The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033343	Salmonella enterica subsp. enterica serovar Mbandaka strain CFSAN076213 chromosome, complete genome	4709669	639652	679586	4709669	head,portal,capsid,integrase,tRNA,holin,tail,terminase	Cronobacter_phage(68.42%)	49	630297:630320	678301:678324
630297:630320	attL	GATAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
AYP80059.1|639652_640690_-|integrase	integrase	integrase	F1BUS9	Erwinia_phage	64.7	6.6e-122
AYP80060.1|640693_641260_-	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	35.0	3.0e-20
AYP80061.1|641276_641858_-	phage repressor protein	NA	F1BUS8	Erwinia_phage	39.8	2.5e-33
AYP80062.1|641993_642215_+	regulator	NA	NA	NA	NA	NA
AYP80063.1|642245_642749_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
AYP80064.1|642758_642986_+	hypothetical protein	NA	NA	NA	NA	NA
AYP80065.1|642975_643401_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	50.4	7.6e-24
AYP80066.1|643400_643802_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	67.7	1.3e-49
AYP80067.1|643869_644100_+	DUF2732 family protein	NA	NA	NA	NA	NA
AYP80068.1|644090_644945_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	83.3	1.3e-131
AYP80069.1|644941_645943_+	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	56.8	9.9e-99
AYP80070.1|645935_647975_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.4	3.8e-299
AYP80071.1|648094_648301_+	hypothetical protein	NA	NA	NA	NA	NA
AYP80072.1|648274_648598_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
AYP80073.1|648594_649656_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	2.3e-162
AYP80074.1|649652_651428_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	82.4	4.1e-289
AYP80075.1|651588_652392_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	56.4	4.1e-79
AYP80076.1|652453_653476_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
AYP80077.1|653479_654181_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
AYP80078.1|654226_654730_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.0	5.2e-64
AYP80079.1|654726_655233_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.5e-63
AYP80080.1|655229_655937_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.9	6.8e-102
AYP80081.1|655933_657061_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	3.3e-175
AYP80082.1|657057_657513_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
AYP80083.1|657522_657816_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
AYP80084.1|657812_658154_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
AYP80085.1|658153_658486_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	1.1e-35
AYP80086.1|658457_658646_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	80.6	1.1e-22
AYP80087.1|658632_658890_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
AYP80088.1|659077_661048_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.9	9.5e-271
AYP80089.1|661044_661374_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
AYP80090.1|661370_662555_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
AYP80091.1|662541_663135_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.4e-89
AYP80092.1|663144_665250_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	76.2	5.3e-219
AYP80093.1|665262_665817_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	97.2	4.6e-98
AYP80094.1|665806_666532_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
AYP80095.1|666503_667049_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
AYP80096.1|667048_668752_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	6.4e-223
AYP83841.1|668910_669090_+	hypothetical protein	NA	NA	NA	NA	NA
AYP80097.1|669924_670431_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AYP83842.1|670554_672402_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AYP80098.1|672551_674297_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
AYP80099.1|674532_674748_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AYP80100.1|674975_675989_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
AYP80101.1|675892_676231_-	hypothetical protein	NA	NA	NA	NA	NA
AYP80102.1|676244_676856_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
AYP80103.1|676962_677322_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AYP80104.1|677419_678241_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AYP80105.1|678344_679586_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	47.9	6.5e-92
