The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033378	Escherichia coli strain L73 chromosome, complete genome	4849006	1066439	1079622	4849006		Escherichia_phage(50.0%)	12	NA	NA
AYQ10987.1|1066439_1067201_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AYQ10988.1|1067194_1067821_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AYQ10989.1|1067960_1069100_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	2.3e-06
AYQ10990.1|1069162_1070155_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AYQ10991.1|1070248_1071613_-	permease	NA	NA	NA	NA	NA
AYQ10992.1|1071701_1072478_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AYQ10993.1|1072482_1073121_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AYQ10994.1|1073117_1074380_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
AYQ10995.1|1074376_1075285_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AYQ10996.1|1075480_1076248_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AYQ10997.1|1076298_1076955_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
AYQ10998.1|1077060_1079622_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
CP033378	Escherichia coli strain L73 chromosome, complete genome	4849006	1441500	1487317	4849006	holin,transposase,head,lysis	Enterobacteria_phage(26.32%)	66	NA	NA
AYQ11305.1|1441500_1441701_-	excisionase	NA	K7P7V0	Enterobacteria_phage	80.3	2.9e-26
AYQ14302.1|1441849_1442941_-|transposase	transposase	transposase	A0A220NS37	Mycobacterium_phage	36.6	2.2e-27
AYQ11306.1|1443031_1443373_-	hypothetical protein	NA	I3PV00	Vibrio_phage	51.9	2.8e-21
AYQ11307.1|1443290_1443605_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	72.7	4.1e-27
AYQ14303.1|1443582_1444236_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	45.9	7.0e-37
AYQ11308.1|1444247_1444466_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	64.3	2.1e-17
AYQ11309.1|1444557_1445175_-	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	59.2	1.1e-60
AYQ11310.1|1445171_1445918_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	65.8	1.8e-65
AYQ11311.1|1445936_1446221_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	92.6	8.5e-48
AYQ11312.1|1446228_1447200_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	98.8	2.7e-85
AYQ11313.1|1447270_1447468_-	DUF1482 family protein	NA	NA	NA	NA	NA
AYQ11314.1|1447757_1448426_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ11315.1|1448615_1448957_-	hypothetical protein	NA	G8C7T6	Escherichia_phage	93.8	6.2e-53
AYQ14304.1|1449312_1450065_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	64.4	5.4e-73
AYQ11316.1|1450106_1450340_+	transcriptional regulator	NA	A0A0P0ZDD7	Stx2-converting_phage	62.3	2.6e-18
AYQ11317.1|1450357_1450900_+	regulator	NA	M9NZI6	Enterobacteria_phage	91.1	1.9e-88
AYQ11318.1|1451128_1452028_+	DNA replication protein	NA	K7P7U6	Enterobacteria_phage	54.5	2.7e-79
AYQ11319.1|1452017_1453451_+	helicase DnaB	NA	Q716D2	Shigella_phage	87.1	6.3e-232
AYQ11320.1|1453450_1453750_+	protein ren	NA	M1FPD5	Enterobacteria_phage	51.6	4.1e-16
AYQ11321.1|1453746_1453944_+	hypothetical protein	NA	K7PKS4	Enterobacteria_phage	95.4	2.2e-26
AYQ11322.1|1453940_1454546_+	ead/Ea22-like family protein	NA	G8C7V0	Escherichia_phage	37.7	1.2e-19
AYQ11323.1|1454579_1454762_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ11324.1|1454761_1455016_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	75.0	2.3e-28
AYQ11325.1|1455032_1455293_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ11326.1|1455411_1455609_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ11327.1|1455812_1456268_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	1.0e-58
AYQ11328.1|1456260_1456782_+	HNH endonuclease	NA	F8UBV0	Escherichia_phage	50.6	6.8e-43
AYQ11329.1|1456781_1456952_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	92.5	1.0e-19
AYQ11330.1|1456944_1457235_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	89.5	3.4e-44
AYQ11331.1|1457231_1457591_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	94.1	2.7e-62
AYQ11332.1|1457587_1457704_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ11333.1|1457703_1458204_+	antiterminator	NA	G8C7V7	Escherichia_phage	94.5	1.0e-88
AYQ11334.1|1458476_1458878_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ11335.1|1458874_1459150_+|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
AYQ11336.1|1459153_1459594_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	71.1	7.5e-51
AYQ11337.1|1459590_1460064_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	54.7	9.3e-39
AYQ11338.1|1460255_1460780_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	76.3	4.1e-72
AYQ11339.1|1460935_1461142_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ11340.1|1461145_1461784_+	hypothetical protein	NA	I6S676	Salmonella_phage	92.5	3.7e-115
AYQ11341.1|1461815_1462295_+	DUF2280 domain-containing protein	NA	F1C5D6	Cronobacter_phage	74.8	3.2e-63
AYQ11342.1|1462281_1463760_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	87.2	1.3e-256
AYQ11343.1|1463775_1465122_+	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	91.8	5.9e-240
AYQ11344.1|1465081_1466008_+|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	93.2	1.1e-163
