGAGCAGATTCTGCCATGGCAAAACATGGTGGAAGTCATCGAGCCGTTTTACCCCAAGGCTGGTAATGGCCGGCGACCTTATCCGCTGGAAACCATGCTACGCATTCACTGCATGCAGCATTGGTACAACCTGAGCGATGGCGCGATGGAAGATGCTCTGTACGAAATCGCCTCCATGCGTCTGTTTGCCCGGTTATCCCTGGATAGCGCCTTGCCGGACCGCACCACCATCATGAATTTCCGCCACCTGCTGGAGCAGCATCAACTGGCCCGCCAATTGTTCAAGACCATCAATCGCTGGCTGGCCGAAGCAGGCGTCATGATGACTCAAGGCACCTTGGTCGATGCCACCATCATTGAGGCACCCAGCTCGACCAAGAACAAAGAGCAGCAACGCGATCCGGAGATGCATCAGACCAAGAAAGGCAATCAGTGGCACTTTGGCATGAAGGCCCACATTGGTGTCGATGCCAAGAGTGGCCTGACCCACAGCCTAGTCACCACCGCGGCCAACGAGCATGACCTCAATCAGCTGGGTAATCTGCTGCATGGAGAGGAGCAATTTGTCTCAGCCGATGCCGGCTACCAAGGGGCGCCACAGCGCGAGGAGCTGGCCGAGGTGGATGTGGACTGGCTGATCGCCGAGCGCCCCGGCAAGGTAAGAACCTTGAAACAGCATCCACGCAAGAACAAAACGGCCATCAACATCGAATACATGAAAGCCAGCATCCGGGCCAGGGTGGAGCACCCATTTCGCATCATCAAGCGACAGTTCGGCTTCGTGAAAGCCAGATACAAGGGGTTGCTGAAAAACGATAACCAACTGGCGATGTTATTCACGCTGGCCAACCTGTTTCGGGCGGACCAAATGATACGTCAGTGGGAGAGATCTCACTAAAAACTGGGGATAACGCCTTAAATGGCGAAGAAACGGTCTAAATAGGCTGATTCAAGGCATTTACGGGAGAAAAAATCGGCTCAAACATGAAGAAATGAAATGACTGAGTCAGCCGAGAAGAATTTCCCCGCTTATTCGCACCTTCC	NA	NA	NA	NA
AYN90136.1|2252303_2252516_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
AYN90137.1|2252791_2253715_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	3.8e-177
>prophage 5
CP033096	Escherichia coli strain CP53 chromosome, complete genome	4623817	2406007	2475277	4623817	terminase,lysis,transposase,coat	Escherichia_phage(33.33%)	65	NA	NA
AYN90260.1|2406007_2407376_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
AYN90261.1|2407476_2407626_+	protein HokB	NA	NA	NA	NA	NA
AYN90262.1|2407697_2407871_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
AYN90263.1|2408115_2408646_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
AYN90264.1|2408834_2408951_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AYN90265.1|2409182_2409587_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYN90266.1|2409565_2409985_+	hypothetical protein	NA	NA	NA	NA	NA
AYN90267.1|2409875_2411315_-	lactaldehyde dehydrogenase	NA	NA	NA	NA	NA
AYN90268.1|2411511_2412312_-	YdcF family protein	NA	NA	NA	NA	NA
AYN90269.1|2412583_2416486_-	ATP-dependent helicase	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
AYN90270.1|2416686_2417292_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AYN92276.1|2417345_2418638_-	hypothetical protein	NA	NA	NA	NA	NA
AYN90271.1|2418651_2420316_-	hydrolase	NA	NA	NA	NA	NA
AYN90272.1|2422855_2423716_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
AYN90273.1|2423947_2424538_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
AYN90274.1|2424519_2425470_-	transcriptional regulator	NA	NA	NA	NA	NA
AYN90275.1|2425570_2426884_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
AYN90276.1|2426910_2428116_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AYN90277.1|2428115_2428538_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AYN90278.1|2428527_2429955_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
AYN90279.1|2429956_2430745_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
AYN90280.1|2430744_2431512_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
AYN90281.1|2431508_2432579_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
AYN90282.1|2432586_2433084_-	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
AYN90283.1|2433098_2433845_-	1,2-phenylacetyl-CoA epoxidase subunit C	NA	NA	NA	NA	NA
AYN90284.1|2433853_2434141_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
AYN90285.1|2434152_2435082_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
AYN90286.1|2435366_2437412_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
AYN90287.1|2437659_2439933_+	primary-amine oxidase	NA	NA	NA	NA	NA
AYN90288.1|2439990_2441490_-	NAD-dependent phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
AYN90289.1|2441725_2442631_+	transcriptional activator FeaR	NA	NA	NA	NA	NA
AYN90290.1|2442802_2443129_-	DUF1318 domain-containing protein	NA	NA	NA	NA	NA
AYN90291.1|2443136_2443322_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
AYN90292.1|2443318_2445958_-	YdbH family protein	NA	NA	NA	NA	NA
AYN90293.1|2446165_2447155_+	lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
AYN90294.1|2447265_2447688_+	heat-shock protein HslJ	NA	NA	NA	NA	NA
AYN90295.1|2447684_2447951_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AYN90296.1|2448224_2451749_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AYN90297.1|2452115_2453249_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
AYN90298.1|2453389_2453824_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AYN90299.1|2454783_2455017_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AYN90300.1|2455333_2455864_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	40.1	4.2e-24
AYN90301.1|2455883_2456240_-	HK97 gp10 family phage protein	NA	A0A059VF88	Pseudomonas_phage	39.2	6.1e-11
AYN90302.1|2456240_2456624_-	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	39.4	3.7e-14
AYN90303.1|2456623_2457019_-	protein singed	NA	NA	NA	NA	NA
AYN90304.1|2457241_2458381_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	75.0	7.4e-159
AYN90305.1|2458479_2459244_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
AYN90306.1|2459348_2460461_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
AYN90307.1|2460444_2461851_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	4.0e-186
AYN90308.1|2461853_2463155_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
AYN90309.1|2463135_2464230_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
AYN90310.1|2464233_2464443_-	hypothetical protein	NA	NA	NA	NA	NA
