The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033162	Serratia sp. P2ACOL2 chromosome, complete genome	5590417	1511442	1585699	5590417	capsid,portal,head,protease,lysis,tRNA,tail,integrase,plate	Erwinia_phage(34.78%)	83	1511333:1511351	1545647:1545665
1511333:1511351	attL	AGGCAACAAAAAACCCGAT	NA	NA	NA	NA
AYO37097.1|1511442_1512477_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	59.2	7.3e-113
AYO37098.1|1512550_1513540_-	hypothetical protein	NA	NA	NA	NA	NA
AYO37099.1|1513570_1514143_-	phage repressor protein	NA	F1BUN8	Cronobacter_phage	38.5	5.2e-28
AYO37100.1|1514283_1514514_+	regulator	NA	NA	NA	NA	NA
AYO37101.1|1514543_1515053_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	53.0	7.9e-44
AYO40715.1|1515063_1515243_+	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	51.0	1.1e-05
AYO37102.1|1515254_1515557_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37103.1|1515620_1515863_+	DUF2732 family protein	NA	A0A218M4I9	Erwinia_phage	49.2	2.8e-07
AYO37104.1|1515862_1516174_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37105.1|1516173_1516398_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	58.3	7.5e-15
AYO37106.1|1516520_1516802_+	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	51.2	4.5e-17
AYO37107.1|1516791_1517307_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37108.1|1517303_1519520_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	58.0	9.2e-238
AYO37109.1|1519558_1519783_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37110.1|1519797_1520028_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37111.1|1520396_1520651_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	5.9e-16
AYO40716.1|1520650_1520992_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AYO37112.1|1521157_1522468_+	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
AYO37113.1|1522498_1523533_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	80.4	5.0e-162
AYO37114.1|1523532_1525305_-	oxidoreductase	NA	F1BUR2	Erwinia_phage	81.9	1.7e-290
AYO37115.1|1525447_1526263_+|capsid	phage capsid protein	capsid	S4TP53	Salmonella_phage	53.5	6.4e-72
AYO37116.1|1526305_1527490_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.9	1.6e-159
AYO37117.1|1527492_1528152_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	69.4	5.2e-80
AYO37118.1|1528245_1528734_+|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	53.1	4.3e-39
AYO37119.1|1528733_1528937_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	68.7	2.4e-20
AYO37120.1|1528941_1529151_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	43.5	2.0e-09
AYO37121.1|1529134_1529647_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	66.5	3.3e-58
AYO37122.1|1529643_1530072_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	35.9	1.6e-13
AYO37123.1|1530167_1530644_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	64.7	1.8e-50
AYO37124.1|1530630_1531083_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	59.2	3.0e-39
AYO37125.1|1531054_1531858_-	hypothetical protein	NA	NA	NA	NA	NA
AYO37126.1|1531972_1532602_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	73.1	2.2e-75
AYO37127.1|1532598_1532949_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	67.2	2.9e-37
AYO37128.1|1532953_1533862_+|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	68.5	5.6e-109
AYO37129.1|1533854_1534388_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.6	4.3e-77
AYO37130.1|1534394_1536914_+	hypothetical protein	NA	Q858V4	Yersinia_virus	54.6	9.3e-61
AYO37131.1|1536915_1537440_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	44.2	6.2e-36
AYO37132.1|1537608_1537827_-	hypothetical protein	NA	NA	NA	NA	NA
AYO37133.1|1538555_1539725_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	82.0	3.6e-185
AYO37134.1|1539740_1540250_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	76.2	1.7e-70
AYO37135.1|1540303_1540585_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	69.8	9.1e-26
AYO37136.1|1540617_1540740_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	75.0	3.0e-10
AYO37137.1|1540732_1543579_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	39.9	1.3e-103
AYO37138.1|1543583_1544069_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	65.7	1.5e-47
AYO37139.1|1544065_1545214_+	phage late control D family protein	NA	S4TRX8	Salmonella_phage	62.4	4.6e-124
AYO37140.1|1545313_1545532_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.2	3.2e-26
AYO37141.1|1545826_1547515_-	transporter	NA	NA	NA	NA	NA
1545647:1545665	attR	AGGCAACAAAAAACCCGAT	NA	NA	NA	NA
AYO37142.1|1548374_1548638_-	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	70.5	1.7e-26
AYO37143.1|1548880_1549186_+	DUF1418 family protein	NA	NA	NA	NA	NA
AYO37144.1|1549242_1550145_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.4	9.7e-37
AYO37145.1|1550306_1550786_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AYO37146.1|1551194_1552304_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AYO37147.1|1552441_1553575_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
AYO40717.1|1553606_1554566_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AYO37148.1|1554562_1555408_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AYO37149.1|1555630_1556110_+	DUF2593 family protein	NA	NA	NA	NA	NA
AYO37150.1|1556178_1557306_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.8	5.7e-26
AYO37151.1|1557369_1558104_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYO37152.1|1558311_1558980_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AYO37153.1|1558979_1559696_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AYO37154.1|1559705_1560437_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYO37155.1|1560470_1561199_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.4	3.9e-28
