The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033250	Escherichia coli strain ECCHD184 chromosome, complete genome	4783813	1401119	1409361	4783813		Enterobacteria_phage(62.5%)	8	NA	NA
AYP01387.1|1401119_1401287_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	3.7e-27
AYP01388.1|1401359_1401644_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	97.9	2.7e-49
AYP01389.1|1401636_1401891_-	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	96.2	3.2e-38
AYP01390.1|1404076_1405537_-	hypothetical protein	NA	A8CG94	Salmonella_phage	32.1	1.6e-17
AYP01391.1|1405538_1406450_-	glycosyltransferase	NA	M1FQW5	Enterobacteria_phage	89.1	1.9e-157
AYP01392.1|1406446_1406809_-	GtrA family protein	NA	U5P0S6	Shigella_phage	91.7	5.4e-55
AYP01393.1|1406959_1408117_-	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	99.7	2.8e-222
AYP01394.1|1408428_1409361_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
>prophage 2
CP033250	Escherichia coli strain ECCHD184 chromosome, complete genome	4783813	1676214	1685655	4783813		Enterobacteria_phage(85.71%)	10	NA	NA
AYP01618.1|1676214_1677141_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
AYP01619.1|1677145_1677877_+	ABC transporter permease	NA	NA	NA	NA	NA
AYP01620.1|1677857_1677965_-	protein YohO	NA	NA	NA	NA	NA
AYP01621.1|1678024_1678756_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AYP01622.1|1678977_1680663_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AYP01623.1|1680659_1681379_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYP01624.1|1681425_1681896_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AYP01625.1|1681935_1682397_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AYP01626.1|1682521_1684522_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
AYP01627.1|1684518_1685655_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 3
CP033250	Escherichia coli strain ECCHD184 chromosome, complete genome	4783813	2158122	2206255	4783813	coat,transposase,tRNA,tail,lysis,terminase	Escherichia_phage(52.5%)	57	NA	NA
AYP04423.1|2158122_2159355_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
AYP02043.1|2159609_2160593_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AYP02044.1|2161070_2162444_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AYP02045.1|2162572_2163508_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AYP02046.1|2163559_2164795_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
AYP02047.1|2164796_2165012_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AYP04425.1|2165090_2165300_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	96.8	1.8e-26
AYP04424.1|2165292_2165487_-	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AYP02048.1|2165543_2166353_-	DNA recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
AYP02049.1|2166345_2168946_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
AYP02050.1|2169047_2169323_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	6.8e-42
AYP04426.1|2169397_2169568_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AYP02051.1|2169567_2169789_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
AYP02052.1|2170715_2170871_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AYP02053.1|2170881_2171061_-	hypothetical protein	NA	NA	NA	NA	NA
AYP02054.1|2171302_2171722_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
AYP02055.1|2171801_2172056_+	DNA-binding protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
AYP02056.1|2172052_2172478_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AYP02057.1|2172549_2173620_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
AYP02058.1|2173660_2174083_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
AYP02059.1|2174417_2176421_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.4e-21
AYP02060.1|2176484_2177762_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AYP02061.1|2177892_2178774_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYP02062.1|2178770_2179463_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AYP02063.1|2179474_2180674_-	MFS transporter	NA	NA	NA	NA	NA
AYP02064.1|2181035_2181179_+	hypothetical protein	NA	NA	NA	NA	NA
AYP02065.1|2181337_2181550_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	75.7	3.0e-21
AYP02066.1|2181900_2182116_+	hypothetical protein	NA	NA	NA	NA	NA
AYP02067.1|2182018_2182618_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
AYP02068.1|2182617_2182908_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
AYP02069.1|2182904_2183447_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
AYP02070.1|2184491_2184920_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AYP04427.1|2185091_2185466_+	tolA family protein	NA	NA	NA	NA	NA
AYP02071.1|2185717_2185933_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
AYP02072.1|2185932_2186430_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
AYP02073.1|2186646_2186832_+	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
AYP02074.1|2187028_2188486_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
AYP02075.1|2188623_2189415_+	transcriptional regulator	NA	R4TG31	Halovirus	40.2	2.8e-48
AYP02076.1|2189407_2190340_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
AYP02077.1|2190317_2190527_+	hypothetical protein	NA	NA	NA	NA	NA
AYP02078.1|2190530_2191625_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
AYP02079.1|2191605_2192907_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
AYP02080.1|2192909_2194316_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
AYP02081.1|2194299_2195412_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
AYP02082.1|2195516_2196281_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
AYP02083.1|2196379_2197519_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	75.0	7.4e-159
AYP02084.1|2197741_2198137_+	protein singed	NA	NA	NA	NA	NA
AYP02085.1|2198136_2198520_+	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
AYP02086.1|2198520_2198901_+	HK97 gp10 family phage protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
AYP02087.1|2198897_2199290_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AYP02088.1|2199316_2200279_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
AYP02089.1|2200339_2200789_+	hypothetical protein	NA	NA	NA	NA	NA
AYP02090.1|2200896_2201097_+	hypothetical protein	NA	NA	NA	NA	NA
AYP02091.1|2201262_2203179_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	39.4	1.8e-72
AYP02092.1|2203219_2204200_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
AYP02093.1|2204546_2204981_-	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
AYP02094.1|2205121_2206255_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 4
CP033250	Escherichia coli strain ECCHD184 chromosome, complete genome	4783813	2236569	2307654	4783813	transposase,protease	Escherichia_phage(23.08%)	56	NA	NA
AYP02119.1|2236569_2237843_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AYP02120.1|2238599_2238692_+	twice split molybdate metabolism regulator domain protein	NA	NA	NA	NA	NA
AYP04429.1|2239228_2241640_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AYP02121.1|2241847_2242708_+	oxidoreductase	NA	NA	NA	NA	NA
AYP02122.1|2244813_2245794_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
AYP02123.1|2246447_2247053_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
AYP02124.1|2247052_2247949_+	hypothetical protein	NA	NA	NA	NA	NA
AYP02125.1|2247964_2249722_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AYP04430.1|2249735_2251028_+	hypothetical protein	NA	NA	NA	NA	NA