AYQ11345.1|1466010_1467276_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	91.7	9.9e-221
AYQ11346.1|1467288_1467738_+	hypothetical protein	NA	H6WRT3	Salmonella_phage	85.2	1.2e-64
AYQ11347.1|1467755_1468832_+	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	91.0	1.7e-189
AYQ11348.1|1468841_1469135_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	90.7	8.5e-43
AYQ11349.1|1469197_1469599_+	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	79.7	2.4e-56
AYQ11350.1|1469598_1469772_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AYQ11351.1|1469771_1470140_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	58.2	1.7e-35
AYQ11352.1|1470140_1470509_+	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	67.2	5.0e-40
AYQ11353.1|1470505_1470889_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	55.1	9.2e-37
AYQ11354.1|1470945_1471704_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	87.9	5.6e-86
AYQ11355.1|1471761_1472445_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	63.2	3.2e-80
AYQ11356.1|1472506_1475992_+	hypothetical protein	NA	R9TMK1	Aeromonas_phage	43.1	4.8e-132
AYQ11357.1|1475991_1476489_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	91.5	3.5e-89
AYQ11358.1|1476488_1476959_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	91.7	3.5e-78
AYQ11359.1|1476966_1477434_+	HNH endonuclease	NA	A0A0M7Q8U0	Escherichia_phage	44.3	3.9e-29
AYQ11360.1|1477435_1477828_+	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	88.2	1.1e-64
AYQ11361.1|1477814_1480289_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	89.1	0.0e+00
AYQ11362.1|1480349_1482932_+	SGNH/GDSL hydrolase family protein	NA	A0A1B1W279	Salmonella_phage	60.8	3.6e-44
AYQ11363.1|1482967_1484056_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	30.0	3.4e-20
AYQ11364.1|1484285_1484525_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	57.0	4.4e-21
AYQ11365.1|1484526_1484916_+	LexA family transcriptional regulator	NA	K7P6F7	Enterobacteria_phage	70.3	1.5e-47
AYQ11366.1|1484916_1486074_-	DUF4102 domain-containing protein	NA	Q716F9	Shigella_phage	82.2	5.4e-189
AYQ11367.1|1486384_1487317_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
>prophage 3
CP033378	Escherichia coli strain L73 chromosome, complete genome	4849006	1737161	1746603	4849006		Enterobacteria_phage(85.71%)	10	NA	NA
AYQ11573.1|1737161_1738088_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
AYQ11574.1|1738092_1738824_+	ABC transporter permease	NA	NA	NA	NA	NA
AYQ11575.1|1738804_1738912_-	protein YohO	NA	NA	NA	NA	NA
AYQ11576.1|1738971_1739703_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AYQ11577.1|1739924_1741610_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AYQ11578.1|1741606_1742326_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYQ11579.1|1742372_1742843_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AYQ11580.1|1742883_1743345_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
AYQ11581.1|1743469_1745470_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.7	0.0e+00
AYQ11582.1|1745466_1746603_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 4
CP033378	Escherichia coli strain L73 chromosome, complete genome	4849006	2566831	2632182	4849006	tail,coat,tRNA,transposase,lysis	Escherichia_phage(46.55%)	73	NA	NA
AYQ12280.1|2566831_2567965_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
AYQ12281.1|2568105_2568540_+	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
AYQ12282.1|2569318_2569432_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
AYQ12283.1|2569500_2569734_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AYQ12284.1|2570050_2570641_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AYQ12285.1|2570738_2571314_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.2e-101
AYQ12286.1|2571313_2574592_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	61.2	1.1e-05
AYQ12287.1|2574656_2575256_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	93.0	7.2e-105
AYQ12288.1|2575323_2578803_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	90.1	0.0e+00
AYQ12289.1|2578863_2579466_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	4.0e-87
AYQ12290.1|2579402_2580146_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	1.0e-145
AYQ12291.1|2580151_2580850_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	93.5	1.1e-125
AYQ12292.1|2580849_2581188_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
AYQ12293.1|2581180_2584414_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.5	1.1e-111
AYQ12294.1|2584579_2584780_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ14344.1|2584887_2585247_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ12295.1|2585397_2586360_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
AYQ12296.1|2586386_2586779_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AYQ12297.1|2586775_2587156_-	HK97 gp10 family phage protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
AYQ12298.1|2587156_2587540_-	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
AYQ12299.1|2587539_2587935_-	protein singed	NA	NA	NA	NA	NA
AYQ12300.1|2588157_2589297_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	75.0	7.4e-159
