The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033338	Salmonella enterica subsp. enterica serovar Anatum strain CFSAN076215 chromosome, complete genome	4689440	1123337	1186431	4689440	plate,tail,integrase,lysis,head,tRNA,capsid,portal	Salmonella_phage(90.7%)	65	1123176:1123222	1157374:1157420
1123176:1123222	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AYP89498.1|1123337_1124564_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	65.4	3.6e-151
AYP89499.1|1124570_1125587_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.0	5.0e-191
AYP89500.1|1125588_1126221_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	96.7	5.8e-113
AYP89501.1|1126340_1126583_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYP89502.1|1126615_1127125_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	3.5e-84
AYP89503.1|1127211_1127487_-	hypothetical protein	NA	NA	NA	NA	NA
AYP89504.1|1127571_1127766_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	84.1	5.3e-25
AYP89505.1|1127729_1128071_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	84.1	6.0e-48
AYP89506.1|1128138_1128366_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	64.0	8.1e-17
AYP89507.1|1128365_1128593_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	66.7	5.4e-21
AYP89508.1|1128589_1129447_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	69.8	4.6e-113
AYP89509.1|1129443_1131837_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	88.8	0.0e+00
AYP89510.1|1131856_1132084_-	hypothetical protein	NA	NA	NA	NA	NA
AYP89511.1|1132221_1132410_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	91.7	5.7e-24
AYP89512.1|1132740_1133943_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	37.1	5.6e-64
AYP89513.1|1133905_1134823_+	restriction endonuclease	NA	NA	NA	NA	NA
AYP89514.1|1134869_1135904_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	94.8	4.1e-188
AYP89515.1|1135903_1137670_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	96.6	0.0e+00
AYP89516.1|1137812_1138646_+|capsid	capsid protein	capsid	E5G6M5	Salmonella_phage	97.1	1.1e-127
AYP89517.1|1138662_1139730_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.0	2.8e-192
AYP89518.1|1139733_1140384_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	98.6	1.6e-113
AYP89519.1|1140477_1140942_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.8	7.9e-83
AYP89520.1|1140941_1141145_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYP89521.1|1141148_1141364_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
AYP89522.1|1141344_1141854_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	3.2e-93
AYP89523.1|1141858_1142233_+	hypothetical protein	NA	NA	NA	NA	NA
AYP89524.1|1142229_1142658_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
AYP89525.1|1142753_1143185_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	95.1	4.0e-73
AYP89526.1|1143177_1143624_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.7	3.8e-66
AYP89527.1|1143692_1144271_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	1.5e-107
AYP89528.1|1144267_1144627_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	92.4	6.3e-56
AYP89529.1|1144613_1145522_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.7	7.2e-157
AYP89530.1|1145514_1146120_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	1.1e-116
AYP89531.1|1146116_1147691_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	60.9	3.3e-157
AYP89532.1|1147660_1148278_+|tail	tail assembly chaperone	tail	A0A1B0VCD0	Salmonella_phage	84.1	1.6e-94
AYP89533.1|1148281_1148689_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	85.2	6.7e-62
AYP89534.1|1149743_1150301_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	98.9	9.4e-99
AYP89535.1|1150403_1151576_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	3.7e-222
AYP89536.1|1151585_1152101_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYP89537.1|1152155_1152458_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
AYP89538.1|1152472_1152592_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
AYP89539.1|1152584_1155392_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	98.3	0.0e+00
AYP89540.1|1155388_1155874_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
AYP89541.1|1155870_1156971_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	95.6	9.0e-194
AYP92799.1|1157039_1157258_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
AYP92800.1|1157809_1158973_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1157374:1157420	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AYP89542.1|1158980_1161161_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
AYP89543.1|1161157_1162567_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AYP89544.1|1162631_1174106_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
AYP92801.1|1174725_1175208_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AYP89545.1|1175357_1175834_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AYP89546.1|1175823_1176114_+	RnfH family protein	NA	NA	NA	NA	NA