AYP02126.1|2251081_2251687_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AYP02127.1|2251887_2255790_+	ATP-dependent helicase	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
AYP04431.1|2256158_2256863_+	YdcF family protein	NA	NA	NA	NA	NA
AYP02128.1|2257059_2258499_+	lactaldehyde dehydrogenase	NA	NA	NA	NA	NA
AYP02129.1|2259729_2260260_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
AYP02130.1|2260504_2260678_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
AYP02131.1|2260749_2260899_-	protein HokB	NA	NA	NA	NA	NA
AYP02132.1|2261034_2262403_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
AYP02133.1|2262743_2264384_+	methyl-accepting chemotaxis protein III	NA	NA	NA	NA	NA
AYP04432.1|2264421_2265345_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYP02134.1|2265561_2266905_+	VOC family protein	NA	NA	NA	NA	NA
AYP02135.1|2267129_2268785_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AYP02136.1|2268705_2268909_-	hypothetical protein	NA	NA	NA	NA	NA
AYP02137.1|2268924_2269149_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
AYP02138.1|2269211_2269751_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
AYP02139.1|2269742_2270723_-	hypothetical protein	NA	NA	NA	NA	NA
AYP02140.1|2270846_2271839_+	tellurite resistance protein TehA	NA	NA	NA	NA	NA
AYP02141.1|2271835_2272429_+	tellurite methyltransferase	NA	NA	NA	NA	NA
AYP02142.1|2272730_2273399_+	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
AYP02143.1|2273930_2275139_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
AYP02144.1|2275178_2276393_-	benzoate transporter BenE	NA	NA	NA	NA	NA
AYP02145.1|2276445_2276982_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYP02146.1|2277054_2279016_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.3	3.5e-23
AYP02147.1|2279559_2279736_+	mRNA interferase HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
AYP04433.1|2279781_2280198_+	antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
AYP02148.1|2280276_2281683_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AYP02149.1|2281927_2283073_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
AYP02150.1|2283090_2284104_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
AYP02151.1|2284104_2285046_+	ABC transporter permease	NA	NA	NA	NA	NA
AYP02152.1|2285035_2285830_+	ABC transporter permease	NA	NA	NA	NA	NA
AYP02153.1|2285851_2287276_+	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
AYP02154.1|2287372_2287468_-	stress response membrane protein YncL	NA	NA	NA	NA	NA
AYP04434.1|2287662_2287836_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
AYP02155.1|2287921_2288155_+	DUF2526 domain-containing protein	NA	NA	NA	NA	NA
AYP02156.1|2288155_2288605_-	DMT family transporter	NA	NA	NA	NA	NA
AYP02157.1|2288601_2289120_-	L-amino acid N-acyltransferase MnaT	NA	NA	NA	NA	NA
AYP02158.1|2289297_2290335_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AYP02159.1|2290532_2291198_+	transcriptional regulator	NA	NA	NA	NA	NA
AYP02160.1|2291233_2293336_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
AYP02161.1|2293577_2294639_+	YncE family protein	NA	NA	NA	NA	NA
AYP02162.1|2294751_2296251_-	L-asparagine permease	NA	NA	NA	NA	NA
AYP02163.1|2296517_2297135_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AYP02164.1|2297210_2297423_+	hypothetical protein	NA	NA	NA	NA	NA
AYP02165.1|2298242_2300351_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	5.6e-27
AYP02166.1|2300417_2304641_+	RHS repeat protein	NA	NA	NA	NA	NA
AYP02167.1|2304842_2305106_+	dCTP deaminase	NA	NA	NA	NA	NA
AYP02168.1|2306517_2307654_+|transposase	ISAs1-like element ISEc5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
CP033250	Escherichia coli strain ECCHD184 chromosome, complete genome	4783813	2381524	2490785	4783813	integrase,transposase,tail,protease,lysis,terminase	Enterobacteria_phage(43.14%)	104	2441358:2441373	2478590:2478605
AYP02221.1|2381524_2383075_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AYP02222.1|2383064_2384381_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AYP02223.1|2384680_2386003_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AYP02224.1|2386002_2386269_-	transcriptional regulator	NA	NA	NA	NA	NA
AYP02225.1|2392441_2394034_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
AYP02226.1|2394112_2395066_-	LsrR family transcriptional regulator	NA	NA	NA	NA	NA
AYP02227.1|2395314_2396850_+	autoinducer 2 import ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	4.4e-21
AYP02228.1|2396843_2397872_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
AYP02229.1|2397871_2398864_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
AYP02230.1|2398875_2399898_+	autoinducer 2 ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYP02231.1|2399924_2400800_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase LsrF	NA	NA	NA	NA	NA
AYP02232.1|2400823_2401114_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
AYP02233.1|2401170_2401929_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
AYP02234.1|2401932_2402847_-	bestrophin family inner membrane protein	NA	NA	NA	NA	NA
AYP02235.1|2403053_2404505_-	altronate oxidoreductase	NA	NA	NA	NA	NA
AYP02236.1|2404731_2405679_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	29.6	7.3e-19
AYP02237.1|2405790_2406150_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
AYP02238.1|2406149_2407076_-	glutaminase 2	NA	NA	NA	NA	NA
AYP02239.1|2407139_2408528_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYP02240.1|2408628_2409510_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYP02241.1|2409587_2410703_+	putative protein YneK	NA	NA	NA	NA	NA
AYP02242.1|2410852_2412043_+	MFS transporter	NA	NA	NA	NA	NA
AYP02243.1|2412067_2412733_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
AYP02244.1|2412944_2413379_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYP02245.1|2413398_2413782_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
AYP02246.1|2413813_2414032_+	multiple antibiotic resistance regulatory periplasmic protein MarB	NA	NA	NA	NA	NA
AYP02247.1|2414062_2414962_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
AYP02248.1|2415156_2416344_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
AYP02249.1|2416470_2416566_+	hypothetical protein	NA	NA	NA	NA	NA
AYP02250.1|2416784_2417675_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
AYP02251.1|2417929_2418322_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
AYP02252.1|2418597_2419116_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
AYP02253.1|2419159_2421205_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
AYP02254.1|2421341_2422088_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYP02255.1|2422176_2422863_+	transcriptional regulator	NA	NA	NA	NA	NA
AYP02256.1|2423039_2423243_+	protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
AYP02257.1|2424826_2426110_-	MFS transporter	NA	NA	NA	NA	NA
AYP02258.1|2426895_2427129_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AYP02259.1|2427445_2428036_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AYP02260.1|2428133_2428709_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	3.2e-102
AYP02261.1|2431651_2432251_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	8.2e-109
AYP02262.1|2432320_2435818_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.6	0.0e+00
AYP02263.1|2435878_2436526_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
AYP02264.1|2436423_2437167_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	7.3e-147
AYP02265.1|2437172_2437871_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	9.5e-133