AYO37156.1|1561461_1562010_-	lipoprotein	NA	NA	NA	NA	NA
AYO37157.1|1562171_1562495_+	hypothetical protein	NA	M4STD1	Rhodobacter_phage	44.2	2.2e-15
AYO37158.1|1562533_1564051_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
AYO37159.1|1564240_1565077_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	30.0	5.5e-10
AYO37160.1|1565077_1566088_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYO37161.1|1566245_1567685_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
AYO37162.1|1567830_1568178_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
AYO37163.1|1568214_1569231_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AYO40718.1|1569404_1571126_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AYO37164.1|1571306_1572311_-	NADH oxidoreductase	NA	NA	NA	NA	NA
AYO37165.1|1572362_1574012_-	hydroxylamine reductase	NA	NA	NA	NA	NA
AYO37166.1|1574186_1575083_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
AYO37167.1|1575274_1576939_+	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
AYO37168.1|1576935_1577904_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AYO37169.1|1578069_1579212_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
AYO37170.1|1579211_1581158_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	38.0	2.1e-36
AYO37171.1|1581237_1581459_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	3.0e-16
AYO37172.1|1581818_1582139_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
AYO37173.1|1582166_1584446_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	4.3e-166
AYO37174.1|1584648_1584867_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYO37175.1|1584973_1585699_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 2
CP033162	Serratia sp. P2ACOL2 chromosome, complete genome	5590417	1599336	1651631	5590417	capsid,portal,head,tRNA,tail,terminase,plate	Enterobacteria_phage(28.12%)	57	NA	NA
AYO37184.1|1599336_1600629_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.7	9.8e-91
AYO37185.1|1600899_1603353_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	1.3e-216
AYO37186.1|1603490_1604108_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.8	4.3e-76
AYO37187.1|1604109_1604970_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AYO37188.1|1605022_1605640_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.7	3.8e-24
AYO37189.1|1605813_1606959_+	MFS transporter	NA	NA	NA	NA	NA
AYO37190.1|1607011_1607752_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.8	2.5e-22
AYO37191.1|1608056_1610339_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	9.7e-158
AYO37192.1|1610393_1611254_-	formate transporter FocA	NA	NA	NA	NA	NA
AYO37193.1|1611706_1613470_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AYO37194.1|1613868_1615095_+	DUF4102 domain-containing protein	NA	A0A2H4JB45	uncultured_Caudovirales_phage	54.8	1.5e-133
AYO37195.1|1615091_1615913_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37196.1|1615990_1616323_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AYO37197.1|1616450_1616735_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AYO37198.1|1616748_1617396_+	hypothetical protein	NA	Q3LZN7	Bacteriophage	39.8	8.9e-16
AYO37199.1|1617392_1618190_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AYO37200.1|1618176_1618386_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37201.1|1618375_1618585_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37202.1|1618867_1619101_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37203.1|1619093_1619882_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	58.2	9.7e-41
AYO37204.1|1619878_1620184_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37205.1|1620272_1620641_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37206.1|1620640_1621243_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37207.1|1621242_1623324_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	49.8	9.4e-160
AYO37208.1|1623323_1623668_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AYO37209.1|1623724_1624645_+	hypothetical protein	NA	F1C596	Cronobacter_phage	45.9	2.7e-58
AYO37210.1|1624746_1625529_+	antitermination protein	NA	F1C595	Cronobacter_phage	52.5	3.6e-72
AYO37211.1|1627540_1627897_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37212.1|1627886_1628279_+	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	75.4	9.3e-53
AYO37213.1|1628275_1628662_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AYO37214.1|1628591_1628816_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37215.1|1628879_1629134_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37216.1|1629577_1630279_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37217.1|1630660_1631131_-	hypothetical protein	NA	NA	NA	NA	NA
AYO37218.1|1631504_1632059_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	68.3	3.2e-67
AYO37219.1|1632033_1633959_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	75.0	4.7e-299
AYO37220.1|1633921_1634167_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	57.4	4.8e-15
AYO37221.1|1634163_1635765_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	72.9	5.1e-222
AYO37222.1|1637082_1637409_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	53.2	1.8e-17
AYO37223.1|1637475_1638504_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	56.1	2.0e-107
AYO37224.1|1638563_1638974_+	DNA-packaging protein FI	NA	K7P7M3	Enterobacteria_phage	41.3	7.1e-11
AYO37225.1|1638983_1639352_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37226.1|1639353_1640016_+	hypothetical protein	NA	A0A088FVG9	Escherichia_phage	31.0	4.2e-13