AYN90311.1|2464420_2465353_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
AYN90312.1|2465345_2466137_-	transcriptional regulator	NA	R4TG31	Halovirus	40.2	2.8e-48
AYN90313.1|2466274_2467732_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
AYN90314.1|2467928_2468114_-	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
AYN90315.1|2468330_2468828_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
AYN90316.1|2468827_2469043_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
AYN90317.1|2469094_2470323_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	3.7e-172
AYN92277.1|2470630_2471005_-	tolA family protein	NA	NA	NA	NA	NA
AYN90318.1|2471138_2472155_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AYN90319.1|2472375_2472804_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AYN90320.1|2473848_2474391_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	1.7e-76
AYN90321.1|2474387_2474678_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
AYN90322.1|2474677_2475277_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
>prophage 6
CP033096	Escherichia coli strain CP53 chromosome, complete genome	4623817	2480874	2499175	4623817	tRNA	Escherichia_phage(55.56%)	22	NA	NA
AYN90329.1|2480874_2482878_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.4e-21
AYN90330.1|2483212_2483635_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
AYN90331.1|2483675_2484746_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
AYN90332.1|2484817_2485243_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AYN90333.1|2485226_2485508_-	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
AYN90334.1|2485608_2486028_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
AYN90335.1|2486237_2486417_+	hypothetical protein	NA	NA	NA	NA	NA
AYN90336.1|2486427_2486583_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AYN92278.1|2486579_2487068_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
AYN90337.1|2487508_2487730_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AYN92279.1|2487729_2487900_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AYN90338.1|2487974_2488250_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AYN90339.1|2488351_2490952_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
AYN90340.1|2490944_2491754_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
AYN90341.1|2491810_2492005_+	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AYN90342.1|2491997_2492207_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
AYN90343.1|2492285_2492501_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AYN90344.1|2492502_2493738_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
AYN90345.1|2493789_2494725_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AYN90346.1|2494853_2496227_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AYN90347.1|2496704_2497688_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AYN92280.1|2497942_2499175_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 7
CP033096	Escherichia coli strain CP53 chromosome, complete genome	4623817	3072089	3118182	4623817	lysis,terminase,head,transposase,capsid,integrase,tail,portal	Enterobacteria_phage(53.97%)	65	3096010:3096025	3119890:3119905
AYN90855.1|3072089_3073421_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.6	1.0e-21
AYN90856.1|3073494_3074079_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.9	1.4e-105
AYN90857.1|3074078_3077438_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
AYN90858.1|3077502_3078102_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	8.2e-109
AYN90859.1|3079088_3080301_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
AYN90860.1|3080305_3082912_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	98.5	0.0e+00
AYN90861.1|3082971_3083643_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.1	5.2e-104
AYN90862.1|3083540_3084284_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	6.8e-145
AYN90863.1|3084288_3084987_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
AYN90864.1|3084986_3085316_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AYN90865.1|3085312_3087874_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.9	0.0e+00
AYN90866.1|3087866_3088301_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
AYN90867.1|3088282_3088705_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	98.6	5.7e-72
AYN92308.1|3088720_3089461_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	4.9e-127
AYN90868.1|3089468_3089864_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
AYN90869.1|3089860_3090439_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	8.6e-79
AYN90870.1|3090450_3090804_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
AYN90871.1|3090815_3091211_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	81.1	3.8e-46
AYN90872.1|3091252_3092278_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	1.9e-190
AYN90873.1|3092333_3092666_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	95.5	1.8e-52
AYN90874.1|3092675_3093995_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.9	1.3e-234
AYN90875.1|3093975_3095577_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	5.5e-309
AYN90876.1|3095573_3095780_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AYN90877.1|3095776_3097702_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
3096010:3096025	attL	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
AYN90878.1|3097676_3098222_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