AYP02266.1|2437880_2438210_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AYP02267.1|2438209_2441275_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.0	0.0e+00
AYP02268.1|2441246_2441576_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
2441358:2441373	attL	AAGGCTGAAATCAGCC	NA	NA	NA	NA
AYP04435.1|2441584_2441971_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	97.7	1.8e-64
AYP02269.1|2442031_2442775_-|tail	phage tail protein	tail	K7PGT7	Enterobacteria_phage	99.6	3.5e-133
AYP02270.1|2442785_2443187_-|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
AYP02271.1|2443183_2443762_-|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.5	9.4e-102
AYP02272.1|2443773_2444049_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
AYP02273.1|2444041_2444410_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	4.8e-51
AYP02274.1|2444451_2446575_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.1	0.0e+00
AYP02275.1|2447931_2448144_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AYP02276.1|2448140_2450240_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	98.7	0.0e+00
AYP02277.1|2450387_2451601_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.6e-167
AYP02278.1|2451606_2452101_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.2e-76
AYP02279.1|2452651_2452858_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
AYP02280.1|2453153_2453327_-	protein GnsB	NA	NA	NA	NA	NA
AYP02281.1|2453499_2453772_-	hypothetical protein	NA	NA	NA	NA	NA
AYP02282.1|2453802_2453991_-	cold-shock protein	NA	NA	NA	NA	NA
AYP02283.1|2455151_2455649_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AYP02284.1|2455645_2456179_-	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AYP02285.1|2456175_2456487_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	63.6	1.0e-25
AYP02286.1|2456491_2456707_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AYP02287.1|2457460_2457676_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
AYP02288.1|2458351_2459104_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	1.3e-130
AYP02289.1|2459117_2460167_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	3.3e-113
AYP02290.1|2460168_2460447_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
AYP02291.1|2460513_2460765_-	hypothetical protein	NA	NA	NA	NA	NA
AYP02292.1|2460981_2461194_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	3.9e-29
AYP04436.1|2461352_2461568_-	hypothetical protein	NA	NA	NA	NA	NA
AYP02293.1|2465600_2466029_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.8	1.6e-61
AYP02294.1|2466069_2467089_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	3.6e-56
AYP02295.1|2467015_2467537_-	hypothetical protein	NA	NA	NA	NA	NA
AYP02296.1|2467520_2467748_-	transcriptional regulator	NA	NA	NA	NA	NA
AYP02297.1|2467828_2468236_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
AYP02298.1|2468404_2468560_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AYP02299.1|2468827_2469211_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
AYP02300.1|2469207_2469555_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
AYP04437.1|2469536_2470712_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	59.6	3.6e-132
AYP02301.1|2470731_2470842_-	transporter	NA	NA	NA	NA	NA
AYP02302.1|2470899_2471919_-	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AYP02303.1|2471930_2473145_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AYP02304.1|2473350_2473677_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	1.3e-23
AYP02305.1|2473811_2474153_+	DUF1283 family protein	NA	NA	NA	NA	NA
AYP02306.1|2474187_2474748_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AYP02307.1|2474750_2475461_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AYP02308.1|2475568_2475874_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AYP02309.1|2476072_2478499_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
AYP04438.1|2478559_2480983_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	3.7e-208
2478590:2478605	attR	AAGGCTGAAATCAGCC	NA	NA	NA	NA
AYP02310.1|2480993_2481611_+	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AYP02311.1|2481612_2482467_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AYP02312.1|2482509_2483124_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AYP02313.1|2483282_2484575_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AYP02314.1|2484527_2485223_-	dethiobiotin synthase	NA	NA	NA	NA	NA
AYP02315.1|2485347_2486568_-	protein mlc	NA	NA	NA	NA	NA
AYP02316.1|2486702_2487596_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYP02317.1|2487702_2488956_+	MFS transporter	NA	NA	NA	NA	NA
AYP02318.1|2489352_2489688_+	acid shock protein	NA	NA	NA	NA	NA
AYP02319.1|2489780_2489864_+	hypothetical protein	NA	NA	NA	NA	NA
AYP02320.1|2489963_2490785_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 6
CP033250	Escherichia coli strain ECCHD184 chromosome, complete genome	4783813	3032991	3125935	4783813	plate,head,integrase,capsid,portal,tRNA,tail,protease,lysis	Salmonella_phage(57.63%)	95	3025954:3025969	3128880:3128895
3025954:3025969	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
AYP02815.1|3032991_3034284_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AYP02816.1|3034374_3035718_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AYP02817.1|3035728_3036340_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AYP02818.1|3036498_3040488_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AYP02819.1|3040622_3041117_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AYP02820.1|3041216_3041429_-	hypothetical protein	NA	NA	NA	NA	NA
AYP02821.1|3041661_3042627_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
AYP02822.1|3042749_3044516_+	ATP-binding/permease CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
AYP02823.1|3044516_3046238_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
AYP02824.1|3046279_3046984_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYP02825.1|3047268_3047487_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYP02826.1|3048171_3050448_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AYP02827.1|3050478_3050799_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AYP02828.1|3051121_3051346_+	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AYP02829.1|3051418_3053365_-	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AYP02830.1|3053361_3054477_-	MacA family efflux pump subunit	NA	NA	NA	NA	NA
AYP02831.1|3054591_3055584_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AYP02832.1|3055580_3057239_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AYP02833.1|3058444_3059344_+	transporter	NA	NA	NA	NA	NA
AYP02834.1|3059487_3061140_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AYP02835.1|3061151_3062120_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYP02836.1|3062252_3063971_+	pyruvate dehydrogenase [ubiquinone]	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
AYP02837.1|3064007_3065009_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AYP02838.1|3065019_3066450_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYP04458.1|3066548_3067562_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYP02839.1|3067558_3068389_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
AYP02840.1|3068385_3068709_-	hypothetical protein	NA	NA	NA	NA	NA
AYP02841.1|3068834_3069350_+	lipoprotein	NA	NA	NA	NA	NA
AYP02842.1|3069567_3070296_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
AYP02843.1|3070313_3071045_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYP02844.1|3071051_3071768_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AYP02845.1|3071767_3072436_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AYP02846.1|3072726_3073458_+	ABC transporter arginine-binding protein 1	NA	NA	NA	NA	NA