AYO37227.1|1640041_1640578_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37228.1|1640570_1641191_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	35.0	3.9e-13
AYO37229.1|1641223_1641583_+|plate	baseplate assembly protein	plate	V5YTB2	Pseudomonas_phage	45.9	5.1e-21
AYO37230.1|1641557_1642472_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	42.9	2.0e-58
AYO37231.1|1642461_1643607_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	41.4	4.7e-28
AYO37232.1|1643606_1644953_+	hypothetical protein	NA	A0A0M7QEX0	Escherichia_phage	52.6	1.1e-15
AYO37233.1|1644949_1645678_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	28.5	7.4e-19
AYO37234.1|1645730_1647272_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	36.2	1.9e-72
AYO37235.1|1647268_1647775_+|tail	phage tail protein	tail	NA	NA	NA	NA
AYO37236.1|1647833_1648133_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AYO37237.1|1648232_1649858_+	hypothetical protein	NA	R9TRP8	Vibrio_phage	32.2	4.6e-45
AYO37238.1|1649857_1650316_+|tail	phage tail protein	tail	A4PE53	Ralstonia_virus	29.1	4.2e-12
AYO40720.1|1650290_1650506_+|tail	phage tail protein	tail	A0A193GYC8	Enterobacter_phage	42.6	7.7e-09
AYO37239.1|1650509_1651631_+	late control protein D	NA	R9TNM7	Vibrio_phage	34.5	5.4e-37
>prophage 3
CP033162	Serratia sp. P2ACOL2 chromosome, complete genome	5590417	1714214	1773687	5590417	capsid,portal,head,protease,tail,terminase,plate	Enterobacteria_phage(31.25%)	66	NA	NA
AYO37286.1|1714214_1715987_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
AYO40723.1|1716175_1716634_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
AYO37287.1|1716744_1717821_-	porin OmpA	NA	NA	NA	NA	NA
AYO37288.1|1718179_1718686_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
AYO37289.1|1718918_1719578_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
AYO37290.1|1719578_1721714_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AYO37291.1|1721740_1722193_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AYO37292.1|1722359_1724414_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	24.9	6.3e-15
AYO37293.1|1724447_1724906_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYO37294.1|1725026_1725698_-	DUF2057 family protein	NA	NA	NA	NA	NA
AYO37295.1|1725958_1726372_+	CoA-binding protein	NA	NA	NA	NA	NA
AYO37296.1|1726438_1726756_-	heat-shock protein HspQ	NA	NA	NA	NA	NA
AYO37297.1|1726817_1728008_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
AYO37298.1|1728100_1728379_+	acylphosphatase	NA	NA	NA	NA	NA
AYO37299.1|1728383_1728713_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
AYO37300.1|1728824_1729484_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	48.4	2.8e-41
AYO37301.1|1729984_1731166_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	57.4	8.6e-134
AYO37302.1|1732735_1733668_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	47.2	1.8e-09
AYO37303.1|1733770_1733968_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AYO37304.1|1734064_1734712_+	hypothetical protein	NA	Q3LZN7	Bacteriophage	39.8	8.9e-16
AYO37305.1|1734869_1735055_-	hypothetical protein	NA	NA	NA	NA	NA
AYO40724.1|1735245_1735524_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	53.2	1.9e-15
AYO37306.1|1735511_1736243_+	hypothetical protein	NA	A0A173GC65	Salmonella_phage	49.4	2.1e-42
AYO37307.1|1736232_1736436_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37308.1|1736425_1736635_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37309.1|1736917_1737151_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37310.1|1737143_1737932_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	58.2	9.7e-41
AYO37311.1|1737928_1738234_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37312.1|1738322_1738691_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37313.1|1738690_1739290_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37314.1|1739289_1741371_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	50.5	1.7e-161
AYO37315.1|1741370_1741715_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AYO37316.1|1741769_1742690_+	hypothetical protein	NA	F1C596	Cronobacter_phage	45.9	1.6e-58
AYO37317.1|1742791_1743574_+	antitermination protein	NA	F1C595	Cronobacter_phage	50.2	4.6e-67
AYO37318.1|1744596_1744884_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37319.1|1744876_1745401_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37320.1|1745804_1746032_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37321.1|1746743_1749263_+	urease subunit alpha	NA	NA	NA	NA	NA
AYO37322.1|1750899_1751280_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYO37323.1|1751474_1751831_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37324.1|1751820_1752216_+	M15 family peptidase	NA	E7C9S9	Salmonella_phage	55.0	8.3e-33
AYO37325.1|1752251_1752677_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	35.2	2.0e-08
AYO37326.1|1752846_1753194_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37327.1|1753537_1754092_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	68.9	1.5e-67
AYO37328.1|1754066_1755992_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	75.0	1.8e-298
AYO37329.1|1755954_1756200_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	57.4	4.8e-15
AYO37330.1|1756196_1757798_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	72.9	5.1e-222
AYO37331.1|1759115_1759442_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	53.2	1.8e-17
AYO37332.1|1759505_1760534_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	56.1	2.0e-107
AYO37333.1|1760593_1761004_+	hypothetical protein	NA	K7P7M3	Enterobacteria_phage	42.0	2.4e-11
AYO37334.1|1761013_1761382_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37335.1|1761383_1762076_+	hypothetical protein	NA	NA	NA	NA	NA