678301:678324	attR	GATAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
>prophage 2
CP033343	Salmonella enterica subsp. enterica serovar Mbandaka strain CFSAN076213 chromosome, complete genome	4709669	1437841	1484282	4709669	coat,portal,protease,lysis,tail,terminase	Salmonella_phage(68.66%)	77	NA	NA
AYP80791.1|1437841_1438780_+|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
AYP80792.1|1438801_1439032_-	hypothetical protein	NA	C6ZR23	Salmonella_phage	81.8	1.2e-10
AYP80793.1|1439041_1439245_-	hypothetical protein	NA	C6ZR24	Salmonella_phage	95.5	4.7e-32
AYP80794.1|1439341_1439977_-	Eac protein	NA	A0A075B8I7	Enterobacteria_phage	87.7	4.1e-106
AYP80795.1|1440221_1440488_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	96.6	1.1e-44
AYP80796.1|1441459_1441717_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	5.9e-40
AYP80797.1|1441718_1442351_-	ead/Ea22-like family protein	NA	A0A1R3Y5T1	Salmonella_virus	44.5	2.1e-25
AYP80798.1|1442347_1442758_-	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	94.1	5.7e-69
AYP80799.1|1442754_1442925_-	DUF2737 family protein	NA	A0A220NQV6	Salmonella_phage	100.0	6.1e-25
AYP80800.1|1442935_1443229_-	DUF2856 family protein	NA	A0A2H4FNA1	Salmonella_phage	96.9	1.4e-48
AYP80801.1|1443275_1443560_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
AYP80802.1|1443559_1444267_-	recombinase	NA	K7PKU3	Enterobacteria_phage	86.4	1.3e-116
AYP80803.1|1444274_1444463_-	hypothetical protein	NA	C6ZR38	Salmonella_phage	82.3	1.7e-23
AYP80804.1|1444550_1444745_-	hypothetical protein	NA	NA	NA	NA	NA
AYP80805.1|1444729_1444864_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	78.0	2.1e-09
AYP80806.1|1444949_1445204_-	hypothetical protein	NA	NA	NA	NA	NA
AYP80807.1|1445356_1445989_-	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	68.4	9.4e-79
AYP80808.1|1446066_1446429_-	antitermination protein	NA	C6ZR44	Salmonella_phage	95.0	2.3e-58
AYP80809.1|1446796_1447006_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	95.7	2.2e-29
AYP80810.1|1447147_1447906_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AYP80811.1|1447902_1448439_-	hypothetical protein	NA	NA	NA	NA	NA
AYP80812.1|1448533_1449187_-	LexA family transcriptional regulator	NA	I6R0S2	Salmonella_phage	99.1	3.3e-127
AYP80813.1|1449296_1449506_+	XRE family transcriptional regulator	NA	I6S1U2	Salmonella_phage	100.0	2.1e-35
AYP80814.1|1449625_1449907_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	98.9	7.4e-44
AYP80815.1|1449941_1450088_+	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
AYP80816.1|1450080_1450980_+	DNA replication protein	NA	A0A220NQX5	Salmonella_phage	100.0	2.1e-156
AYP80817.1|1450954_1452406_+	helicase DnaB	NA	Q7Y2K5	Escherichia_phage	99.4	4.0e-274
AYP80818.1|1452481_1452808_+	hypothetical protein	NA	Q716D0	Shigella_phage	99.1	4.2e-59
AYP80819.1|1452804_1453005_+	hypothetical protein	NA	Q716C9	Shigella_phage	100.0	4.6e-32
AYP80820.1|1453016_1453268_+	hypothetical protein	NA	A0A220NQX3	Salmonella_phage	65.5	2.9e-23
AYP80821.1|1453271_1453478_+	hypothetical protein	NA	I1TEG6	Salmonella_phage	98.5	2.7e-35
AYP80822.1|1453492_1453930_+	recombination protein NinB	NA	C6ZR55	Salmonella_phage	100.0	7.7e-80
AYP80823.1|1453926_1454100_+	protein ninD	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
AYP80824.1|1454066_1454243_+	NinE family protein	NA	I6RSI9	Salmonella_phage	96.6	4.3e-26
AYP80825.1|1454239_1454416_+	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	96.6	1.0e-27
AYP80826.1|1454378_1454675_+	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	98.9	7.5e-47
AYP80827.1|1454671_1455067_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	96.9	1.4e-69
AYP80828.1|1455063_1455267_+	protein ninH	NA	Q5G8R8	Enterobacteria_phage	100.0	7.2e-33
AYP80829.1|1455247_1455427_+	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	100.0	7.1e-24
AYP80830.1|1455423_1456047_+	antitermination protein	NA	C6ZR62	Salmonella_phage	99.0	1.5e-113
AYP80831.1|1456320_1456518_+	hypothetical protein	NA	NA	NA	NA	NA
AYP80832.1|1456605_1457124_+	endodeoxyribonuclease	NA	A0A1V0E5R7	Salmonella_phage	100.0	5.9e-95
AYP80833.1|1457347_1457620_+	hypothetical protein	NA	A0A1V0E5R8	Salmonella_phage	100.0	1.1e-41
AYP80834.1|1457619_1458117_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	93.9	3.0e-88
AYP80835.1|1458205_1458673_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	94.8	1.0e-74
AYP80836.1|1458660_1458813_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