AYP02847.1|3073656_3074784_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.0e-27
AYP02848.1|3074824_3075313_-	DUF2593 family protein	NA	NA	NA	NA	NA
AYP02849.1|3075372_3076218_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AYP02850.1|3076214_3077168_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AYP02851.1|3077177_3078311_-	putrescine transport ATP-binding protein PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
AYP02852.1|3078405_3079518_-	putrescine-binding periplasmic protein	NA	NA	NA	NA	NA
AYP02853.1|3079868_3080345_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AYP02854.1|3080432_3081335_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AYP02855.1|3081395_3082094_-	nitroreductase NfsA	NA	NA	NA	NA	NA
AYP02856.1|3084350_3085724_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
AYP02857.1|3086087_3086279_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
AYP02858.1|3087151_3087439_-	DUF1418 family protein	NA	NA	NA	NA	NA
AYP02859.1|3087598_3087856_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
AYP02860.1|3087885_3088263_-	hypothetical protein	NA	NA	NA	NA	NA
AYP02861.1|3088532_3090218_+	transporter	NA	NA	NA	NA	NA
AYP02862.1|3090453_3090672_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYP02863.1|3090762_3091863_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	4.9e-176
AYP02864.1|3091859_3092345_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
AYP02865.1|3092341_3095419_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.3	0.0e+00
AYP02866.1|3095411_3095531_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYP02867.1|3095545_3095848_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AYP02868.1|3095902_3096418_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYP02869.1|3096427_3097600_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	2.7e-204
AYP02870.1|3097742_3098309_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	8.4e-87
AYP02871.1|3098336_3098738_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	37.7	7.7e-10
AYP02872.1|3099509_3099929_-|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	54.4	1.9e-35
AYP02873.1|3099932_3101336_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.9	5.2e-154
AYP02874.1|3101332_3101938_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
AYP02875.1|3101930_3102839_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.7e-143
AYP02876.1|3102825_3103185_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
AYP02877.1|3103181_3103760_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	8.8e-92
AYP02878.1|3103828_3104275_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.9e-62
AYP02879.1|3104267_3104699_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.7e-71
AYP02880.1|3104661_3104865_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	71.6	2.0e-22
AYP02881.1|3104794_3105223_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.1	3.8e-47
AYP02882.1|3105219_3105597_-	hypothetical protein	NA	NA	NA	NA	NA
AYP04459.1|3105598_3106072_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYP02883.1|3106091_3106307_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYP02884.1|3106310_3106514_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYP02885.1|3106513_3106978_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
AYP02886.1|3107073_3107724_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYP02887.1|3107727_3108786_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
AYP02888.1|3108802_3109636_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	2.4e-122
AYP02889.1|3109778_3111545_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYP02890.1|3111544_3112570_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	3.4e-171
AYP02891.1|3112594_3113569_-	DNA-processing protein DprA	NA	NA	NA	NA	NA
AYP02892.1|3113558_3114134_-	hypothetical protein	NA	NA	NA	NA	NA
AYP02893.1|3114118_3114319_-	hypothetical protein	NA	NA	NA	NA	NA
AYP02894.1|3114568_3116461_-	NTPase KAP	NA	NA	NA	NA	NA
AYP02895.1|3116775_3117081_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AYP02896.1|3117019_3117208_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
AYP02897.1|3117361_3119776_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
AYP02898.1|3119772_3120630_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	1.7e-160
AYP02899.1|3120626_3120854_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYP02900.1|3120853_3121087_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
AYP02901.1|3121154_3121496_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
AYP02902.1|3121459_3121660_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	3.5e-32
AYP02903.1|3121667_3122177_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.7e-86
AYP02904.1|3122209_3122431_-	regulator	NA	NA	NA	NA	NA
AYP02905.1|3122526_3123123_+	hypothetical protein	NA	A0A1S6KZZ7	Salmonella_phage	42.4	1.1e-39
AYP02906.1|3123143_3124820_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	67.0	5.7e-83
AYP02907.1|3124903_3125935_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	1.9e-105
3128880:3128895	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 7
CP033250	Escherichia coli strain ECCHD184 chromosome, complete genome	4783813	3209090	3243898	4783813	head,integrase,capsid,portal,tail,lysis,terminase	Enterobacteria_phage(57.14%)	44	3215237:3215253	3251937:3251953
AYP02980.1|3209090_3209675_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.3	4.3e-102
AYP02981.1|3209674_3212638_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	93.2	1.2e-54
AYP02982.1|3212702_3213302_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	1.5e-110
AYP02983.1|3213371_3216785_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
3215237:3215253	attL	CGGAAGATGGCAGCGTG	NA	NA	NA	NA
AYP02984.1|3216844_3217516_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
AYP02985.1|3217413_3218157_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	5.6e-147
AYP02986.1|3218162_3218861_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
AYP02987.1|3218860_3219190_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AYP02988.1|3219186_3221748_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.1	0.0e+00
AYP02989.1|3221740_3222175_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AYP02990.1|3222156_3222579_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.9e-72
AYP04464.1|3222594_3223335_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	97.6	9.5e-131
AYP02991.1|3223342_3223738_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	6.5e-70
AYP02992.1|3223734_3224313_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	1.7e-79
AYP02993.1|3224324_3224678_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AYP02994.1|3224689_3225085_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
AYP02995.1|3225126_3226152_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	96.8	3.8e-186
AYP02996.1|3226207_3226540_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
AYP02997.1|3226549_3227869_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	2.2e-231
AYP02998.1|3227849_3229451_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.9e-310
AYP02999.1|3229447_3229654_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AYP03000.1|3229650_3231576_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AYP03001.1|3231550_3232096_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