AYQ12301.1|2589395_2590160_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	63.8	1.2e-83
AYQ12302.1|2590264_2591377_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.3	2.7e-113
AYQ12303.1|2591360_2592767_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
AYQ12304.1|2593456_2594670_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	5.1e-166
AYQ12305.1|2596261_2597149_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	4.9e-166
AYQ12306.1|2597148_2597475_-	hypothetical protein	NA	Q6H9S4	Enterobacteria_phage	99.1	4.9e-55
AYQ12307.1|2597775_2597985_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ12308.1|2597962_2598895_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
AYQ12309.1|2598887_2599679_-	transcriptional regulator	NA	R4TG31	Halovirus	40.2	2.8e-48
AYQ12310.1|2599816_2601274_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
AYQ12311.1|2601470_2601641_-	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	98.1	2.4e-13
AYQ12312.1|2601675_2601972_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ12313.1|2602006_2603169_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AYQ12314.1|2603304_2603802_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
AYQ12315.1|2603801_2604017_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
AYQ14345.1|2604268_2604643_-	tolA family protein	NA	NA	NA	NA	NA
AYQ12316.1|2605052_2606591_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
AYQ12317.1|2606639_2606987_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AYQ14346.1|2606983_2607364_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	7.9e-65
AYQ12318.1|2608735_2609278_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.1	8.3e-76
AYQ12319.1|2609274_2609565_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	86.5	5.3e-45
AYQ12320.1|2609564_2610164_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
AYQ12321.1|2610670_2611783_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AYQ12322.1|2611976_2612132_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	89.6	1.3e-13
AYQ12323.1|2612192_2612594_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	82.3	1.1e-19
AYQ12324.1|2612557_2613490_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ12325.1|2613486_2614041_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ12326.1|2614247_2614670_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.8	5.9e-61
AYQ12327.1|2614685_2615447_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	3.4e-115
AYQ12328.1|2615469_2616216_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
AYQ12329.1|2616222_2617011_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
AYQ12330.1|2617088_2617511_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
AYQ12331.1|2617507_2617762_-	DNA-binding protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AYQ12332.1|2617841_2618261_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
AYQ12333.1|2618297_2618516_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ12334.1|2618548_2618683_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ12335.1|2618693_2618849_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AYQ14347.1|2618845_2619334_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
AYQ12336.1|2619775_2619997_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AYQ14348.1|2619996_2620167_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AYQ12337.1|2620241_2620517_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
AYQ12338.1|2620618_2623690_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	84.0	0.0e+00
AYQ12339.1|2623701_2624754_+	enterohemolysin	NA	A0A0U2S5Y9	Escherichia_phage	63.6	8.5e-117
AYQ12340.1|2624817_2625012_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	98.4	1.3e-31
AYQ12341.1|2625004_2625193_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	1.2e-26
AYQ12342.1|2625292_2625508_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AYQ12343.1|2625509_2626745_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.0	9.3e-240
AYQ12344.1|2626796_2627732_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
AYQ12345.1|2627860_2629234_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AYQ12346.1|2629711_2630695_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AYQ14349.1|2630949_2632182_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 5
CP033378	Escherichia coli strain L73 chromosome, complete genome	4849006	3067921	3155806	4849006	tail,plate,head,integrase,capsid,tRNA,portal,protease,lysis	Salmonella_phage(59.32%)	94	3060884:3060899	3158377:3158392
3060884:3060899	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
AYQ12734.1|3067921_3069214_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AYQ12735.1|3069304_3070648_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AYQ12736.1|3070658_3071270_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AYQ12737.1|3071424_3075453_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AYQ12738.1|3075587_3076082_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AYQ12739.1|3076625_3077591_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
AYQ12740.1|3077713_3079480_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AYQ12741.1|3079480_3081202_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