AYP80837.1|1459015_1459534_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	100.0	3.2e-93
AYP80838.1|1459818_1460199_+	hypothetical protein	NA	Q716B1	Shigella_phage	97.6	1.0e-64
AYP80839.1|1460302_1460545_+	DUF2560 family protein	NA	A0A1R3Y5V5	Salmonella_virus	100.0	1.7e-36
AYP80840.1|1460547_1460952_+	Decoration protein	NA	C6ZR73	Salmonella_phage	99.3	1.5e-66
AYP80841.1|1460955_1461444_+	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
AYP80842.1|1461421_1462921_+|terminase	terminase	terminase	A0A0M4S5Z3	Salmonella_phage	99.6	3.1e-306
AYP80843.1|1462920_1465098_+|portal	portal protein	portal	I6R968	Salmonella_phage	98.2	0.0e+00
AYP80844.1|1465111_1466023_+	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	99.7	1.1e-160
AYP80845.1|1466022_1467315_+|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.3	3.2e-243
AYP80846.1|1467355_1467916_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	7.0e-102
AYP80847.1|1467899_1468400_+	hypothetical protein	NA	I1TEJ0	Salmonella_phage	100.0	3.2e-90
AYP80848.1|1468359_1469778_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	89.4	1.5e-249
AYP80849.1|1469799_1470333_+	endodeoxyribonuclease	NA	A0A1V0E5R7	Salmonella_phage	47.7	7.0e-35
AYP80850.1|1470325_1471027_+|tail	phage tail protein	tail	A0A0M4QWW6	Salmonella_phage	91.8	2.8e-68
AYP80851.1|1471026_1471488_+	DUF2824 family protein	NA	C6ZR15	Salmonella_phage	84.9	4.3e-73
AYP80852.1|1471490_1472180_+	DNA transfer protein	NA	B9UDK9	Salmonella_phage	89.8	1.9e-88
AYP83871.1|1472222_1473560_+	DNA transfer protein	NA	I1TEJ5	Salmonella_phage	98.4	3.5e-240
AYP80853.1|1473559_1475563_+	injection protein	NA	A0A2I7QW93	Vibrio_phage	36.9	2.0e-98
AYP80854.1|1475571_1475892_-	hypothetical protein	NA	NA	NA	NA	NA
AYP80855.1|1475922_1476288_+	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	100.0	2.1e-67
AYP80856.1|1476301_1476526_-	hypothetical protein	NA	NA	NA	NA	NA
AYP80857.1|1476551_1476737_+	hypothetical protein	NA	I6RSG3	Salmonella_phage	100.0	1.1e-08
AYP80858.1|1476711_1476921_-	hypothetical protein	NA	I6R975	Salmonella_phage	98.6	5.9e-30
AYP80859.1|1476917_1477154_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	59.2	2.2e-17
AYP80860.1|1477242_1477416_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AYP80861.1|1477478_1478357_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.5	6.9e-96
AYP80862.1|1478457_1480218_+	hypothetical protein	NA	I6S5Y0	Salmonella_phage	89.1	1.0e-58
AYP80863.1|1480253_1481705_-	hypothetical protein	NA	NA	NA	NA	NA
AYP80864.1|1481701_1482619_-	glycosyltransferase	NA	I1TED8	Salmonella_phage	93.1	1.3e-161
AYP80865.1|1482615_1482978_-	GtrA family protein	NA	I1TED9	Salmonella_phage	82.5	6.2e-51
AYP80866.1|1483112_1484282_-	DUF4102 domain-containing protein	NA	I6R0M2	Salmonella_phage	99.0	1.7e-227
>prophage 3
CP033343	Salmonella enterica subsp. enterica serovar Mbandaka strain CFSAN076213 chromosome, complete genome	4709669	1726798	1735969	4709669	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYP81088.1|1726798_1727746_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.0	3.7e-10
AYP81089.1|1727729_1728461_+	ABC transporter permease	NA	NA	NA	NA	NA
AYP81090.1|1728441_1728549_-	protein YohO	NA	NA	NA	NA	NA
AYP81091.1|1728608_1729340_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYP81092.1|1729562_1731248_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AYP81093.1|1731244_1731964_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYP81094.1|1732010_1732478_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.0e-74
AYP81095.1|1732534_1733065_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AYP81096.1|1733236_1733695_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYP81097.1|1733935_1735969_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
CP033343	Salmonella enterica subsp. enterica serovar Mbandaka strain CFSAN076213 chromosome, complete genome	4709669	1893278	1900510	4709669		Morganella_phage(33.33%)	8	NA	NA
AYP81242.1|1893278_1893698_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AYP81243.1|1893700_1894969_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	1.9e-227
AYP81244.1|1895414_1895627_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AYP83888.1|1895637_1895826_+	cold-shock protein	NA	NA	NA	NA	NA
AYP81245.1|1896085_1897270_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.1	5.1e-110
AYP81246.1|1897919_1898231_+	hypothetical protein	NA	NA	NA	NA	NA