AYN90879.1|3098610_3098844_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
AYN90880.1|3098901_3099312_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	77.8	2.7e-55
AYN90881.1|3099396_3099531_+	hypothetical protein	NA	NA	NA	NA	NA
AYN90882.1|3099612_3100137_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
AYN90883.1|3100339_3100492_-	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
AYN90884.1|3100479_3100947_-|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	91.0	7.7e-70
AYN90885.1|3100943_3101477_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	5.3e-99
AYN90886.1|3101582_3101855_+	hypothetical protein	NA	NA	NA	NA	NA
AYN90887.1|3101820_3102165_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	96.4	4.4e-38
AYN90888.1|3102169_3102385_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
AYN90889.1|3102722_3103241_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	98.8	2.2e-94
AYN90890.1|3103284_3103896_-	recombination protein NinG	NA	Q716C3	Shigella_phage	99.0	1.1e-97
AYN90891.1|3103895_3104165_-	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
AYN90892.1|3104157_3104328_-	protein ninF	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
AYN90893.1|3104324_3104507_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
AYN90894.1|3104503_3105031_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	2.8e-100
AYN90895.1|3105027_3105486_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.3e-81
AYN90896.1|3105541_3105832_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	95.8	5.9e-44
AYN90897.1|3105828_3106530_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
AYN90898.1|3106526_3107426_-	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	99.3	1.6e-172
AYN90899.1|3107458_3107752_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
AYN90900.1|3107870_3108056_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	1.6e-18
AYN90901.1|3108045_3109062_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AYN90902.1|3109370_3110084_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	5.4e-131
AYN90903.1|3110202_3111108_+	hypothetical protein	NA	A4KWU2	Enterobacteria_phage	94.8	3.0e-163
AYN90904.1|3111540_3111864_+	antitermination protein	NA	A4KWR8	Enterobacteria_phage	99.1	1.0e-52
AYN90905.1|3111864_3112347_-	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
AYN90906.1|3112613_3112814_+	restriction endonuclease	NA	A0A088CQ62	Enterobacteria_phage	98.5	1.2e-32
AYN90907.1|3112996_3113365_+	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	98.4	7.6e-65
AYN90908.1|3113444_3113714_+	host cell division inhibitory peptide Kil	NA	G3CFI2	Escherichia_phage	100.0	1.3e-42
AYN90909.1|3113668_3114085_+	Host-nuclease inhibitor protein gam	NA	C6ZCV5	Enterobacteria_phage	97.1	2.8e-71
AYN90910.1|3114090_3114876_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
AYN90911.1|3114872_3115553_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	7.9e-132
AYN92309.1|3115549_3115732_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
AYN90912.1|3115704_3115896_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
AYN90913.1|3115906_3116188_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
AYN90914.1|3116286_3116505_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	1.2e-33
AYN90915.1|3116551_3116830_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
AYN92310.1|3116915_3117134_+	excisionase	NA	Q77WA4	Escherichia_phage	97.2	1.1e-34
AYN90916.1|3117111_3118182_+|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	4.3e-201
3119890:3119905	attR	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
>prophage 8
CP033096	Escherichia coli strain CP53 chromosome, complete genome	4623817	3308399	3372704	4623817	tRNA,transposase	Escherichia_phage(30.0%)	48	NA	NA
AYN91082.1|3308399_3309416_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AYN91083.1|3310007_3313889_-	enterobactin synthase component F	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
AYN91084.1|3313885_3314104_-	enterobactin biosynthesis protein YbdZ	NA	NA	NA	NA	NA
AYN91085.1|3314106_3315309_-	enterochelin esterase	NA	NA	NA	NA	NA
AYN91086.1|3315551_3317792_+	siderophore enterobactin receptor FepA	NA	NA	NA	NA	NA
AYN92315.1|3317966_3318587_+	enterobactin synthase subunit EntD	NA	NA	NA	NA	NA
AYN91087.1|3318868_3319981_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AYN91088.1|3320057_3320210_-	protein HokE	NA	NA	NA	NA	NA
AYN91089.1|3320307_3321677_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
AYN91090.1|3321947_3322097_-	hypothetical protein	NA	NA	NA	NA	NA
AYN91091.1|3322108_3323227_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AYN91092.1|3323292_3323541_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
AYN91093.1|3323605_3323974_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AYN91094.1|3324067_3324721_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AYN91095.1|3324828_3326076_+	miniconductance mechanosensitive channel YbdG	NA	NA	NA	NA	NA
AYN91096.1|3326143_3327520_-	phenylalanine transporter	NA	NA	NA	NA	NA
AYN91097.1|3327621_3330765_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.0	1.1e-58
AYN91098.1|3330776_3332000_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
AYN91099.1|3332015_3332327_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone	NA	NA	NA	NA	NA
AYN91100.1|3332363_3333287_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	3.8e-177
AYN91101.1|3333571_3334945_-	cation efflux system protein CusC	NA	NA	NA	NA	NA