AYQ12742.1|3081243_3081948_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYQ12743.1|3082232_3082451_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYQ12744.1|3083313_3085590_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.1e-166
AYQ12745.1|3085620_3085941_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AYQ12746.1|3086263_3086488_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AYQ12747.1|3086560_3088507_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AYQ12748.1|3088503_3089619_-	MacA family efflux pump subunit	NA	NA	NA	NA	NA
AYQ12749.1|3089733_3090726_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AYQ12750.1|3090722_3092381_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AYQ12751.1|3092806_3093502_+	aquaporin	NA	NA	NA	NA	NA
AYQ12752.1|3093996_3094896_+	transporter	NA	NA	NA	NA	NA
AYQ12753.1|3095039_3096692_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AYQ12754.1|3096703_3097672_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYQ12755.1|3097804_3099523_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
AYQ12756.1|3099559_3100561_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AYQ12757.1|3100571_3102002_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYQ14374.1|3102100_3103114_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYQ12758.1|3103110_3103941_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
AYQ12759.1|3103937_3104261_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ12760.1|3104386_3104902_+	lipoprotein	NA	NA	NA	NA	NA
AYQ12761.1|3105119_3105848_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
AYQ12762.1|3105865_3106597_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYQ12763.1|3106603_3107320_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AYQ12764.1|3107319_3107988_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AYQ12765.1|3108278_3109010_+	ABC transporter arginine-binding protein 1	NA	NA	NA	NA	NA
AYQ12766.1|3109208_3110336_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
AYQ12767.1|3110376_3110865_-	DUF2593 family protein	NA	NA	NA	NA	NA
AYQ12768.1|3110924_3111770_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AYQ12769.1|3111766_3112720_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AYQ12770.1|3112729_3113863_-	putrescine transport ATP-binding protein PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
AYQ12771.1|3113957_3115070_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AYQ12772.1|3115420_3115897_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AYQ12773.1|3115984_3116887_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AYQ12774.1|3116947_3117670_-	nitroreductase NfsA	NA	NA	NA	NA	NA
AYQ12775.1|3117653_3117941_-	DUF1418 family protein	NA	NA	NA	NA	NA
AYQ12776.1|3118100_3118358_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
AYQ12777.1|3118387_3118765_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ12778.1|3119034_3120720_+	transporter	NA	NA	NA	NA	NA
AYQ12779.1|3120955_3121174_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYQ12780.1|3121264_3122365_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.3	1.2e-177
AYQ12781.1|3122361_3122847_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	3.7e-67
AYQ12782.1|3122843_3125921_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.8	0.0e+00
AYQ12783.1|3125913_3126033_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYQ12784.1|3126047_3126350_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AYQ12785.1|3126404_3126920_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
AYQ12786.1|3126929_3128102_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
AYQ12787.1|3128244_3128811_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYQ12788.1|3128838_3129240_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	37.7	7.7e-10
AYQ12789.1|3129243_3129657_+|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	51.0	6.6e-33
AYQ12790.1|3129803_3131486_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	82.9	1.5e-160
AYQ12791.1|3131482_3132088_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
AYQ12792.1|3132080_3132989_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.7e-143
AYQ12793.1|3132975_3133335_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	1.2e-51
AYQ12794.1|3133331_3133910_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
AYQ12795.1|3133978_3134425_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYQ12796.1|3134417_3134849_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
AYQ14375.1|3134811_3135057_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.3	4.1e-30
AYQ12797.1|3134944_3135373_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	1.4e-46
AYQ12798.1|3135369_3135747_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	37.6	2.6e-15
AYQ14376.1|3135748_3136222_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYQ12799.1|3136241_3136457_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYQ12800.1|3136460_3136664_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYQ12801.1|3136663_3137128_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	87.7	3.5e-75
AYQ12802.1|3137223_3137874_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	95.4	4.3e-111