AYO40725.1|1762094_1762631_+	hypothetical protein	NA	Q9JML9	Wolbachia_phage	30.6	2.1e-10
AYO37336.1|1762623_1763244_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	35.4	2.3e-13
AYO37337.1|1763276_1763636_+|plate	baseplate assembly protein	plate	V5YTB2	Pseudomonas_phage	45.9	3.0e-21
AYO37338.1|1763610_1764525_+|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	41.2	9.8e-53
AYO37339.1|1764514_1765663_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	41.4	2.8e-28
AYO37340.1|1765662_1767009_+	hypothetical protein	NA	A0A0M7QEX0	Escherichia_phage	52.6	1.1e-15
AYO37341.1|1767005_1767734_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	28.5	7.4e-19
AYO37342.1|1767786_1769328_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	36.2	1.9e-72
AYO37343.1|1769324_1769831_+|tail	phage tail protein	tail	NA	NA	NA	NA
AYO37344.1|1769889_1770189_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AYO37345.1|1770288_1771914_+	hypothetical protein	NA	R9TRP8	Vibrio_phage	32.2	4.6e-45
AYO37346.1|1771913_1772372_+|tail	phage tail protein	tail	A4PE53	Ralstonia_virus	29.1	4.2e-12
AYO40726.1|1772346_1772562_+|tail	phage tail protein	tail	A0A193GYC8	Enterobacter_phage	42.6	7.7e-09
AYO37347.1|1772565_1773687_+	late control protein D	NA	R9TNM7	Vibrio_phage	34.5	5.4e-37
>prophage 4
CP033162	Serratia sp. P2ACOL2 chromosome, complete genome	5590417	1830203	1875037	5590417	head,lysis,tail,integrase,terminase	Pectobacterium_phage(26.53%)	61	1821905:1821919	1849202:1849216
1821905:1821919	attL	CGCTGGCGCAGCAGT	NA	NA	NA	NA
AYO37400.1|1830203_1831220_-|integrase	integrase	integrase	K7PLZ2	Enterobacterial_phage	63.9	1.6e-125
AYO37401.1|1831220_1831445_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	40.6	6.2e-09
AYO37402.1|1831401_1831611_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	46.4	8.3e-08
AYO37403.1|1831839_1832340_-	hypothetical protein	NA	H9C156	Pectobacterium_phage	76.5	1.3e-62
AYO37404.1|1832336_1834535_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	40.2	5.7e-123
AYO37405.1|1834574_1834892_-	hypothetical protein	NA	NA	NA	NA	NA
AYO37406.1|1835414_1835612_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37407.1|1835731_1836121_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	58.7	1.6e-33
AYO37408.1|1836201_1836408_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37409.1|1836469_1836922_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	58.3	3.6e-32
AYO37410.1|1836947_1837166_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	58.0	5.4e-18
AYO37411.1|1837168_1838014_+	hypothetical protein	NA	A0A1C9LVZ5	Vibrio_phage	43.3	8.3e-14
AYO37412.1|1838010_1838616_+	DNA replication protein DnaC	NA	K7PLU3	Enterobacteria_phage	44.0	1.5e-41
AYO37413.1|1838615_1840031_+	helicase DnaB	NA	H9C165	Pectobacterium_phage	66.2	9.2e-175
AYO37414.1|1840074_1840566_+	hypothetical protein	NA	H9C166	Pectobacterium_phage	46.8	9.0e-29
AYO37415.1|1840569_1840815_+	hypothetical protein	NA	H9C167	Pectobacterium_phage	51.9	4.1e-14
AYO37416.1|1840921_1841443_+	SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.8	8.0e-68
AYO37417.1|1841439_1843731_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.5	2.9e-234
AYO37418.1|1843976_1844168_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37419.1|1844236_1844830_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	65.5	1.7e-74
AYO37420.1|1844826_1845114_+	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	65.3	2.5e-31
AYO37421.1|1845110_1845611_+	DUF1133 family protein	NA	I6S672	Salmonella_phage	58.8	7.5e-47
AYO37422.1|1846323_1846998_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37423.1|1846978_1848094_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	30.3	1.4e-29
AYO37424.1|1848272_1848536_+|lysis	lysis protein	lysis	Q7Y3V4	Yersinia_phage	52.9	7.0e-20
AYO37425.1|1848535_1849066_+	lysozyme	NA	H9C184	Pectobacterium_phage	83.4	2.4e-83
AYO37426.1|1849062_1849446_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
1849202:1849216	attR	CGCTGGCGCAGCAGT	NA	NA	NA	NA
AYO37427.1|1849429_1849615_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37428.1|1849627_1849867_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37429.1|1850929_1852342_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.3	2.3e-186
AYO37430.1|1852341_1853892_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.8	4.5e-106
AYO40729.1|1853932_1854616_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	51.3	2.6e-58
AYO37431.1|1854619_1855945_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	40.5	1.8e-68
AYO37432.1|1855946_1856429_+	hypothetical protein	NA	E2GLV4	Acinetobacter_phage	52.1	2.1e-30
AYO37433.1|1856428_1857457_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	49.1	5.4e-84
AYO37434.1|1857460_1857811_+	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	36.0	3.5e-11
AYO37435.1|1857814_1858270_+	DUF4054 domain-containing protein	NA	K4NXG6	Acinetobacter_phage	42.6	9.6e-17
AYO37436.1|1858287_1858611_+	hypothetical protein	NA	A0A2P1JY38	Gordonia_phage	56.7	1.2e-08
AYO37437.1|1858610_1859090_+	hypothetical protein	NA	I6ZXX4	Escherichia_phage	33.9	8.6e-08
AYO37438.1|1859086_1859452_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37439.1|1859436_1859988_+	hypothetical protein	NA	A0A077KC88	Edwardsiella_phage	33.3	5.2e-17
AYO37440.1|1859968_1861453_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	38.0	3.1e-88
AYO37441.1|1861452_1861893_+	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	35.3	1.9e-17
AYO37442.1|1861892_1862297_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.6	3.5e-18