AYN91102.1|3335101_3335785_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	7.9e-31
AYN91103.1|3335774_3337223_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
AYN91104.1|3337959_3339861_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	2.3e-27
AYN91105.1|3339888_3340350_+	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
AYN91106.1|3343918_3345055_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AYN91107.1|3345325_3347563_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
AYN91108.1|3347549_3350522_+	phage receptor	NA	NA	NA	NA	NA
AYN91109.1|3350522_3351413_+	DUF4434 family protein	NA	NA	NA	NA	NA
AYN91110.1|3351595_3352357_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYN91111.1|3352721_3353354_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYN91112.1|3353356_3353872_-	fimbriae assembly protein	NA	NA	NA	NA	NA
AYN91113.1|3353882_3354923_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AYN91114.1|3358318_3359011_-	fimbrial chaperone SfmC	NA	NA	NA	NA	NA
AYN91115.1|3359230_3359773_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AYN91116.1|3360243_3361110_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AYN91117.1|3361111_3361324_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AYN91118.1|3361431_3361953_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYN91119.1|3361988_3363374_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
AYN91120.1|3363547_3364042_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AYN91121.1|3364044_3364767_+	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AYN91122.1|3364884_3365394_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AYN91123.1|3365390_3366458_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AYN91124.1|3366652_3367546_-	carbamate kinase	NA	NA	NA	NA	NA
AYN91125.1|3367542_3368358_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
AYN91126.1|3368368_3369628_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AYN91127.1|3369637_3371305_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
AYN91128.1|3371687_3372704_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
>prophage 9
CP033096	Escherichia coli strain CP53 chromosome, complete genome	4623817	3618401	3669890	4623817	plate,transposase,holin	Enterobacteria_phage(18.75%)	49	NA	NA
AYN91340.1|3618401_3620507_-	injection protein	NA	A0A2I7QQN9	Vibrio_phage	36.2	2.0e-88
AYN91341.1|3620506_3621973_-	acyltransferase	NA	B6SCW4	Bacteriophage	52.0	5.7e-111
AYN91342.1|3622417_3622669_-	hypothetical protein	NA	NA	NA	NA	NA
AYN91343.1|3622735_3625492_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.2	3.0e-299
AYN91344.1|3625504_3626107_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	5.3e-23
AYN91345.1|3626099_3626321_-	hypothetical protein	NA	NA	NA	NA	NA
AYN91346.1|3626317_3626581_-|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
AYN91347.1|3626577_3626772_-	hypothetical protein	NA	NA	NA	NA	NA
AYN91348.1|3626764_3627832_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	36.8	8.9e-13
AYN91349.1|3627825_3628008_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AYN91350.1|3628000_3628834_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
AYN91351.1|3628846_3629278_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	5.1e-28
AYN91352.1|3629277_3629481_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
AYN91353.1|3630132_3631347_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	56.7	5.7e-133
AYN91354.1|3631702_3632956_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
AYN91355.1|3632967_3634071_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AYN91356.1|3634358_3635414_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	5.0e-117
AYN91357.1|3635452_3635854_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
AYN91358.1|3635911_3637156_-	esterase	NA	NA	NA	NA	NA
AYN91359.1|3637247_3637706_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AYN91360.1|3637966_3639424_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
AYN91361.1|3639480_3640017_-	peptide chain release factor H	NA	NA	NA	NA	NA
AYN91362.1|3639949_3640216_-	hypothetical protein	NA	NA	NA	NA	NA
AYN91363.1|3640449_3640902_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYN91364.1|3640911_3641310_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
AYN91365.1|3641312_3641606_-	antitoxin YafN	NA	NA	NA	NA	NA
AYN91366.1|3641657_3642713_-	DNA polymerase IV	NA	NA	NA	NA	NA
AYN92325.1|3642783_3643554_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
AYN91367.1|3643513_3645253_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
AYN91368.1|3645476_3645974_-|transposase	transposase	transposase	NA	NA	NA	NA
AYN91369.1|3646149_3646899_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
AYN91370.1|3647108_3647369_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
AYN91371.1|3647371_3647650_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
AYN91372.1|3647805_3648546_+	transpeptidase	NA	NA	NA	NA	NA
AYN91373.1|3648516_3649284_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AYN91374.1|3649489_3650068_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
AYN91375.1|3650307_3652752_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AYN91376.1|3652794_3653268_-	inhibitor of vertebrate lysozyme	NA	NA	NA	NA	NA
AYN91377.1|3653421_3654192_+	hydrolase YafV	NA	NA	NA	NA	NA
AYN91378.1|3655270_3656287_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AYN91379.1|3660719_3662861_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
AYN91380.1|3662900_3663038_-	hypothetical protein	NA	NA	NA	NA	NA