AYP03002.1|3232484_3232718_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.1	1.5e-21
AYP03003.1|3232774_3233185_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AYP03004.1|3233230_3233395_+	hypothetical protein	NA	NA	NA	NA	NA
AYP03005.1|3233534_3234056_-	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
AYP03006.1|3234260_3234698_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.2	6.1e-69
AYP03007.1|3234694_3235192_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	4.2e-90
AYP03008.1|3235191_3235407_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AYP03009.1|3235997_3237080_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
AYP03010.1|3237268_3237652_-	antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
AYP03011.1|3237737_3237878_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
AYP03012.1|3237874_3238237_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AYP03013.1|3238256_3238451_-	protein ninF	NA	NA	NA	NA	NA
AYP03014.1|3238443_3238827_-	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	96.5	1.7e-62
AYP03015.1|3238787_3238964_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
AYP03016.1|3238960_3239488_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
AYP03017.1|3239484_3239943_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.3e-81
AYP03018.1|3239998_3240289_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
AYP03019.1|3240285_3240987_-	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	99.6	9.9e-130
AYP03020.1|3240983_3241883_-	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	99.3	3.2e-173
AYP03021.1|3241915_3242212_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
AYP03022.1|3243205_3243898_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	1.1e-125
3251937:3251953	attR	CACGCTGCCATCTTCCG	NA	NA	NA	NA
>prophage 8
CP033250	Escherichia coli strain ECCHD184 chromosome, complete genome	4783813	3738419	3812051	4783813	plate,head,integrase,capsid,portal,holin,tail,protease,lysis,terminase	Shigella_phage(44.26%)	88	3738199:3738254	3808140:3808195
3738199:3738254	attL	TTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AYP03442.1|3738419_3739739_+|integrase	site-specific integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	23.4	1.5e-17
AYP03443.1|3739831_3740680_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AYP03444.1|3740764_3740962_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AYP03445.1|3740973_3741462_-	hypothetical protein	NA	NA	NA	NA	NA
AYP03446.1|3741458_3741836_-	toxin	NA	NA	NA	NA	NA
AYP03447.1|3741882_3742257_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AYP03448.1|3742419_3742641_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
AYP04476.1|3742709_3743156_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AYP03449.1|3743201_3743681_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	1.2e-12
AYP03450.1|3743762_3744581_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.8	4.8e-43
AYP03451.1|3744608_3744725_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYP03452.1|3744919_3748039_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
AYP03453.1|3748332_3749205_-	GTPase family protein	NA	NA	NA	NA	NA
AYP03454.1|3749633_3750281_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AYP03455.1|3751031_3752102_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.2	5.1e-69
AYP03456.1|3752372_3753644_+	maltoporin	NA	NA	NA	NA	NA
AYP03457.1|3753780_3754095_-	PTS sugar transporter	NA	NA	NA	NA	NA
AYP03458.1|3754158_3756216_-	beta-galactosidase	NA	NA	NA	NA	NA
AYP03459.1|3756247_3757450_-	galactosidase	NA	NA	NA	NA	NA
AYP03460.1|3757454_3758306_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AYP03461.1|3758316_3759624_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AYP03462.1|3759686_3760919_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AYP03463.1|3761275_3762385_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.0	3.3e-26
AYP03464.1|3763636_3766765_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
AYP03465.1|3767165_3768536_-	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	33.8	5.1e-05
AYP03466.1|3768903_3769116_+	hypothetical protein	NA	NA	NA	NA	NA
AYP03467.1|3769162_3769315_-	hypothetical protein	NA	NA	NA	NA	NA
AYP03468.1|3769449_3770367_+	hypothetical protein	NA	NA	NA	NA	NA
AYP03469.1|3770636_3771140_-	hypothetical protein	NA	A0A291AWW1	Escherichia_phage	68.6	6.1e-57
AYP03470.1|3771760_3772534_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	1.9e-36
AYP03471.1|3772594_3773149_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	89.0	9.7e-88
AYP03472.1|3773680_3774028_+	hypothetical protein	NA	NA	NA	NA	NA
AYP03473.1|3773993_3774602_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.9	4.2e-92
AYP03474.1|3774601_3775354_-|integrase	integrase	integrase	Q9MCR6	Enterobacteria_phage	69.3	1.9e-54
AYP03475.1|3775357_3775942_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	99.5	5.4e-113
AYP03476.1|3775932_3776991_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.9	5.6e-201
AYP03477.1|3776977_3777406_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	5.2e-81
AYP03478.1|3777402_3777951_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.9	5.1e-97
AYP03479.1|3777950_3779030_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
AYP03480.1|3779026_3780400_-	DNA circularization protein	NA	U5P4I0	Shigella_phage	97.5	2.6e-243
AYP03481.1|3780456_3780945_-	hypothetical protein	NA	NA	NA	NA	NA
AYP03482.1|3781009_3782911_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.4	0.0e+00
AYP03483.1|3782995_3783319_-|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	100.0	6.5e-52
AYP03484.1|3783315_3783672_-|tail	phage tail protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
AYP03485.1|3783671_3785168_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	99.8	2.2e-275
AYP03486.1|3785151_3785322_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
AYP03487.1|3785330_3785891_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
AYP03488.1|3785887_3786394_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
AYP03489.1|3786368_3786779_-|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	94.9	8.0e-71
AYP03490.1|3786775_3787099_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
AYP03491.1|3787101_3787302_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	1.7e-26
AYP03492.1|3787351_3788557_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	3.5e-223
AYP03493.1|3788571_3789258_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.6	7.2e-125
AYP03494.1|3789199_3790441_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	2.6e-242
AYP03495.1|3790440_3790623_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	96.7	1.9e-24
AYP03496.1|3790634_3792368_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.6	0.0e+00
AYP03497.1|3792364_3792868_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	2.3e-88
AYP03498.1|3792984_3793335_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	95.7	1.2e-62
AYP03499.1|3793422_3794109_-	hypothetical protein	NA	NA	NA	NA	NA
AYP03500.1|3794160_3794598_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.1	1.4e-68
AYP03501.1|3794594_3795071_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	94.3	6.2e-83
AYP04477.1|3795074_3795410_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	93.7	2.5e-54
AYP03502.1|3795539_3795743_-	hypothetical protein	NA	NA	NA	NA	NA
AYP03503.1|3795935_3796688_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.0	1.3e-135
AYP03504.1|3796701_3797691_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	6.2e-194