AYO37443.1|1862299_1862506_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AYO37444.1|1862505_1864440_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	58.0	2.4e-56
AYO37445.1|1864436_1865243_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	41.4	3.5e-30
AYO37446.1|1865242_1865545_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	51.5	2.2e-25
AYO37447.1|1865541_1866387_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	35.1	1.1e-37
AYO37448.1|1866388_1867066_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	40.2	5.6e-37
AYO37449.1|1867066_1867417_-	hypothetical protein	NA	NA	NA	NA	NA
AYO37450.1|1867403_1867631_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37451.1|1867651_1868008_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.7e-21
AYO37452.1|1868004_1869252_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	51.7	1.0e-105
AYO37453.1|1869253_1869841_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	39.6	2.7e-35
AYO37454.1|1869842_1871390_+	hypothetical protein	NA	H9C0Y2	Aeromonas_phage	51.6	1.7e-25
AYO37455.1|1871365_1871914_+|tail	tail fiber assembly protein	tail	A0A222YXY8	Escherichia_phage	40.3	2.2e-28
AYO37456.1|1871953_1873393_-	hypothetical protein	NA	A8CG94	Salmonella_phage	23.6	3.5e-20
AYO37457.1|1873406_1874318_-	glycosyltransferase	NA	M1FQW5	Enterobacteria_phage	75.2	4.1e-136
AYO37458.1|1874317_1874671_-	GtrA family protein	NA	B9UDL8	Salmonella_phage	59.0	8.2e-32
AYO37459.1|1874842_1875037_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	53.8	9.7e-11
>prophage 5
CP033162	Serratia sp. P2ACOL2 chromosome, complete genome	5590417	2065041	2210544	5590417	capsid,portal,head,tRNA,tail,integrase,terminase,plate,coat	Enterobacteria_phage(33.33%)	153	2140097:2140123	2175945:2175971
AYO40737.1|2065041_2066145_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AYO37634.1|2066240_2066687_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AYO37635.1|2066696_2067032_-	hypothetical protein	NA	NA	NA	NA	NA
AYO40738.1|2067053_2067680_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AYO37636.1|2067812_2069066_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.0e-20
AYO37637.1|2069369_2069678_-	monooxygenase	NA	NA	NA	NA	NA
AYO37638.1|2069777_2070689_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYO37639.1|2070676_2071588_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYO37640.1|2071683_2073282_+	benzoylformate decarboxylase	NA	NA	NA	NA	NA
AYO37641.1|2073373_2074153_+	cyclase family protein	NA	NA	NA	NA	NA
AYO37642.1|2074834_2075962_-|integrase	integrase	integrase	Q77Z04	Phage_21	59.8	3.6e-121
AYO37643.1|2075942_2076188_-	excisionase	NA	NA	NA	NA	NA
AYO37644.1|2076187_2076805_-	3'-5' exoribonuclease	NA	Q52PP6	Xanthomonas_phage	27.3	5.1e-13
AYO37645.1|2077086_2077704_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37646.1|2078312_2078963_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	59.3	2.5e-71
AYO37647.1|2079068_2079296_+	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	1.9e-18
AYO37648.1|2079323_2079857_+	DNA-binding protein	NA	Q8SBF4	Shigella_phage	34.2	1.9e-16
AYO37649.1|2080055_2081099_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	61.9	1.6e-30
AYO37650.1|2081095_2081443_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37651.1|2081439_2081811_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	57.4	1.1e-34
AYO37652.1|2081807_2082806_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.4	3.2e-89
AYO37653.1|2082858_2083260_+	antitermination protein Q	NA	B6SCY2	Bacteriophage	55.8	5.5e-32
AYO37654.1|2083671_2084055_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37655.1|2084054_2084429_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37656.1|2085701_2086055_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37657.1|2086137_2086539_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37658.1|2086525_2086966_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	65.8	5.6e-46
AYO37659.1|2086962_2087343_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AYO37660.1|2087494_2087692_-	hypothetical protein	NA	NA	NA	NA	NA
AYO37661.1|2088203_2088758_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	68.9	5.5e-67
AYO37662.1|2088732_2090658_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	74.7	2.4e-298
AYO37663.1|2090620_2090866_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	58.8	2.8e-15
AYO37664.1|2090862_2092464_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	72.9	3.9e-222
AYO37665.1|2093781_2094108_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	53.2	5.3e-17
AYO37666.1|2094174_2095203_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	56.1	9.2e-108
AYO37667.1|2095262_2095673_+	DNA-packaging protein FI	NA	K7P7M3	Enterobacteria_phage	41.3	7.1e-11
AYO37668.1|2095682_2096051_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37669.1|2096052_2096709_+	hypothetical protein	NA	R9TR34	Vibrio_phage	34.6	4.2e-21
AYO37670.1|2096734_2097271_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37671.1|2097263_2097884_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	34.4	8.8e-13
AYO37672.1|2097916_2098276_+|plate	baseplate assembly protein	plate	E5FFH4	Burkholderia_phage	49.6	6.0e-22
AYO37673.1|2099153_2100302_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	41.4	4.7e-28
AYO37674.1|2100301_2100940_+	hypothetical protein	NA	D5LGZ0	Escherichia_phage	30.3	4.3e-07
AYO37675.1|2100999_2101647_+|tail	tail fiber protein	tail	A0A0M7QEX0	Escherichia_phage	51.3	1.2e-15
AYO37676.1|2101643_2102372_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	30.9	4.2e-22
AYO37677.1|2102425_2103967_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	35.2	2.7e-71