AYN91381.1|3663070_3663589_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AYN91382.1|3664284_3664785_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AYN91383.1|3664819_3665044_+	hypothetical protein	NA	NA	NA	NA	NA
AYN91384.1|3665094_3666570_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AYN91385.1|3666576_3666990_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AYN91386.1|3666993_3668844_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYN91387.1|3668807_3669890_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 1
CP033097	Escherichia coli strain CP53 plasmid pCP53-113k, complete sequence	113610	8060	80386	113610	integrase,terminase,tail,capsid,transposase	Salmonella_phage(92.19%)	77	NA	NA
AYN92362.1|8060_9288_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	3.7e-172
AYN92363.1|9300_10014_+	hypothetical protein	NA	NA	NA	NA	NA
AYN92364.1|10494_12834_-	recombinase RecA	NA	J9Q736	Salmonella_phage	85.1	1.8e-29
AYN92365.1|12836_13103_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	78.4	6.8e-31
AYN92366.1|13102_14047_-	exonuclease	NA	J9Q7S6	Salmonella_phage	91.7	2.5e-168
AYN92367.1|14107_15136_-	regulator	NA	J9Q7Z3	Salmonella_phage	86.0	2.3e-143
AYN92368.1|15253_15685_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	83.9	9.9e-64
AYN92369.1|15938_16163_+	hypothetical protein	NA	J9Q735	Salmonella_phage	55.6	2.4e-13
AYN92370.1|16223_16787_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	68.2	3.3e-67
AYN92371.1|16817_20324_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	89.5	0.0e+00
AYN92372.1|20298_20502_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	88.1	4.8e-29
AYN92373.1|20504_21740_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	81.3	2.3e-198
AYN92374.1|21835_23944_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	66.2	6.9e-227
AYN92375.1|24042_24255_-	hypothetical protein	NA	NA	NA	NA	NA
AYN92376.1|24506_24893_+	transcriptional regulator	NA	NA	NA	NA	NA
AYN92377.1|24887_25991_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
AYN92378.1|26201_26447_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	4.5e-13
AYN92379.1|26443_26794_-	hypothetical protein	NA	Q716B1	Shigella_phage	51.7	7.9e-27
AYN92380.1|28447_28738_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	79.2	2.4e-37
AYN92381.1|28883_29099_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.5	3.3e-20
AYN92382.1|29095_30418_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	91.1	3.1e-241
AYN92383.1|30414_30672_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	60.2	3.9e-15
AYN92384.1|30952_31735_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.1	1.5e-54
AYN92385.1|31810_32992_-	DNA primase	NA	J9Q720	Salmonella_phage	93.8	4.8e-209
AYN92386.1|33073_34414_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	93.5	3.4e-235
AYN92387.1|34457_35198_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.6	2.2e-127
AYN92388.1|35480_36248_+	hypothetical protein	NA	NA	NA	NA	NA
AYN92389.1|36300_36660_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	96.9	3.3e-44
AYN92390.1|36659_37325_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	95.0	9.5e-114
AYN92473.1|37643_37913_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AYN92391.1|37920_38442_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYN92392.1|38474_38660_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	75.0	4.9e-20
AYN92393.1|38610_38862_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	74.4	4.5e-24
AYN92394.1|38863_39556_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	93.5	4.0e-123
AYN92395.1|39569_39893_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	88.8	2.9e-44
AYN92396.1|39967_40756_-	receptor-recognizing protein	NA	E5DHZ0	Enterobacter_phage	69.6	2.4e-55
AYN92397.1|44073_44286_-	hypothetical protein	NA	NA	NA	NA	NA
AYN92474.1|44465_44927_+	hypothetical protein	NA	NA	NA	NA	NA
AYN92398.1|45562_50290_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	74.2	0.0e+00
AYN92399.1|50307_50901_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	2.0e-99
AYN92400.1|50888_51686_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	94.0	1.3e-154
AYN92401.1|51678_52410_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
AYN92402.1|52459_52795_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	87.3	8.0e-53
AYN92403.1|52837_57400_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	67.7	0.0e+00
AYN92404.1|57407_57677_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.8	1.7e-34
AYN92405.1|57757_58075_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	95.2	3.3e-48
AYN92406.1|58136_58883_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	6.2e-106
AYN92407.1|58957_59341_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	82.7	1.2e-57
AYN92408.1|59342_59816_-	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
AYN92409.1|59806_60151_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
AYN92410.1|60230_61064_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.1	1.3e-141
AYN92411.1|61063_61498_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	82.6	1.1e-59
AYN92412.1|61542_62463_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	80.2	2.4e-123
AYN92413.1|62536_63412_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	93.8	4.2e-154
AYN92414.1|63437_64325_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	87.6	5.1e-131
AYN92415.1|64346_65921_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	92.7	3.2e-285