AYP89547.1|1176279_1176618_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYP89548.1|1176766_1178428_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AYP89549.1|1178513_1179392_-	NAD(+) kinase	NA	NA	NA	NA	NA
AYP92802.1|1179323_1179518_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AYP89550.1|1179514_1180105_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYP89551.1|1180139_1180745_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYP89552.1|1180865_1182107_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AYP89553.1|1182171_1182963_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYP89554.1|1182908_1183205_-	hypothetical protein	NA	NA	NA	NA	NA
AYP89555.1|1183128_1184490_+	signal recognition particle protein	NA	NA	NA	NA	NA
AYP92804.1|1184803_1185052_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYP92803.1|1185070_1185619_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYP89556.1|1185663_1186431_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
CP033338	Salmonella enterica subsp. enterica serovar Anatum strain CFSAN076215 chromosome, complete genome	4689440	1676881	1686052	4689440	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYP89995.1|1676881_1677829_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AYP89996.1|1677812_1678544_+	ABC transporter permease	NA	NA	NA	NA	NA
AYP89997.1|1678524_1678632_-	protein YohO	NA	NA	NA	NA	NA
AYP89998.1|1678691_1679423_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYP89999.1|1679645_1681331_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
AYP90000.1|1681327_1682047_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYP90001.1|1682093_1682561_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYP90002.1|1682617_1683148_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AYP90003.1|1683319_1683778_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYP90004.1|1684018_1686052_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
CP033338	Salmonella enterica subsp. enterica serovar Anatum strain CFSAN076215 chromosome, complete genome	4689440	1754144	1760441	4689440		Enterobacteria_phage(50.0%)	6	NA	NA
AYP90060.1|1754144_1755548_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
AYP90061.1|1755725_1756619_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYP90062.1|1756995_1758081_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYP90063.1|1758080_1758980_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
AYP92822.1|1759027_1759906_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
AYP90064.1|1759910_1760441_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 4
CP033338	Salmonella enterica subsp. enterica serovar Anatum strain CFSAN076215 chromosome, complete genome	4689440	1866595	1877980	4689440		Stenotrophomonas_phage(25.0%)	13	NA	NA
AYP90161.1|1866595_1867858_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	41.3	1.5e-75
AYP90162.1|1868503_1868794_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	1.8e-08
AYP90163.1|1869165_1869963_-	protein MtfA	NA	NA	NA	NA	NA
AYP90164.1|1870223_1870466_+	hypothetical protein	NA	NA	NA	NA	NA
AYP90165.1|1870443_1870605_+	hypothetical protein	NA	NA	NA	NA	NA
AYP90166.1|1870731_1871151_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AYP90167.1|1871153_1872422_+	protein UmuC	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
AYP90168.1|1872876_1873089_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AYP92830.1|1873099_1873288_+	cold-shock protein	NA	NA	NA	NA	NA
AYP90169.1|1873547_1874741_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
AYP90170.1|1875389_1875701_+	hypothetical protein	NA	NA	NA	NA	NA
AYP90171.1|1875780_1876476_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AYP90172.1|1876549_1877980_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
CP033338	Salmonella enterica subsp. enterica serovar Anatum strain CFSAN076215 chromosome, complete genome	4689440	1981226	1987840	4689440	integrase	Pectobacterium_phage(16.67%)	12	1983436:1983458	1995559:1995581
AYP90280.1|1981226_1981457_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
AYP90281.1|1981594_1981969_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AYP90282.1|1981969_1982845_+	copper resistance D family protein	NA	NA	NA	NA	NA
AYP90283.1|1982861_1983215_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AYP92834.1|1983272_1983392_+	hypothetical protein	NA	NA	NA	NA	NA
1983436:1983458	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
AYP90284.1|1983586_1984666_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
AYP90285.1|1984662_1985769_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
AYP90286.1|1985799_1986030_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
AYP90287.1|1986083_1986617_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
AYP90288.1|1986873_1987041_-	lytic enzyme	NA	NA	NA	NA	NA
AYP90289.1|1987105_1987294_-	hypothetical protein	NA	NA	NA	NA	NA
AYP90290.1|1987348_1987840_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
1995559:1995581	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 6