AYQ12803.1|3137877_3138936_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
AYQ12804.1|3138952_3139786_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
AYQ12805.1|3139928_3141695_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
AYQ12806.1|3141694_3142726_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.7	1.3e-170
AYQ12807.1|3142766_3144425_-	AAA family ATPase	NA	NA	NA	NA	NA
AYQ12808.1|3144414_3144720_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ12809.1|3144916_3145510_-	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
AYQ12810.1|3145571_3145811_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ12811.1|3145783_3146503_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ12812.1|3146625_3146931_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AYQ14377.1|3146869_3147058_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	7.2e-27
AYQ12813.1|3147211_3149626_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYQ12814.1|3149622_3150480_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	1.7e-160
AYQ12815.1|3150476_3150704_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
AYQ12816.1|3150703_3150937_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
AYQ12817.1|3151004_3151346_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AYQ12818.1|3151309_3151510_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
AYQ12819.1|3151517_3152027_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYQ12820.1|3152059_3152281_-	regulator	NA	NA	NA	NA	NA
AYQ12821.1|3152376_3152973_+	hypothetical protein	NA	A0A1S6KZZ7	Salmonella_phage	42.4	1.1e-39
AYQ12822.1|3152993_3154670_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	67.0	5.7e-83
AYQ12823.1|3154753_3155806_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3158377:3158392	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 6
CP033378	Escherichia coli strain L73 chromosome, complete genome	4849006	3436527	3506900	4849006	terminase,tail,head,integrase,capsid,portal,transposase,protease,lysis	Enterobacteria_phage(61.82%)	77	3458519:3458565	3506914:3506960
AYQ13057.1|3436527_3437640_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AYQ13058.1|3437716_3437869_-	protein HokE	NA	NA	NA	NA	NA
AYQ13059.1|3438321_3439440_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AYQ13060.1|3439505_3439754_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
AYQ13061.1|3439818_3440187_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AYQ13062.1|3440280_3440934_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AYQ13063.1|3441041_3442289_+	miniconductance mechanosensitive channel YbdG	NA	NA	NA	NA	NA
AYQ13064.1|3442356_3443733_-	aromatic amino acid transporter AroP	NA	NA	NA	NA	NA
AYQ13065.1|3443834_3446978_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	6.4e-59
AYQ13066.1|3446989_3448213_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
AYQ13067.1|3448228_3448561_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone	NA	NA	NA	NA	NA
AYQ13068.1|3448718_3450092_-	cation efflux system protein CusC	NA	NA	NA	NA	NA
AYQ13069.1|3450248_3450932_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
AYQ13070.1|3450921_3452370_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
AYQ13071.1|3453922_3456640_+	phage receptor	NA	NA	NA	NA	NA
AYQ13072.1|3456640_3457531_+	DUF4434 family protein	NA	NA	NA	NA	NA
AYQ13073.1|3457713_3458475_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
3458519:3458565	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
AYQ13074.1|3458988_3459942_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
AYQ13075.1|3460191_3460941_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYQ13076.1|3461843_3462470_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYQ13077.1|3462414_3462552_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AYQ13078.1|3462524_3463109_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.9	2.0e-104
AYQ13079.1|3463108_3466387_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.5e-06
AYQ13080.1|3466451_3467051_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	5.7e-110
AYQ13081.1|3467120_3470618_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	98.1	0.0e+00
AYQ13082.1|3470678_3471311_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
AYQ13083.1|3471247_3471991_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
AYQ13084.1|3471996_3472695_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
AYQ13085.1|3472694_3473024_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
AYQ13086.1|3473020_3475582_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.2	0.0e+00
AYQ13087.1|3475574_3476009_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AYQ13088.1|3475990_3476413_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
AYQ14388.1|3476428_3477169_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	1.8e-129
AYQ13089.1|3477176_3477572_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	2.9e-70
AYQ13090.1|3477568_3478147_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	5.0e-79
AYQ13091.1|3478158_3478512_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AYQ13092.1|3478523_3478919_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.2e-57