AYN92416.1|65947_67204_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
AYN92417.1|67203_67836_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
AYN92418.1|68032_68299_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
AYN92419.1|68308_69208_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.3	1.3e-166
AYN92420.1|69204_69459_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AYN92421.1|69451_70090_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	1.2e-110
AYN92422.1|70086_70755_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
AYN92423.1|70754_71453_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	87.1	5.1e-110
AYN92424.1|71517_73077_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.1	1.1e-277
AYN92425.1|73079_73358_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
AYN92426.1|73390_73990_+	hypothetical protein	NA	NA	NA	NA	NA
AYN92427.1|74130_74679_+	hypothetical protein	NA	NA	NA	NA	NA
AYN92428.1|74706_75126_+	hypothetical protein	NA	J9Q806	Salmonella_phage	58.8	8.2e-39
AYN92429.1|75130_75652_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	68.2	7.3e-53
AYN92430.1|75949_76600_+	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	6.4e-99
AYN92431.1|76647_76878_+	hypothetical protein	NA	NA	NA	NA	NA
AYN92432.1|77494_77977_-	hypothetical protein	NA	J9Q805	Salmonella_phage	70.4	3.2e-63
AYN92433.1|78186_78777_-	hypothetical protein	NA	NA	NA	NA	NA
AYN92434.1|79060_79471_-	hypothetical protein	NA	NA	NA	NA	NA
AYN92435.1|79552_79948_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	53.8	2.4e-32
AYN92436.1|80074_80386_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	5.7e-29
>prophage 2
CP033097	Escherichia coli strain CP53 plasmid pCP53-113k, complete sequence	113610	88264	112868	113610		Salmonella_phage(77.78%)	29	NA	NA
AYN92476.1|88264_89821_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.4e-104
AYN92443.1|89817_91137_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AYN92444.1|91258_94375_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.2	1.7e-27
AYN92445.1|94433_94910_-	hypothetical protein	NA	J9Q747	Salmonella_phage	89.2	6.0e-78
AYN92446.1|95013_95628_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	81.4	6.7e-98
AYN92447.1|95630_95912_-	hypothetical protein	NA	A0A0E3JPT1	Enterobacteria_phage	76.3	2.5e-39
AYN92448.1|95966_96536_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	61.4	2.3e-52
AYN92449.1|96675_96834_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AYN92450.1|96833_97259_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	2.6e-56
AYN92451.1|97352_97541_-	hypothetical protein	NA	J9Q800	Salmonella_phage	51.6	2.1e-10
AYN92452.1|97550_98045_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	55.4	5.2e-24
AYN92453.1|98193_98784_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	82.2	5.8e-91
AYN92454.1|99370_99601_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	5.9e-31
AYN92455.1|99787_100381_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.8	1.7e-98
AYN92456.1|100534_101491_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	72.4	8.0e-98
AYN92457.1|101535_102090_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	95.1	2.8e-95
AYN92458.1|102099_102519_-	hypothetical protein	NA	J9Q743	Salmonella_phage	95.7	4.6e-66
AYN92459.1|102582_103227_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	95.8	7.8e-113
AYN92460.1|103226_103703_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	96.2	7.0e-87
AYN92461.1|103699_104113_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	98.5	3.3e-72
AYN92462.1|104114_105230_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	99.2	1.1e-218
AYN92463.1|105397_106276_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	97.9	9.8e-159
AYN92464.1|106541_107111_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	80.4	7.9e-85
AYN92465.1|107107_107848_-	hypothetical protein	NA	A0A2I7R0K2	Vibrio_phage	40.0	2.3e-23
AYN92466.1|107859_108606_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	91.9	1.4e-126
AYN92467.1|108595_110512_-	exonuclease	NA	J9Q741	Salmonella_phage	86.5	3.4e-297
AYN92468.1|110508_110787_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	68.3	1.5e-20
AYN92469.1|110741_111827_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	97.5	1.2e-203
AYN92470.1|112223_112868_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.6	1.4e-122
>prophage 1
CP033095	Escherichia coli strain CP53 plasmid pCP53-92k, complete sequence	92168	504	65143	92168	transposase,integrase	Escherichia_phage(33.33%)	58	285:344	63917:64082
285:344	attL	TGATCTTACCCAGCAATAGTGGACACGCGGCTAAGTGAGTAAACTCTCAGTCAGAGGTGA	NA	NA	NA	NA
AYN88035.1|504_1200_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.0	7.0e-43
AYN88036.1|1491_1758_-	hypothetical protein	NA	NA	NA	NA	NA
AYN88037.1|2059_3040_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
AYN88038.1|3180_3381_+	hypothetical protein	NA	NA	NA	NA	NA
AYN88039.1|3373_5233_+	hypothetical protein	NA	A0A1Q1N989	Escherichia_phage	29.1	3.3e-55
AYN88040.1|5264_5504_-	transcription factor	NA	NA	NA	NA	NA
AYN88041.1|5553_6810_-|integrase	integrase	integrase	NA	NA	NA	NA
AYN88042.1|7066_8977_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AYN88043.1|9109_9442_-	NIPSNAP family protein	NA	NA	NA	NA	NA
AYN88044.1|9714_10230_+	hypothetical protein	NA	NA	NA	NA	NA
AYN88045.1|10342_10552_+	hypothetical protein	NA	NA	NA	NA	NA
AYN88112.1|12450_12843_+	cysteine hydrolase	NA	NA	NA	NA	NA
AYN88046.1|12980_13865_+	EamA family transporter	NA	NA	NA	NA	NA