AYO37678.1|2103963_2104470_+|tail	phage tail protein	tail	NA	NA	NA	NA
AYO37679.1|2104526_2104826_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AYO37680.1|2104928_2106548_+	hypothetical protein	NA	R9TRP8	Vibrio_phage	42.3	5.2e-41
AYO37681.1|2106547_2107006_+|tail	phage tail protein	tail	V5YTC2	Pseudomonas_phage	36.8	5.5e-20
AYO40739.1|2106980_2107196_+|tail	phage tail protein	tail	A0A193GYC8	Enterobacter_phage	43.3	4.5e-09
AYO37682.1|2107199_2108327_+	late control protein D	NA	R9TNM7	Vibrio_phage	34.2	9.3e-37
AYO37683.1|2108350_2109046_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37684.1|2109691_2110114_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	54.3	4.0e-33
AYO37685.1|2110113_2111382_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	71.5	2.2e-175
AYO37686.1|2112845_2113982_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYO40740.1|2114154_2115039_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYO37687.1|2116198_2117119_-	Mig-14 family protein	NA	NA	NA	NA	NA
AYO37688.1|2117408_2118530_-	AI-2E family transporter	NA	NA	NA	NA	NA
AYO37689.1|2118728_2119940_-	MFS transporter	NA	NA	NA	NA	NA
AYO37690.1|2119938_2120136_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37691.1|2120132_2120447_-	hypothetical protein	NA	NA	NA	NA	NA
AYO37692.1|2120612_2121029_+	DUF2000 domain-containing protein	NA	NA	NA	NA	NA
AYO37693.1|2121140_2122178_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AYO37694.1|2122386_2123310_+	AP endonuclease	NA	NA	NA	NA	NA
AYO37695.1|2123324_2124497_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AYO37696.1|2124642_2124852_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37697.1|2125000_2125744_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
AYO37698.1|2125871_2126516_+	Qnr family pentapeptide repeat protein	NA	NA	NA	NA	NA
AYO37699.1|2126831_2127044_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AYO37700.1|2127437_2128118_-	hydrolase	NA	NA	NA	NA	NA
AYO37701.1|2128386_2128812_+	universal stress protein UspA	NA	NA	NA	NA	NA
AYO37702.1|2129087_2129843_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYO37703.1|2129884_2131165_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AYO37704.1|2131176_2132673_-	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
AYO37705.1|2132688_2133246_-	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
AYO37706.1|2133242_2134004_-	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
AYO37707.1|2134243_2135662_+	glutamine synthetase	NA	NA	NA	NA	NA
AYO37708.1|2135792_2135990_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37709.1|2135979_2137350_+	APC family permease	NA	NA	NA	NA	NA
AYO37710.1|2137567_2138461_+	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
AYO37711.1|2138534_2138807_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37712.1|2139202_2140078_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
2140097:2140123	attL	ACAGAAAACCCCGCTTTGGCGGGGTTT	NA	NA	NA	NA
AYO37713.1|2140268_2140652_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	65.4	1.7e-43
AYO37714.1|2140775_2141024_-	hypothetical protein	NA	NA	NA	NA	NA
AYO37715.1|2141069_2142224_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	88.7	4.7e-193
AYO37716.1|2142376_2143558_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.4	1.5e-154
AYO37717.1|2143558_2144074_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.8	5.0e-54
AYO37718.1|2144137_2144437_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	84.8	6.5e-38
AYO37719.1|2144451_2144616_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	57.8	2.4e-10
AYO37720.1|2144605_2147560_+|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	92.2	6.2e-274
AYO37721.1|2147574_2148066_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	61.1	1.8e-53
AYO37722.1|2148160_2149324_-|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	55.3	3.1e-51
AYO37723.1|2149335_2150052_-	hypothetical protein	NA	NA	NA	NA	NA
AYO37724.1|2150048_2151977_-|tail	phage tail protein	tail	A0A2D1GNM3	Pseudomonas_phage	52.1	4.8e-25
AYO40741.1|2151858_2152470_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	49.1	2.3e-42
AYO37725.1|2152462_2153362_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	63.2	6.0e-95
AYO37726.1|2153348_2153717_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	52.2	4.8e-27
AYO37727.1|2153713_2154298_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	64.2	7.6e-67
AYO37728.1|2154297_2154936_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	50.2	9.6e-47
AYO37729.1|2154932_2155394_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	52.6	4.6e-35
AYO37730.1|2155535_2155919_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AYO37731.1|2155915_2156470_-	lysozyme	NA	A0A1W5P530	Pectobacterium_phage	33.5	4.1e-22
AYO37732.1|2156466_2156748_-	hypothetical protein	NA	B9A7B8	Serratia_phage	97.4	1.2e-33
AYO37733.1|2156738_2156939_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	61.5	4.6e-16
AYO37734.1|2156938_2157436_-|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	77.6	2.2e-67
AYO37735.1|2157539_2158454_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	82.3	2.8e-100
AYO37736.1|2158498_2159545_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.1	7.2e-108
AYO37737.1|2159581_2160415_-|capsid	phage capsid protein	capsid	B9A7B4	Serratia_phage	67.1	3.6e-102
AYO37738.1|2160575_2162297_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	65.1	1.2e-224
AYO37739.1|2162298_2163354_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	67.9	2.9e-141
AYO37740.1|2166022_2167159_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	28.9	8.3e-17
AYO37741.1|2167309_2169766_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	40.4	3.3e-135