AYQ13093.1|3478960_3479986_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	1.5e-187
AYQ13094.1|3480041_3480374_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
AYQ13095.1|3480383_3481703_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	7.4e-235
AYQ13096.1|3481683_3483285_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	6.1e-308
AYQ13097.1|3483281_3483488_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AYQ13098.1|3483484_3485410_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
AYQ13099.1|3485384_3485930_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
AYQ13100.1|3486318_3486552_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
AYQ13101.1|3486609_3487020_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AYQ13102.1|3487698_3488187_-	GIY-YIG nuclease family protein	NA	K7P7S3	Enterobacteria_phage	98.8	1.4e-85
AYQ13103.1|3488700_3489913_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	5.1e-166
AYQ13104.1|3490160_3490658_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	95.2	5.6e-87
AYQ13105.1|3490657_3490873_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AYQ13106.1|3491446_3492544_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
AYQ13107.1|3492733_3493117_-	antitermination protein	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
AYQ13108.1|3493202_3493343_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	65.1	4.7e-07
AYQ13109.1|3493339_3493702_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	94.9	2.1e-59
AYQ13110.1|3493698_3493989_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	8.2e-46
AYQ13111.1|3493981_3494152_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
AYQ13112.1|3494151_3494607_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	65.6	2.7e-59
AYQ13113.1|3494603_3494705_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ14389.1|3494867_3495479_-	NADAR family protein	NA	A0A1X7BZM3	Faustovirus	32.9	3.6e-11
AYQ13114.1|3495468_3496500_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ13115.1|3497298_3497985_-	phage replication protein	NA	G8C7U6	Escherichia_phage	74.7	1.1e-96
AYQ14390.1|3497981_3498911_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.7	2.1e-111
AYQ13116.1|3498997_3499537_-	regulator	NA	M9NZI6	Enterobacteria_phage	65.6	5.8e-61
AYQ13117.1|3499606_3499837_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	8.5e-22
AYQ13118.1|3499941_3500631_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
AYQ13119.1|3500860_3501241_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYQ13120.1|3501721_3501928_+	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AYQ13121.1|3502003_3502300_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	2.3e-48
AYQ13122.1|3502305_3503091_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AYQ13123.1|3503087_3503768_+	exonuclease	NA	Q6H9Z0	Enterobacteria_phage	99.1	1.3e-131
AYQ13124.1|3503764_3503923_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	100.0	3.1e-23
AYQ13125.1|3503919_3504672_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	99.6	8.4e-151
AYQ13126.1|3504679_3504895_+	cell division protein ZapA	NA	M1FPM2	Enterobacteria_phage	97.2	8.5e-32
AYQ13127.1|3504993_3505212_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
AYQ13128.1|3505259_3505538_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
AYQ13129.1|3505509_3505881_+	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
AYQ13130.1|3505736_3506900_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
3506914:3506960	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 1
CP033379	Escherichia coli strain L73 plasmid pL73-2, complete sequence	167170	3659	143596	167170	transposase	Escherichia_phage(41.79%)	128	NA	NA
AYQ14439.1|3659_4361_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	97.4	4.3e-141
AYQ14440.1|4442_4661_+	hypothetical protein	NA	Q71TI9	Escherichia_phage	98.6	2.9e-35
AYQ14441.1|4662_5925_+	hypothetical protein	NA	Q1MVG4	Enterobacteria_phage	99.0	3.9e-233
AYQ14442.1|7302_7524_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	98.6	3.3e-31
AYQ14443.1|7523_7904_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	9.7e-63
AYQ14444.1|7908_8088_+	PdcA protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
AYQ14445.1|8115_9159_+	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.6	1.5e-203
AYQ14446.1|9461_9773_+	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	98.0	2.9e-49
AYQ14447.1|9805_10657_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	1.0e-157
AYQ14448.1|10767_10977_-	c1 repressor inactivator	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
AYQ14449.1|10942_11038_-	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AYQ14450.1|11056_11170_-	peptidase	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
AYQ14451.1|11581_11803_+	creatininase	NA	Q5QBN7	Enterobacteria_phage	97.3	4.2e-34
AYQ14452.1|11810_12842_+	recombinase	NA	A0A077SLE7	Escherichia_phage	99.1	1.9e-193
AYQ14453.1|12892_13204_+	lysogeny establishment protein	NA	A0A077SK03	Escherichia_phage	97.1	8.8e-46
AYQ14454.1|13449_14010_+	recombinase	NA	Q5QBN4	Enterobacteria_phage	95.7	2.8e-95