AYP03505.1|3797698_3798508_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	4.0e-151
AYP03506.1|3798527_3798917_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
AYP03507.1|3798913_3799240_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
AYP03508.1|3799236_3799890_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
AYP03509.1|3799889_3800384_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	93.9	3.4e-84
AYP03510.1|3800380_3801322_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	1.4e-139
AYP03511.1|3801311_3801491_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AYP03512.1|3801666_3802218_-	hypothetical protein	NA	S5FXP0	Shigella_phage	95.1	8.7e-97
AYP03513.1|3802240_3802489_-	cytoplasmic chaperone TorD	NA	NA	NA	NA	NA
AYP03514.1|3802624_3803311_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	42.0	2.7e-39
AYP03515.1|3803293_3804184_-	NAD-dependent DNA ligase	NA	U3PB51	Vibrio_phage	31.6	4.5e-34
AYP03516.1|3804386_3804590_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	75.5	2.0e-14
AYP03517.1|3804598_3804874_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
AYP03518.1|3804791_3805037_-	hypothetical protein	NA	NA	NA	NA	NA
AYP03519.1|3805273_3805495_+	hypothetical protein	NA	S5FNS4	Shigella_phage	95.9	2.4e-37
AYP03520.1|3805550_3806087_+	HD family hydrolase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
AYP03521.1|3806077_3806440_+	hypothetical protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
AYP03522.1|3806439_3806745_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
AYP03523.1|3806744_3807095_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
AYP04478.1|3807196_3808135_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	4.7e-183
AYP03524.1|3808339_3809593_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3808140:3808195	attR	TTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AYP03525.1|3809604_3810708_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AYP03526.1|3810995_3812051_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	7.0e-119
>prophage 1
CP033251	Escherichia coli strain ECCHD184 plasmid pTB211, complete sequence	164062	200	66723	164062	transposase,plate,integrase	Escherichia_phage(41.94%)	57	55614:55630	65967:65983
AYP04512.1|200_1085_+	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
AYP04513.1|1377_2187_+	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.8	7.1e-156
AYP04514.1|2355_3552_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AYP04515.1|3568_4570_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
AYP04516.1|4794_6501_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
AYP04517.1|6560_8150_+	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	98.5	3.4e-303
AYP04518.1|8159_8975_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.2	3.5e-110
AYP04519.1|9010_9592_+	hypothetical protein	NA	Q71TM4	Escherichia_phage	98.4	9.5e-102
AYP04520.1|9603_10113_+|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	99.4	6.6e-91
AYP04521.1|10272_11385_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AYP04522.1|11578_11734_-	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	90.2	4.0e-15
AYP04523.1|14040_14754_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	36.4	4.1e-14
AYP04636.1|14786_16010_-	MFS transporter	NA	NA	NA	NA	NA
AYP04524.1|15998_17211_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.6e-167
AYP04525.1|17347_18172_-	carbon-phosphorus lyase	NA	A0A0E3D9J5	Bacillus_phage	26.7	6.9e-05
AYP04526.1|18505_20680_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
AYP04527.1|23749_24862_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AYP04528.1|25028_25184_-	reverse transcriptase	NA	NA	NA	NA	NA
AYP04529.1|26168_26759_+	hypothetical protein	NA	U5P429	Shigella_phage	87.8	4.2e-57
AYP04530.1|26646_27057_-	hypothetical protein	NA	NA	NA	NA	NA
AYP04531.1|27350_28874_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AYP04532.1|31429_32155_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYP04533.1|33745_34231_-	plasmid transfer protein	NA	NA	NA	NA	NA
AYP04534.1|35256_35787_+	hypothetical protein	NA	NA	NA	NA	NA
AYP04535.1|38122_39100_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	64.1	6.1e-101
AYP04536.1|39384_40125_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
AYP04537.1|40230_41451_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AYP04538.1|41569_41710_-	transcriptional regulator	NA	NA	NA	NA	NA
AYP04539.1|41736_42054_+	hypothetical protein	NA	NA	NA	NA	NA
AYP04540.1|42575_43737_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AYP04541.1|45367_46339_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AYP04542.1|47158_47785_+	norphogenetic protein	NA	Q1MVG8	Enterobacteria_phage	99.5	1.0e-122
AYP04543.1|47781_48459_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
AYP04544.1|48455_49157_+	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
AYP04545.1|49238_49475_+	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	5.3e-35
AYP04546.1|49511_50216_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYP04637.1|50245_50533_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AYP04547.1|50548_50731_-	resolvase	NA	NA	NA	NA	NA
AYP04638.1|50759_51524_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AYP04548.1|51714_52071_-	hypothetical protein	NA	NA	NA	NA	NA
AYP04549.1|52016_52601_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYP04550.1|52600_53839_-	MFS transporter	NA	NA	NA	NA	NA
AYP04551.1|53835_54741_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AYP04552.1|54862_55567_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
55614:55630	attL	CTATTTGCAACAGTGCC	NA	NA	NA	NA
AYP04553.1|55689_56895_-	chromate efflux transporter	NA	NA	NA	NA	NA
AYP04554.1|57050_57254_-	hypothetical protein	NA	NA	NA	NA	NA
AYP04555.1|57272_57452_+	hypothetical protein	NA	NA	NA	NA	NA
AYP04556.1|57381_58221_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AYP04557.1|58214_58562_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AYP04558.1|58767_59556_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
AYP04639.1|59686_60160_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
AYP04559.1|60317_61331_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYP04560.1|61269_61884_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AYP04561.1|62009_62570_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYP04562.1|62572_65524_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
AYP04640.1|65532_65934_+	hypothetical protein	NA	NA	NA	NA	NA
AYP04563.1|66018_66723_-|transposase	IS6 family transposase IS1006	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
65967:65983	attR	GGCACTGTTGCAAATAG	NA	NA	NA	NA
>prophage 2
CP033251	Escherichia coli strain ECCHD184 plasmid pTB211, complete sequence	164062	70407	133933	164062	transposase	Escherichia_phage(60.0%)	54	NA	NA
AYP04567.1|70407_71901_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYP04568.1|71931_72183_+	hypothetical protein	NA	NA	NA	NA	NA
AYP04569.1|72076_72379_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AYP04570.1|72465_73281_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYP04571.1|73370_74460_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AYP04572.1|74657_75143_-	phenol hydroxylase	NA	NA	NA	NA	NA
AYP04573.1|76953_77706_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
AYP04574.1|78127_79153_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
AYP04575.1|79139_79361_-	hypothetical protein	NA	NA	NA	NA	NA
AYP04576.1|79381_80158_-	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