AYO37742.1|2169916_2170834_-	DNA cytosine methyltransferase	NA	S5WBB0	Pseudomonas_phage	26.9	1.2e-13
AYO37743.1|2170826_2171183_-	hypothetical protein	NA	NA	NA	NA	NA
AYO37744.1|2171179_2172001_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	49.2	5.9e-65
AYO37745.1|2172004_2172223_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	55.6	1.6e-14
AYO37746.1|2173107_2173305_-	hypothetical protein	NA	NA	NA	NA	NA
AYO37747.1|2173594_2173858_-	hypothetical protein	NA	NA	NA	NA	NA
AYO37748.1|2173854_2174061_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	65.6	5.6e-17
AYO37749.1|2174057_2174390_-	hypothetical protein	NA	NA	NA	NA	NA
AYO37750.1|2174484_2174787_+	XRE family transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	8.0e-20
AYO37751.1|2174874_2175882_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	53.9	1.9e-102
AYO37752.1|2175981_2176161_-	hypothetical protein	NA	NA	NA	NA	NA
2175945:2175971	attR	ACAGAAAACCCCGCTTTGGCGGGGTTT	NA	NA	NA	NA
AYO37753.1|2176623_2177106_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37754.1|2177218_2177749_+	chorismate mutase	NA	NA	NA	NA	NA
AYO37755.1|2177761_2179297_-	class A beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AYO37756.1|2179578_2180382_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
AYO37757.1|2180378_2181602_-	imidazolonepropionase	NA	NA	NA	NA	NA
AYO37758.1|2181761_2182517_-	histidine utilization repressor	NA	NA	NA	NA	NA
AYO37759.1|2182693_2184064_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AYO37760.1|2184063_2184627_+	HutD family protein	NA	NA	NA	NA	NA
AYO37761.1|2184705_2185707_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYO37762.1|2185763_2187206_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
AYO37763.1|2187202_2188462_-	MFS transporter	NA	NA	NA	NA	NA
AYO37764.1|2188634_2189945_-	MFS transporter	NA	NA	NA	NA	NA
AYO37765.1|2190035_2190422_-	GFA family protein	NA	NA	NA	NA	NA
AYO37766.1|2190508_2191207_-	hydrolase	NA	NA	NA	NA	NA
AYO37767.1|2191300_2191957_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYO37768.1|2191974_2193624_-	aromatic amino acid lyase	NA	NA	NA	NA	NA
AYO37769.1|2193675_2195016_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	41.0	8.4e-85
AYO37770.1|2196653_2197745_-	DUF917 domain-containing protein	NA	NA	NA	NA	NA
AYO37771.1|2197947_2198844_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYO37772.1|2199020_2200406_+	allantoinase	NA	NA	NA	NA	NA
AYO37773.1|2200402_2201653_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AYO37774.1|2201700_2203320_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.1	9.0e-142
AYO37775.1|2203785_2205129_+	malate permease	NA	A0A140XAH4	Dickeya_phage	55.3	5.5e-28
AYO37776.1|2205436_2206867_+	serine 3-dehydrogenase	NA	NA	NA	NA	NA
AYO37777.1|2207017_2207227_-	hypothetical protein	NA	NA	NA	NA	NA
AYO37778.1|2208184_2208577_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
AYO37779.1|2208578_2209181_+	hypothetical protein	NA	NA	NA	NA	NA
AYO37780.1|2209235_2209475_-	DUF1480 family protein	NA	NA	NA	NA	NA
AYO37781.1|2209611_2210544_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 6
CP033162	Serratia sp. P2ACOL2 chromosome, complete genome	5590417	3015312	3063183	5590417	head,protease,tail,terminase,holin	Salmonella_phage(41.82%)	73	NA	NA
AYO38454.1|3015312_3017607_-	hypothetical protein	NA	A0A2D1GNM3	Pseudomonas_phage	37.4	4.0e-79
AYO38455.1|3017607_3020103_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	55.1	2.6e-257
AYO40777.1|3020050_3020455_-	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	63.9	2.2e-44
AYO38456.1|3020474_3020945_-	DUF1833 domain-containing protein	NA	R9TPR6	Aeromonas_phage	62.1	4.7e-51
AYO38457.1|3020945_3021413_-	hypothetical protein	NA	A0A173GC35	Salmonella_phage	64.5	1.0e-53
AYO40778.1|3021469_3024070_-|tail	phage tail tape measure protein	tail	A0A1B1W284	Salmonella_phage	40.0	2.0e-114
AYO38458.1|3024193_3024547_-	hypothetical protein	NA	NA	NA	NA	NA
AYO38459.1|3024662_3024950_-	hypothetical protein	NA	H6WRV0	Salmonella_phage	78.7	9.0e-37
AYO38460.1|3024950_3025739_-	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	67.2	3.5e-91
AYO40779.1|3025818_3026355_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	53.3	1.1e-27
AYO38461.1|3026422_3026593_-	Arc family DNA binding domain-containing protein	NA	G9L6D7	Escherichia_phage	63.6	4.1e-13
AYO38462.1|3026715_3027144_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	56.2	3.2e-30
AYO38463.1|3027171_3027846_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	55.4	1.4e-64
AYO38464.1|3027897_3028647_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	79.3	4.7e-85
AYO38465.1|3028672_3029056_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	65.4	9.8e-47
AYO38466.1|3029052_3029478_-	HK97 gp10 family phage protein	NA	R9TPP7	Aeromonas_phage	48.9	1.2e-29
AYO38467.1|3029479_3029830_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	55.2	9.3e-28
AYO38468.1|3029833_3030004_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AYO38469.1|3030003_3030402_-	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	86.8	1.6e-60
AYO38470.1|3030470_3030665_-	glycoprotein	NA	Q5G8X9	Enterobacteria_phage	59.3	9.4e-14
AYO38471.1|3030676_3031777_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	74.9	1.3e-152
AYO38472.1|3031787_3032228_-	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	64.8	6.4e-42
AYO38473.1|3032227_3033496_-	hypothetical protein	NA	G0ZND7	Cronobacter_phage	71.6	8.2e-175
AYO38474.1|3033508_3034456_-|head	phage head morphogenesis protein	head	I6S615	Salmonella_phage	69.3	1.5e-112
AYO38475.1|3034418_3035771_-	DUF1073 domain-containing protein	NA	I6R9A1	Salmonella_phage	69.8	2.0e-179