AYN88047.1|13896_15096_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AYN88048.1|15174_15852_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYN88049.1|15883_16126_-	relaxase	NA	NA	NA	NA	NA
AYN88050.1|18511_18991_+	phenol hydroxylase	NA	NA	NA	NA	NA
AYN88051.1|19187_20278_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AYN88052.1|20367_21183_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AYN88053.1|21269_21572_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AYN88054.1|21465_21717_-	hypothetical protein	NA	NA	NA	NA	NA
AYN88055.1|21747_23241_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYN88056.1|23352_23658_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYN88057.1|23685_24900_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AYN88058.1|25116_26001_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AYN88059.1|26925_27630_+|transposase	IS6 family transposase IS1006	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
AYN88113.1|27714_28116_-	hypothetical protein	NA	NA	NA	NA	NA
AYN88060.1|28124_31076_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
AYN88061.1|31078_31639_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYN88062.1|31764_32379_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AYN88063.1|32317_33331_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYN88064.1|33475_33973_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AYN88065.1|34084_34375_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
AYN88066.1|34380_35172_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AYN88067.1|35433_36693_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
AYN88068.1|36785_37577_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AYN88069.1|37746_38079_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
AYN88070.1|38218_38404_+	hypothetical protein	NA	NA	NA	NA	NA
AYN88071.1|39258_40050_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
AYN88072.1|40740_41604_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
AYN88073.1|41749_42979_-	macrolide efflux MFS transporter Mef(B)	NA	A0A1B0RXG2	Streptococcus_phage	39.0	2.1e-74
AYN88074.1|43320_44025_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYN88075.1|44061_45189_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AYN88076.1|45239_45485_-	hypothetical protein	NA	NA	NA	NA	NA
AYN88077.1|45490_45682_+	hypothetical protein	NA	NA	NA	NA	NA
AYN88078.1|46163_46706_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AYN88079.1|46718_47579_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AYN88080.1|48279_48984_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYN88081.1|49447_50053_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AYN88082.1|50054_50279_+	reverse transcriptase	NA	NA	NA	NA	NA
AYN88083.1|57976_59410_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	1.4e-106
AYN88084.1|59443_60652_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	2.1e-34
AYN88085.1|61409_62114_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYN88086.1|62440_62629_-	hypothetical protein	NA	NA	NA	NA	NA
AYN88087.1|62755_62944_-	hypothetical protein	NA	NA	NA	NA	NA
AYN88088.1|63098_63368_+	hypothetical protein	NA	NA	NA	NA	NA
AYN88089.1|63364_63646_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYN88090.1|63981_65143_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
63917:64082	attR	TGATCTTACCCAGCAATAGTGGACACGCGGCTAAGTGAGTAAACTCTCAGTCAGAGGTGACTCACATGACAAAAACAGTATCAACCAGTAAAAAACCCCGTAAACAGCATTCGCCTGAATTTCGCAGTGAAGCCCTGAAGCTTGCTGAACGCATCGGTGTTACTGC	NA	NA	NA	NA
>prophage 2
CP033095	Escherichia coli strain CP53 plasmid pCP53-92k, complete sequence	92168	72774	92131	92168	transposase,plate,integrase	Enterobacteria_phage(35.71%)	16	70921:70935	88764:88778
70921:70935	attL	AAGCAATAAAAAAAA	NA	NA	NA	NA
AYN88114.1|72774_73860_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	34.4	3.9e-48
AYN88097.1|73881_75006_-	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	65.0	6.5e-131
AYN88098.1|75019_76405_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.7	3.8e-32
AYN88099.1|76419_77835_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.2	3.6e-54
AYN88100.1|78272_79163_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.9e-45
AYN88101.1|79302_80283_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
AYN88102.1|80340_80577_+	hypothetical protein	NA	NA	NA	NA	NA
AYN88103.1|80684_81674_+|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	34.9	1.1e-06
AYN88104.1|81878_82991_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AYN88105.1|83150_83660_-|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	98.8	1.1e-90
AYN88106.1|83671_84253_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	100.0	5.9e-104
AYN88107.1|85113_86703_-	hypothetical protein	NA	A0A077SLN8	Escherichia_phage	98.7	4.5e-303
AYN88108.1|86763_88470_-	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	99.5	0.0e+00
AYN88109.1|88734_89700_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	98.8	6.3e-167
88764:88778	attR	TTTTTTTTATTGCTT	NA	NA	NA	NA
AYN88110.1|89696_90902_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	99.8	9.7e-226
AYN88111.1|91270_92131_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	99.7	1.8e-157
>prophage 1
CP033094	Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence	231859	41426	71761	231859	transposase	Escherichia_phage(30.0%)	26	NA	NA
AYN87844.1|41426_42830_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