AYP04577.1|80271_80976_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYP04578.1|81278_82154_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
AYP04579.1|82765_83182_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
AYP04580.1|83186_83705_-	hypothetical protein	NA	NA	NA	NA	NA
AYP04581.1|83704_84451_-	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
AYP04582.1|84456_85161_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYP04583.1|86950_87457_+	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	99.4	1.4e-93
AYP04584.1|87723_90840_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.3	1.4e-26
AYP04585.1|90961_92200_-	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	52.5	3.5e-37
AYP04641.1|92196_93753_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.1e-104
AYP04586.1|93935_94157_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AYP04587.1|94156_94537_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
AYP04588.1|94541_94721_+	PdcA protein	NA	Q71TH5	Escherichia_phage	98.3	6.0e-23
AYP04589.1|96374_97226_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
AYP04590.1|97336_97546_-	c1 repressor inactivator	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
AYP04591.1|97511_97607_-	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AYP04592.1|99055_99379_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYP04593.1|99484_100618_+	permease	NA	NA	NA	NA	NA
AYP04594.1|101317_104305_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.5	1.7e-295
AYP04642.1|105134_107537_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	83.8	0.0e+00
AYP04595.1|107550_108177_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	100.0	2.9e-128
AYP04596.1|108169_108946_+	dimethyl sulfoxide reductase	NA	A0A077SK59	Escherichia_phage	100.0	5.8e-131
AYP04597.1|109000_109597_+	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	99.5	6.5e-114
AYP04598.1|109593_110124_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SLP0	Escherichia_phage	100.0	8.6e-102
AYP04599.1|110581_111562_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.3e-183
AYP04600.1|111694_111787_-	peptidase	NA	Q38401	Escherichia_phage	100.0	2.3e-07
AYP04601.1|112198_112420_+	creatininase	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
AYP04602.1|112427_113459_+	recombinase	NA	Q71TG5	Escherichia_phage	99.4	8.4e-194
AYP04603.1|113509_113821_+	lysogeny establishment protein	NA	Q5XLQ4	Enterobacteria_phage	93.2	2.8e-44
AYP04604.1|114068_114629_+	recombinase	NA	Q71TG3	Escherichia_phage	97.8	1.7e-100
AYP04605.1|114817_115462_+	maturation control protein	NA	A0A1B0VAG4	Salmonella_phage	86.3	1.7e-96
AYP04606.1|115515_116205_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AYP04607.1|117199_117448_-	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
AYP04608.1|117444_117885_-	peptide-binding protein	NA	Q71TR9	Escherichia_phage	99.3	3.8e-79
AYP04609.1|117918_121803_-	helicase	NA	Q1MVN7	Enterobacteria_phage	96.5	0.0e+00
AYP04610.1|122031_122163_-	replication protein RepA4	NA	NA	NA	NA	NA
AYP04611.1|122415_122667_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AYP04612.1|122663_122951_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	4.5e-20
AYP04613.1|123240_123441_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
AYP04614.1|123810_127326_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	36.1	3.7e-100
AYP04615.1|128833_129283_-	hypothetical protein	NA	NA	NA	NA	NA
AYP04616.1|129272_130319_-	thioredoxin family protein	NA	NA	NA	NA	NA
AYP04643.1|131782_132187_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYP04617.1|132660_133933_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	4.0e-169
>prophage 3
CP033251	Escherichia coli strain ECCHD184 plasmid pTB211, complete sequence	164062	156911	163927	164062	transposase	Salmonella_phage(50.0%)	10	NA	NA
AYP04626.1|156911_157793_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	41.3	2.9e-54
AYP04627.1|158906_159269_-	hypothetical protein	NA	NA	NA	NA	NA
AYP04628.1|159269_160421_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AYP04629.1|160803_161370_-	recombination-associated protein RdgC	NA	Q71TA1	Escherichia_phage	97.8	7.3e-91
AYP04630.1|161362_161647_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.3e-48
AYP04631.1|161631_161844_-	hypothetical protein	NA	NA	NA	NA	NA
AYP04632.1|161920_162100_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	96.6	1.2e-26
AYP04633.1|162108_162897_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	95.8	7.8e-115
AYP04634.1|162936_163359_+	ppfA	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
AYP04635.1|163534_163927_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
>prophage 1
CP033252	Escherichia coli strain ECCHD184 plasmid pTB212, complete sequence	110417	159	109834	110417	capsid,terminase,tail,integrase	Salmonella_phage(90.1%)	120	11136:11150	18960:18974
AYP04645.1|159_1215_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	90.4	8.7e-170
AYP04646.1|1687_1945_+	hypothetical protein	NA	NA	NA	NA	NA
AYP04647.1|2002_4342_-	recombinase RecA	NA	J9Q736	Salmonella_phage	87.8	6.0e-30
AYP04648.1|4344_4611_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYP04649.1|4610_5555_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	2.0e-181
AYP04650.1|5615_6632_-	regulator	NA	J9Q7Z3	Salmonella_phage	98.7	4.4e-163
AYP04759.1|6751_7183_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	5.8e-72
AYP04651.1|7292_7853_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	85.0	1.1e-78
AYP04652.1|7881_11400_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	98.6	0.0e+00
11136:11150	attL	ATGATTCCATACATC	NA	NA	NA	NA
AYP04653.1|11374_11578_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	98.5	3.6e-32
AYP04654.1|11580_12816_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	98.8	1.3e-236
AYP04655.1|12911_15143_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	86.4	0.0e+00
AYP04656.1|15255_15468_-	hypothetical protein	NA	NA	NA	NA	NA
AYP04657.1|15724_16114_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYP04658.1|16108_17212_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	33.9	1.9e-26
AYP04659.1|17511_17928_-	hypothetical protein	NA	NA	NA	NA	NA
AYP04660.1|17918_18467_-	hypothetical protein	NA	NA	NA	NA	NA
AYP04661.1|19539_19845_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	91.1	3.3e-45
18960:18974	attR	GATGTATGGAATCAT	NA	NA	NA	NA
AYP04662.1|19841_19994_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	80.0	3.0e-15
AYP04760.1|19993_20200_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	92.5	6.4e-29
AYP04663.1|20189_20366_-	hypothetical protein	NA	J9Q729	Salmonella_phage	91.4	3.2e-21
AYP04664.1|20365_21688_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	97.7	5.4e-254
AYP04761.1|21722_21980_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	84.7	2.3e-31
AYP04665.1|22279_23092_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	85.6	5.5e-124
AYP04666.1|24878_25427_+	fimbrial protein YehD	NA	NA	NA	NA	NA
AYP04667.1|25482_26163_+	fimbrial assembly chaperone	NA	NA	NA	NA	NA
AYP04668.1|26180_28667_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AYP04669.1|28677_29688_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYP04670.1|29872_30094_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	94.5	8.1e-30
AYP04671.1|30093_30471_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	92.0	9.3e-58
AYP04672.1|30604_31816_-	DNA primase	NA	J9Q720	Salmonella_phage	94.9	9.8e-210
AYP04673.1|31876_33217_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	98.9	2.5e-246