AYP81247.1|1898310_1899006_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AYP81248.1|1899079_1900510_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
CP033343	Salmonella enterica subsp. enterica serovar Mbandaka strain CFSAN076213 chromosome, complete genome	4709669	4297328	4344975	4709669	plate,tail,tRNA	Burkholderia_phage(36.36%)	51	NA	NA
AYP83456.1|4297328_4298327_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AYP83457.1|4298414_4299725_-	conjugal transfer protein	NA	NA	NA	NA	NA
AYP83458.1|4299971_4300487_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
AYP83459.1|4300585_4300795_-	CsbD family protein	NA	NA	NA	NA	NA
AYP83987.1|4300816_4300930_-	hypothetical protein	NA	NA	NA	NA	NA
AYP83460.1|4300926_4302252_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
AYP83461.1|4302430_4303039_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AYP83462.1|4303147_4303516_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AYP83463.1|4303686_4306107_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AYP83464.1|4306205_4307078_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AYP83465.1|4307091_4307589_-	chorismate lyase	NA	NA	NA	NA	NA
AYP83466.1|4307769_4308687_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AYP83467.1|4308850_4310206_-	maltoporin	NA	NA	NA	NA	NA
AYP83468.1|4310294_4311404_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AYP83469.1|4311765_4312956_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AYP83470.1|4313087_4314632_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AYP83471.1|4314646_4315537_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AYP83472.1|4315702_4316113_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AYP83473.1|4316255_4318352_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AYP83474.1|4318351_4319089_-	hypothetical protein	NA	NA	NA	NA	NA
AYP83475.1|4319085_4319724_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AYP83476.1|4319787_4320030_-	outer membrane protein	NA	NA	NA	NA	NA
AYP83477.1|4320473_4322123_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYP83478.1|4322511_4323861_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AYP83479.1|4323995_4324343_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	52.6	7.5e-22
AYP83480.1|4324919_4325207_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
AYP83481.1|4325209_4325815_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	58.8	1.0e-58
AYP83482.1|4325827_4326142_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AYP83483.1|4326301_4326757_+	hypothetical protein	NA	NA	NA	NA	NA
AYP83484.1|4326753_4326951_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	5.1e-07
AYP83485.1|4326940_4328368_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	1.8e-194
AYP83486.1|4328367_4328892_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	1.8e-67
AYP83487.1|4328943_4329261_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AYP83488.1|4329220_4329349_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AYP83489.1|4329445_4331800_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.5	3.4e-65
AYP83490.1|4331799_4332753_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
AYP83491.1|4332752_4332962_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AYP83492.1|4332949_4333993_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.6	1.5e-76
AYP83493.1|4334002_4334725_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
AYP83494.1|4334733_4334976_+	hypothetical protein	NA	NA	NA	NA	NA
AYP83495.1|4335051_4335414_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
AYP83496.1|4335410_4336340_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
AYP83497.1|4336339_4337887_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.4	5.0e-49
AYP83498.1|4338050_4338410_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AYP83499.1|4338400_4339516_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.7	3.1e-101
AYP83500.1|4339508_4340141_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
AYP83501.1|4340143_4341802_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	8.0e-53
AYP83502.1|4341808_4342423_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
AYP83503.1|4342419_4342875_+	hypothetical protein	NA	NA	NA	NA	NA
AYP83988.1|4343251_4343668_+	serine acetyltransferase	NA	NA	NA	NA	NA
AYP83504.1|4344246_4344975_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