AYQ14455.1|14096_14846_+	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	48.6	1.1e-65
AYQ14456.1|15001_15643_+	maturation control protein	NA	A0A077SK30	Escherichia_phage	95.8	2.3e-109
AYQ14457.1|15745_16873_+	GTP pyrophosphokinase	NA	A0A1B0VBT5	Salmonella_phage	74.4	2.0e-156
AYQ14458.1|16909_17158_-	modulator protein	NA	Q71TG0	Escherichia_phage	98.8	4.0e-41
AYQ14459.1|17154_17595_-	peptide-binding protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
AYQ14460.1|17714_18876_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AYQ14461.1|21820_25354_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	36.7	1.2e-98
AYQ14462.1|25521_27060_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	4.3e-295
AYQ14463.1|27108_27456_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AYQ14577.1|27452_27833_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	7.9e-65
AYQ14464.1|28629_28839_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ14465.1|29285_29933_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AYQ14466.1|30269_31511_-	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.1	4.8e-10
AYQ14467.1|31595_32171_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	9.6e-30
AYQ14468.1|32257_32836_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
AYQ14469.1|32874_33915_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.3	4.1e-71
AYQ14470.1|33938_34394_-	Tellurium resistance protein TerB	NA	NA	NA	NA	NA
AYQ14471.1|34416_35568_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AYQ14472.1|35564_36149_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.4	2.0e-11
AYQ14473.1|36459_37518_+	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AYQ14578.1|37529_38672_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	28.4	1.8e-32
AYQ14474.1|38664_39438_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ14475.1|39439_40519_+	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	33.8	1.1e-39
AYQ14476.1|40518_41475_+	citrate lyase subunit beta	NA	NA	NA	NA	NA
AYQ14477.1|41485_42709_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AYQ14478.1|42711_43170_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
AYQ14479.1|43432_43627_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ14480.1|44432_45071_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AYQ14481.1|45095_45737_+	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	1.8e-05
AYQ14482.1|45737_46376_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AYQ14579.1|46468_47509_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AYQ14483.1|47508_49242_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
AYQ14484.1|49269_50769_+	kinase	NA	NA	NA	NA	NA
AYQ14485.1|51160_51832_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ14486.1|52444_53050_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	4.2e-20
AYQ14487.1|53144_56042_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AYQ14580.1|56462_56807_+	hypothetical protein	NA	A0A1B0VAH3	Salmonella_phage	100.0	2.4e-36
AYQ14488.1|56995_57187_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ14489.1|57199_57856_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
AYQ14490.1|61283_61988_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
AYQ14491.1|62074_62641_+	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
AYQ14492.1|62728_62995_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ14493.1|63308_64745_-	glutathione synthase	NA	NA	NA	NA	NA
AYQ14494.1|64832_65021_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ14495.1|65011_65716_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYQ14496.1|66020_66578_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AYQ14497.1|66760_67621_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AYQ14498.1|67851_68688_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AYQ14499.1|68687_69491_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AYQ14500.1|69551_70367_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AYQ14501.1|70696_70873_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AYQ14502.1|71054_72059_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AYQ14503.1|72137_75104_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
AYQ14504.1|75474_76179_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYQ14505.1|76248_76722_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AYQ14506.1|77935_78640_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYQ14507.1|79087_80521_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	1.4e-106
AYQ14508.1|81185_81890_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYQ14509.1|81923_82415_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ14510.1|82521_83259_+	resolvase	NA	NA	NA	NA	NA
AYQ14511.1|83255_83480_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ14512.1|83690_85184_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYQ14513.1|85214_86099_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AYQ14514.1|86315_87530_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	8.0e-18