AYN87845.1|43234_44008_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYN87846.1|44178_45582_-	glucuronate isomerase	NA	NA	NA	NA	NA
AYN87847.1|45584_47066_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.6	3.2e-45
AYN87848.1|47151_48336_-	mannonate dehydratase	NA	NA	NA	NA	NA
AYN88026.1|48714_49995_+	MFS transporter	NA	NA	NA	NA	NA
AYN87849.1|50906_51710_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AYN87850.1|51709_52546_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AYN87851.1|52625_53357_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.7e-20
AYN88027.1|53666_53978_+	hypothetical protein	NA	NA	NA	NA	NA
AYN87852.1|54224_55781_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.1	2.3e-102
AYN87853.1|55777_57097_+	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	50.6	1.9e-41
AYN87854.1|59192_59897_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYN87855.1|60219_61752_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYN87856.1|62280_62730_-	hypothetical protein	NA	NA	NA	NA	NA
AYN87857.1|63251_63362_-	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	88.6	1.9e-08
AYN87858.1|63366_64104_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
AYN87859.1|64229_64325_-	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
AYN87860.1|64459_65164_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYN87861.1|65285_66191_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AYN87862.1|66187_67426_+	MFS transporter	NA	NA	NA	NA	NA
AYN87863.1|67509_68214_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYN87864.1|68159_68351_-	hypothetical protein	NA	NA	NA	NA	NA
AYN87865.1|68473_68782_-	monooxygenase	NA	NA	NA	NA	NA
AYN87866.1|68881_69784_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYN87867.1|70548_71761_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	2.5e-168
>prophage 2
CP033094	Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence	231859	188542	227697	231859	transposase,integrase	Escherichia_phage(25.0%)	47	185107:185119	227861:227873
185107:185119	attL	GAACGTCAGAAGC	NA	NA	NA	NA
AYN87977.1|188542_189466_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	7.1e-176
AYN87978.1|189637_189865_+	hypothetical protein	NA	NA	NA	NA	NA
AYN87979.1|189974_190781_+	HNH endonuclease	NA	G0X580	Salmonella_phage	37.9	1.3e-13
AYN87980.1|190886_191306_+	hypothetical protein	NA	NA	NA	NA	NA
AYN87981.1|191613_192063_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	34.3	4.9e-05
AYN87982.1|192132_192315_+	hypothetical protein	NA	NA	NA	NA	NA
AYN87983.1|192828_193233_-	DNA-binding protein	NA	NA	NA	NA	NA
AYN87984.1|193494_193767_-	hypothetical protein	NA	NA	NA	NA	NA
AYN87985.1|193763_194432_-	hypothetical protein	NA	NA	NA	NA	NA
AYN88033.1|194938_195394_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AYN87986.1|195562_195751_+	hypothetical protein	NA	NA	NA	NA	NA
AYN87987.1|195753_196974_+	hypothetical protein	NA	NA	NA	NA	NA
AYN87988.1|197028_197232_-	hypothetical protein	NA	NA	NA	NA	NA
AYN87989.1|197269_198565_-	DUF1173 family protein	NA	NA	NA	NA	NA
AYN87990.1|198589_198760_-	hypothetical protein	NA	NA	NA	NA	NA
AYN87991.1|198888_200316_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.0e-101
AYN87992.1|200539_201055_+	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.3	7.1e-08
AYN87993.1|201051_201984_+	hypothetical protein	NA	NA	NA	NA	NA
AYN87994.1|202039_202819_+	DNA repair protein	NA	NA	NA	NA	NA
AYN87995.1|203929_204160_+	hypothetical protein	NA	NA	NA	NA	NA
AYN87996.1|204223_204523_+	hypothetical protein	NA	NA	NA	NA	NA
AYN87997.1|204772_205228_-	hypothetical protein	NA	NA	NA	NA	NA
AYN87998.1|207398_207833_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AYN87999.1|207904_208255_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AYN88000.1|208268_208544_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
AYN88034.1|208579_209002_+	mercury transporter MerC	NA	NA	NA	NA	NA
AYN88001.1|209053_210748_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYN88002.1|210765_211128_+	transcriptional regulator	NA	NA	NA	NA	NA
AYN88003.1|211124_211361_+	mercury resistance protein	NA	NA	NA	NA	NA
AYN88004.1|211357_212065_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYN88005.1|212103_213408_+|integrase	integrase	integrase	NA	NA	NA	NA
AYN88006.1|213454_214159_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYN88007.1|214348_215164_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AYN88008.1|215314_216019_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYN88009.1|216076_216940_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
AYN88010.1|217085_218315_-	macrolide efflux MFS transporter Mef(B)	NA	A0A1B0RXG2	Streptococcus_phage	39.0	2.1e-74
AYN88011.1|218442_219147_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYN88012.1|219250_219496_+	hypothetical protein	NA	NA	NA	NA	NA
AYN88013.1|219964_220756_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
AYN88014.1|221610_221796_-	hypothetical protein	NA	NA	NA	NA	NA
AYN88015.1|221935_222268_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
AYN88016.1|222437_223229_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AYN88017.1|223321_224581_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
AYN88018.1|224842_225634_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AYN88019.1|225639_225930_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
AYN88020.1|226041_226539_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AYN88021.1|226683_227697_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
227861:227873	attR	GCTTCTGACGTTC	NA	NA	NA	NA