CP033338	Salmonella enterica subsp. enterica serovar Anatum strain CFSAN076215 chromosome, complete genome	4689440	2935320	2944402	4689440	protease,integrase	Ralstonia_phage(16.67%)	11	2933713:2933725	2952899:2952911
2933713:2933725	attL	CTGTTTTACCTTA	NA	NA	NA	NA
AYP91194.1|2935320_2936562_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
AYP91195.1|2936528_2936717_-	hypothetical protein	NA	NA	NA	NA	NA
AYP91196.1|2936801_2936984_+	hypothetical protein	NA	NA	NA	NA	NA
AYP91197.1|2937089_2937467_+|integrase	integrase	integrase	NA	NA	NA	NA
AYP91198.1|2937628_2937826_+	hypothetical protein	NA	NA	NA	NA	NA
AYP91199.1|2938038_2940315_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AYP91200.1|2940345_2940666_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYP91201.1|2940989_2941211_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYP91202.1|2941165_2941360_-	hypothetical protein	NA	NA	NA	NA	NA
AYP91203.1|2941340_2943287_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
AYP91204.1|2943283_2944402_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
2952899:2952911	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 7
CP033338	Salmonella enterica subsp. enterica serovar Anatum strain CFSAN076215 chromosome, complete genome	4689440	4282160	4326938	4689440	tRNA,plate,tail	Burkholderia_phage(40.91%)	47	NA	NA
AYP92400.1|4282160_4283159_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AYP92401.1|4283246_4284557_-	conjugal transfer protein	NA	NA	NA	NA	NA
AYP92402.1|4284803_4285319_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
AYP92403.1|4285418_4285628_-	CsbD family protein	NA	NA	NA	NA	NA
AYP92939.1|4285649_4285763_-	hypothetical protein	NA	NA	NA	NA	NA
AYP92404.1|4285759_4287085_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
AYP92405.1|4287263_4287872_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AYP92406.1|4287980_4288349_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AYP92407.1|4288519_4290940_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AYP92408.1|4291038_4291911_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AYP92409.1|4291924_4292422_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AYP92410.1|4292602_4293520_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AYP92411.1|4293683_4295042_-	maltoporin	NA	NA	NA	NA	NA
AYP92412.1|4295130_4296240_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AYP92413.1|4296601_4297792_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AYP92414.1|4297923_4299468_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AYP92415.1|4299482_4300373_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AYP92416.1|4300538_4300949_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AYP92417.1|4301091_4303188_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AYP92418.1|4303187_4303925_-	hypothetical protein	NA	NA	NA	NA	NA
AYP92419.1|4303921_4304560_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AYP92420.1|4304623_4304866_-	outer membrane protein	NA	NA	NA	NA	NA
AYP92421.1|4305309_4306959_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYP92422.1|4307303_4308653_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AYP92423.1|4308783_4309131_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
AYP92424.1|4309706_4309994_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
AYP92425.1|4309996_4310602_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
AYP92426.1|4310614_4310929_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AYP92427.1|4311088_4311544_+	hypothetical protein	NA	NA	NA	NA	NA
AYP92428.1|4311540_4311738_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
AYP92429.1|4311727_4313155_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
AYP92430.1|4313154_4313679_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
AYP92431.1|4313730_4314048_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AYP92432.1|4314007_4314136_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AYP92433.1|4314232_4316587_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
AYP92434.1|4316586_4317540_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
AYP92435.1|4317539_4317749_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AYP92436.1|4317736_4318780_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
AYP92437.1|4318789_4319512_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
AYP92438.1|4319839_4320202_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
AYP92439.1|4320198_4321128_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
AYP92440.1|4321127_4322675_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
AYP92441.1|4322838_4323198_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AYP92442.1|4323188_4324304_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.0	4.1e-101
AYP92443.1|4324296_4324929_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
AYP92444.1|4324931_4326413_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
AYP92445.1|4326422_4326938_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	1.3e-33