AYP04674.1|33277_34003_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	96.3	1.0e-137
AYP04675.1|34285_35053_+	hypothetical protein	NA	NA	NA	NA	NA
AYP04676.1|35105_35465_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
AYP04677.1|35464_36133_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
AYP04678.1|36452_36722_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AYP04679.1|36729_37251_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYP04680.1|37283_37469_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	75.0	2.9e-20
AYP04681.1|37419_37671_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	64.6	3.9e-20
AYP04682.1|37673_38366_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	90.0	2.7e-119
AYP04683.1|38379_38703_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	80.4	1.4e-38
AYP04684.1|38836_39418_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	86.9	7.3e-94
AYP04685.1|39426_40329_-|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	67.0	1.9e-96
AYP04686.1|40325_42122_-|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	60.8	3.0e-05
AYP04762.1|42082_42295_-	hypothetical protein	NA	NA	NA	NA	NA
AYP04687.1|42375_42936_+	hypothetical protein	NA	NA	NA	NA	NA
AYP04688.1|43613_48194_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	86.9	0.0e+00
AYP04689.1|48204_48798_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	93.9	4.3e-102
AYP04690.1|48785_49583_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	97.0	2.6e-158
AYP04691.1|49572_50307_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	98.3	6.3e-135
AYP04692.1|50356_50692_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	84.5	2.6e-51
AYP04693.1|50734_55306_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	84.5	0.0e+00
AYP04694.1|55313_55583_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AYP04695.1|55663_55981_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYP04696.1|56040_56787_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	97.6	2.6e-128
AYP04697.1|56861_57245_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	97.6	1.9e-66
AYP04698.1|57246_57720_-	hypothetical protein	NA	J9Q711	Salmonella_phage	96.8	1.4e-79
AYP04699.1|57710_58055_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	1.5e-54
AYP04700.1|58152_58986_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	95.7	3.3e-148
AYP04701.1|58985_59420_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	93.8	3.2e-70
AYP04702.1|59463_59892_-	Ig-like domain-containing protein	NA	J9Q6D6	Salmonella_phage	57.7	6.0e-53
AYP04703.1|59966_60842_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	98.6	4.2e-162
AYP04704.1|60868_61762_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	95.0	3.1e-144
AYP04705.1|61784_63359_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	97.7	2.8e-297
AYP04706.1|63392_64649_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	99.5	9.1e-251
AYP04707.1|64651_65293_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.1	2.3e-109
AYP04708.1|65488_65755_-	hypothetical protein	NA	J9Q757	Salmonella_phage	98.9	2.9e-42
AYP04709.1|65764_66664_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.9e-166
AYP04710.1|66660_66915_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AYP04711.1|66907_67546_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	100.0	3.8e-112
AYP04712.1|67542_68211_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	99.1	1.9e-114
AYP04713.1|68210_68909_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	99.1	5.6e-125
AYP04714.1|68973_70533_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.8e-293
AYP04715.1|70535_70814_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	92.4	2.1e-38
AYP04716.1|70873_71296_+	hypothetical protein	NA	J9Q806	Salmonella_phage	94.3	2.9e-68
AYP04717.1|71300_71828_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	97.3	1.7e-81
AYP04718.1|72149_72800_+	hypothetical protein	NA	J9Q754	Salmonella_phage	96.3	6.6e-112
AYP04719.1|72850_73081_+	hypothetical protein	NA	NA	NA	NA	NA
AYP04720.1|73704_74187_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	7.9e-62
AYP04721.1|74391_74679_-	ABC transporter	NA	J9Q753	Salmonella_phage	80.6	9.6e-39
AYP04722.1|75008_75419_-	hypothetical protein	NA	NA	NA	NA	NA
AYP04723.1|75500_75896_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	64.6	6.8e-43
AYP04724.1|76017_76329_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	1.5e-29
AYP04763.1|76489_76819_-	hypothetical protein	NA	NA	NA	NA	NA
AYP04725.1|76958_77177_-	hypothetical protein	NA	J9Q804	Salmonella_phage	88.9	1.5e-31
AYP04726.1|77478_77679_-	hypothetical protein	NA	J9Q7I0	Salmonella_phage	96.1	5.7e-22
AYP04727.1|78760_78946_-	hypothetical protein	NA	NA	NA	NA	NA
AYP04764.1|78982_79204_-	hypothetical protein	NA	J9Q750	Salmonella_phage	55.2	1.2e-17
AYP04728.1|79504_80248_+	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	54.7	2.5e-78
AYP04729.1|80292_80682_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	89.9	1.8e-64
AYP04730.1|81480_81804_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	76.5	1.4e-06
AYP04731.1|82868_84572_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	94.3	0.0e+00
AYP04765.1|84775_86332_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	4.9e-105
AYP04732.1|86328_87516_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.2	3.3e-08
AYP04733.1|87637_90754_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	8.3e-27
AYP04734.1|90812_91289_-	hypothetical protein	NA	J9Q747	Salmonella_phage	95.5	4.3e-84
AYP04735.1|91429_92002_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	2.4e-97
AYP04736.1|92110_92926_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	95.9	4.8e-128
AYP04737.1|93032_93221_-	hypothetical protein	NA	J9Q800	Salmonella_phage	79.0	2.5e-19
AYP04738.1|93230_93731_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	84.3	1.7e-67
AYP04739.1|93873_94482_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	96.0	1.6e-112
AYP04740.1|95077_95308_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	97.3	3.3e-34
AYP04741.1|95510_96104_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	100.0	2.1e-112
AYP04742.1|96259_97216_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	80.3	1.9e-99
AYP04743.1|97467_98490_+	HNH endonuclease	NA	NA	NA	NA	NA
AYP04744.1|98492_99056_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	97.3	5.0e-100
AYP04745.1|99065_99485_-	hypothetical protein	NA	J9Q743	Salmonella_phage	95.0	3.0e-65
AYP04746.1|99548_100193_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	96.3	2.7e-113
AYP04747.1|100192_100669_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	98.7	2.6e-89
AYP04748.1|100665_101079_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	98.5	3.3e-72
AYP04749.1|101080_102196_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	99.5	9.6e-220
AYP04750.1|102363_103242_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	98.6	5.2e-160
AYP04751.1|103507_104077_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	80.4	7.9e-85
AYP04752.1|104073_104850_-	hypothetical protein	NA	A0A2I7RQG7	Vibrio_phage	33.3	3.1e-23
AYP04753.1|104825_105572_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	88.7	6.9e-121
AYP04754.1|105561_107478_-	exonuclease	NA	J9Q741	Salmonella_phage	86.7	2.0e-297
AYP04755.1|107474_107711_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	68.3	1.6e-20
AYP04756.1|107707_108793_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	97.5	3.2e-204
AYP04757.1|109189_109834_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	1.8e-122