AYQ14515.1|87557_87863_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYQ14516.1|88129_89329_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AYQ14517.1|89407_90085_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYQ14518.1|92676_93381_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYQ14519.1|94083_94296_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ14520.1|94495_95140_-	resolvase	NA	A0A1V0E035	Clostridioides_phage	28.3	3.4e-07
AYQ14521.1|95425_96046_+	chromosome partitioning protein ParA	NA	A2I303	Vibrio_virus	33.8	1.1e-18
AYQ14522.1|96097_96328_+	DNA partition complex ParG	NA	NA	NA	NA	NA
AYQ14523.1|96343_96637_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AYQ14581.1|96683_97607_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	7.1e-176
AYQ14524.1|97666_98089_-	DNA distortion polypeptide 3	NA	NA	NA	NA	NA
AYQ14525.1|98156_98603_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ14526.1|98642_99479_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
AYQ14527.1|100724_100976_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AYQ14528.1|100965_101247_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	3.8e-24
AYQ14529.1|101392_101716_+	hypothetical protein	NA	A0A0K1LL53	Rhodobacter_phage	46.1	9.2e-14
AYQ14530.1|101760_102006_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ14531.1|101995_102211_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ14532.1|102303_102543_+	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	96.2	1.0e-06
AYQ14533.1|103456_104065_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYQ14534.1|104160_104862_+	molecular chaperone	NA	NA	NA	NA	NA
AYQ14535.1|104873_107360_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AYQ14536.1|107350_108346_+	fimbrial protein	NA	NA	NA	NA	NA
AYQ14537.1|108359_108995_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYQ14582.1|111848_112241_+	cysteine hydrolase	NA	NA	NA	NA	NA
AYQ14538.1|112378_113263_+	EamA family transporter	NA	NA	NA	NA	NA
AYQ14539.1|113294_114494_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AYQ14540.1|114572_115250_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYQ14541.1|115904_116510_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	4.2e-20
AYQ14542.1|116604_119502_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AYQ14543.1|119630_119831_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
AYQ14544.1|120120_120408_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	4.5e-20
AYQ14545.1|120404_120656_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AYQ14546.1|120908_121040_+	replication protein RepA4	NA	NA	NA	NA	NA
AYQ14583.1|121268_124127_+	helicase	NA	Q1MVN7	Enterobacteria_phage	98.3	0.0e+00
AYQ14547.1|124940_126092_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	7.5e-42
AYQ14548.1|127254_128763_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.7	8.1e-44
AYQ14549.1|129307_129757_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ14550.1|131921_132452_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ14551.1|133477_133963_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYQ14552.1|133959_134682_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ14553.1|135112_136275_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AYQ14584.1|137606_137828_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ14554.1|137952_138450_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ14555.1|138626_139323_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	92.7	3.3e-125
AYQ14556.1|140833_142192_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
AYQ14557.1|142570_142762_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
AYQ14558.1|142899_143596_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	94.0	5.1e-126
>prophage 2
CP033379	Escherichia coli strain L73 plasmid pL73-2, complete sequence	167170	147593	164458	167170	transposase,plate	Escherichia_phage(56.25%)	17	NA	NA
AYQ14560.1|147593_147791_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.5e-06
AYQ14561.1|147756_148970_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	5.1e-166
AYQ14562.1|149433_149589_+	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	90.2	4.0e-15
AYQ14563.1|149782_150895_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AYQ14564.1|151054_151564_-|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	99.4	6.6e-91
AYQ14565.1|151575_152157_-	hypothetical protein	NA	Q71TM4	Escherichia_phage	96.9	1.8e-100
AYQ14566.1|152192_153008_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	94.8	3.0e-109
AYQ14567.1|153017_154289_-	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	97.4	6.6e-241
AYQ14568.1|154313_155587_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
AYQ14569.1|156002_157709_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
AYQ14570.1|157934_158936_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
AYQ14571.1|158952_160149_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AYQ14572.1|160317_161127_-	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.8	1.6e-155
AYQ14573.1|161419_162304_-	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
AYQ14574.1|162639_163032_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
AYQ14575.1|163207_163630_-	ppfA	NA	Q71TL5	Escherichia_phage	97.1	9.4e-59
AYQ14576.1|163669_164458_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	95.8	7.8e-115