AYO38476.1|3035792_3037112_-|terminase	PBSX family phage terminase large subunit	terminase	Q5G8Y7	Enterobacteria_phage	89.1	9.6e-235
AYO38477.1|3037095_3037527_-|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	86.7	4.6e-61
AYO38478.1|3037529_3037724_-	hypothetical protein	NA	NA	NA	NA	NA
AYO40780.1|3038261_3038504_-	peptidase	NA	NA	NA	NA	NA
AYO38479.1|3038807_3039248_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	70.5	1.3e-50
AYO38480.1|3039261_3039582_-	hypothetical protein	NA	NA	NA	NA	NA
AYO38481.1|3039574_3039910_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	45.9	6.0e-24
AYO38482.1|3040615_3041461_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	51.1	9.6e-71
AYO38483.1|3041615_3041999_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	54.0	7.3e-26
AYO38484.1|3041995_3042358_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	65.0	1.9e-36
AYO40781.1|3042354_3042645_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	74.7	1.2e-36
AYO38485.1|3042637_3042802_-	protein ninF	NA	NA	NA	NA	NA
AYO38486.1|3042917_3043097_-	NinE family protein	NA	NA	NA	NA	NA
AYO38487.1|3043093_3043642_-	phage N-6-adenine-methyltransferase	NA	A0A2I7R2Q6	Vibrio_phage	49.4	1.8e-38
AYO38488.1|3043823_3044267_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	67.8	2.8e-53
AYO38489.1|3044270_3044612_-	hypothetical protein	NA	I6R980	Salmonella_phage	60.5	2.7e-32
AYO38490.1|3044949_3045384_-	hypothetical protein	NA	R9W080	Serratia_phage	62.8	5.0e-07
AYO38491.1|3045407_3046745_-	DNA helicase	NA	A0A2I7S0U1	Vibrio_phage	37.1	2.1e-80
AYO38492.1|3046744_3047629_-	DNA replication protein	NA	A0A0M5M7Y1	Salmonella_phage	76.9	2.8e-57
AYO38493.1|3047814_3048093_-	hypothetical protein	NA	A4KWU5	Enterobacteria_phage	53.3	2.3e-21
AYO40782.1|3048207_3048435_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	73.3	5.8e-23
AYO38494.1|3048552_3049287_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	70.0	2.0e-93
AYO38495.1|3049715_3049982_+	transcriptional regulator	NA	NA	NA	NA	NA
AYO38496.1|3049999_3050293_+	hypothetical protein	NA	NA	NA	NA	NA
AYO38497.1|3050611_3051496_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	65.6	6.2e-04
AYO38498.1|3051683_3052142_+	HNH endonuclease	NA	S4TQH0	Salmonella_virus	45.6	2.9e-29
AYO38499.1|3052231_3052540_+	superinfection exclusion protein	NA	E7C9Q4	Salmonella_phage	74.5	1.6e-39
AYO38500.1|3053611_3053755_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	62.8	9.6e-08
AYO38501.1|3053741_3054308_+	hypothetical protein	NA	A0A0M4RD11	Salmonella_phage	40.9	7.5e-19
AYO38502.1|3054596_3055202_+	recombinase	NA	I6RSN3	Salmonella_phage	74.1	7.9e-75
AYO38503.1|3055201_3055600_+	hypothetical protein	NA	I6S1T0	Salmonella_phage	77.9	1.6e-47
AYO38504.1|3055625_3056003_+	hypothetical protein	NA	NA	NA	NA	NA
AYO38505.1|3056021_3056861_+	hypothetical protein	NA	NA	NA	NA	NA
AYO38506.1|3057330_3057624_+	hypothetical protein	NA	NA	NA	NA	NA
AYO38507.1|3057620_3057911_+	hypothetical protein	NA	R9W0X4	Serratia_phage	86.9	1.0e-32
AYO38508.1|3057897_3058185_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
AYO38509.1|3058189_3058459_-	hypothetical protein	NA	NA	NA	NA	NA
AYO38510.1|3058586_3058826_+	hypothetical protein	NA	A0A219YA55	Aeromonas_phage	46.2	3.5e-10
AYO38511.1|3058825_3059305_+	hypothetical protein	NA	NA	NA	NA	NA
AYO38512.1|3059305_3059491_+	hypothetical protein	NA	R9TNE4	Aeromonas_phage	56.7	2.4e-11
AYO38513.1|3059487_3060204_+	hypothetical protein	NA	NA	NA	NA	NA
AYO38514.1|3060260_3060518_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	60.0	1.1e-20
AYO38515.1|3060579_3060849_+	hypothetical protein	NA	S4TP00	Salmonella_phage	41.9	2.5e-12
AYO38516.1|3060867_3061089_+	hypothetical protein	NA	NA	NA	NA	NA
AYO38517.1|3061081_3061297_+	hypothetical protein	NA	NA	NA	NA	NA
AYO38518.1|3061395_3061620_+	hypothetical protein	NA	A0A2H4J398	uncultured_Caudovirales_phage	59.2	3.6e-17
AYO38519.1|3061619_3061868_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	53.4	9.5e-19
AYO38520.1|3061899_3063183_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	56.7	1.8e-137
>prophage 7
CP033162	Serratia sp. P2ACOL2 chromosome, complete genome	5590417	3233668	3242630	5590417		Escherichia_phage(50.0%)	6	NA	NA
AYO38677.1|3233668_3234571_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.7	1.7e-36
AYO38678.1|3235035_3237369_+	DMSO reductase	NA	A0A077SK27	Escherichia_phage	24.1	7.6e-33
AYO38679.1|3237401_3237926_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	38.0	9.3e-32
AYO38680.1|3237929_3238799_+	dimethyl sulfoxide reductase	NA	A0A077SK59	Escherichia_phage	25.5	2.2e-06
AYO38681.1|3239016_3239802_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	73.9	1.0e-90
AYO38682.1|3240485_3242630_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	69.2	2.5e-139
>prophage 8
CP033162	Serratia sp. P2ACOL2 chromosome, complete genome	5590417	3870009	3879944	5590417		Planktothrix_phage(33.33%)	8	NA	NA
AYO39218.1|3870009_3871737_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.9	1.1e-17
AYO39219.1|3871786_3872296_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AYO40821.1|3872560_3873877_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.6	3.2e-20
AYO39220.1|3873882_3874563_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYO39221.1|3874737_3875931_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	70.0	3.4e-29
AYO40822.1|3875933_3877886_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	41.2	1.7e-38
AYO39222.1|3877889_3878771_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	40.3	1.1e-53
AYO39223.1|3878855_3879944_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	41.2	5.4e-34
