The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029886	Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 chromosome, complete genome	4783528	930522	937834	4783528	protease,integrase	Dickeya_phage(16.67%)	6	931773:931787	942952:942966
AYS29003.1|930522_931641_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS29004.1|931637_933584_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931773:931787	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS29005.1|933713_933935_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS29006.1|934258_934579_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS29007.1|934609_936886_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS29008.1|937456_937834_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942952:942966	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029886	Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 chromosome, complete genome	4783528	1008816	1086128	4783528	integrase,protease,terminase,transposase,tail	Salmonella_phage(73.33%)	93	990882:990901	1061489:1061508
990882:990901	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS29058.1|1008816_1010157_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS29059.1|1010153_1010402_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS29060.1|1010442_1010688_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS29061.1|1010687_1011569_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS29062.1|1011565_1012630_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS29063.1|1012707_1013388_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS29064.1|1013384_1014170_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS29065.1|1014175_1014472_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS29066.1|1014562_1014763_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS29067.1|1015051_1015456_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS29068.1|1015787_1016162_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS29069.1|1016246_1017230_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS29070.1|1017232_1017982_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS29071.1|1017992_1018340_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYS29072.1|1018336_1018861_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS29073.1|1018860_1019334_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS29074.1|1019337_1019910_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS29075.1|1020003_1020270_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS29076.1|1020351_1020513_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS29077.1|1020945_1021443_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS29078.1|1021627_1021867_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS29079.1|1021856_1022162_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS29080.1|1022201_1022804_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS29081.1|1023012_1023624_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS29082.1|1023756_1024554_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS29083.1|1024952_1025078_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS29084.1|1025213_1025663_-	lipoprotein	NA	NA	NA	NA	NA
AYS29085.1|1025879_1026269_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS29086.1|1026255_1026537_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS29087.1|1026536_1027151_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS29088.1|1027369_1027624_+	hypothetical protein	NA	NA	NA	NA	NA
AYS29089.1|1027728_1028106_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS29090.1|1028169_1028430_+	hypothetical protein	NA	NA	NA	NA	NA
AYS29091.1|1028519_1029272_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS29092.1|1029237_1030641_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS29093.1|1030640_1032110_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS29094.1|1032201_1032732_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS29095.1|1032746_1033979_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS29096.1|1033983_1034481_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS29097.1|1034492_1035434_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS29098.1|1035475_1035844_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS29099.1|1035809_1036217_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS29100.1|1036213_1036768_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS29101.1|1036754_1037144_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS29102.1|1037118_1037682_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS29103.1|1037685_1038831_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS29104.1|1038842_1039283_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS29105.1|1039286_1039739_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS29106.1|1039916_1041869_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS29107.1|1041868_1042519_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS29108.1|1042522_1042825_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS29109.1|1042827_1043859_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS29110.1|1043855_1044191_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS29111.1|1044385_1045117_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS29112.1|1045116_1045545_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS29113.1|1045603_1046359_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS29114.1|1046446_1046584_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS29115.1|1046599_1046953_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS29116.1|1046953_1048153_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS29117.1|1048149_1048830_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS29118.1|1048829_1050341_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS29119.1|1050355_1050874_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS29120.1|1051795_1052497_-	hypothetical protein	NA	NA	NA	NA	NA
AYS29121.1|1052809_1053088_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS29122.1|1053513_1056126_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS29123.1|1056333_1057344_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS29124.1|1057506_1058052_+	hypothetical protein	NA	NA	NA	NA	NA
AYS29125.1|1058048_1059158_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS29126.1|1059256_1061365_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS29127.1|1061377_1063285_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061489:1061508	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS29128.1|1063299_1064553_+	inner membrane protein	NA	NA	NA	NA	NA
AYS29129.1|1064557_1066198_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS29130.1|1066194_1066758_+	lipoprotein	NA	NA	NA	NA	NA
AYS29131.1|1067011_1067179_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS29132.1|1067278_1067797_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS29133.1|1067865_1069626_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS29134.1|1069811_1070264_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS29135.1|1070335_1071388_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS29136.1|1071742_1072252_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS29137.1|1072468_1073074_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS29138.1|1073060_1075214_-	inner membrane protein	NA	NA	NA	NA	NA
AYS29139.1|1075232_1075679_-	hypothetical protein	NA	NA	NA	NA	NA
AYS29140.1|1075802_1077857_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS29141.1|1077892_1078351_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS29142.1|1078445_1079108_-	hypothetical protein	NA	NA	NA	NA	NA
AYS29143.1|1079278_1079695_+	hypothetical protein	NA	NA	NA	NA	NA
AYS29144.1|1079739_1080057_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS29145.1|1080114_1081326_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS29146.1|1082457_1082916_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS29147.1|1083652_1083934_+	acylphosphatase	NA	NA	NA	NA	NA
AYS29148.1|1083930_1084260_-	sulfite reductase	NA	NA	NA	NA	NA
AYS29149.1|1084346_1085006_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS29150.1|1085669_1086128_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029886	Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 chromosome, complete genome	4783528	1528946	1602544	4783528	tRNA,head,plate,protease,transposase,tail	Burkholderia_virus(44.12%)	72	NA	NA
AYS29550.1|1528946_1529405_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS29551.1|1529907_1530189_+	stress response protein	NA	NA	NA	NA	NA
AYS29552.1|1530457_1531279_+|protease	serine protease	protease	NA	NA	NA	NA
AYS29553.1|1531313_1531643_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS29554.1|1531629_1531992_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS29555.1|1532103_1532274_-	hypothetical protein	NA	NA	NA	NA	NA
AYS29556.1|1532408_1533443_+	hypothetical protein	NA	NA	NA	NA	NA
AYS29557.1|1533617_1535006_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS29558.1|1535016_1536546_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS29559.1|1537072_1538017_+	hypothetical protein	NA	NA	NA	NA	NA
AYS29560.1|1538198_1538588_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS29561.1|1538559_1539012_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS29562.1|1539206_1539437_-	hypothetical protein	NA	NA	NA	NA	NA
AYS29563.1|1539433_1540117_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS29564.1|1540701_1541004_-	hypothetical protein	NA	NA	NA	NA	NA
AYS29565.1|1541574_1542105_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS29566.1|1542404_1543571_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS29567.1|1543581_1545351_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS29568.1|1546795_1547146_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS29569.1|1547860_1548511_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS29570.1|1548833_1549145_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS29571.1|1549144_1549690_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS29572.1|1549686_1551282_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS29573.1|1551281_1552778_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS29574.1|1552758_1553580_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS29575.1|1553582_1554041_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS29576.1|1554255_1555371_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS29577.1|1555385_1556339_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS29578.1|1556348_1556687_+	hypothetical protein	NA	NA	NA	NA	NA
AYS29579.1|1556688_1557135_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS29580.1|1557134_1557599_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS29581.1|1557839_1559267_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS29582.1|1559266_1559788_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS29583.1|1559790_1560072_+	hypothetical protein	NA	NA	NA	NA	NA
AYS29584.1|1560169_1560505_+	hypothetical protein	NA	NA	NA	NA	NA
AYS29585.1|1560680_1563146_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS29586.1|1563145_1564030_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS29587.1|1564026_1564242_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS29588.1|1564229_1565384_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS29589.1|1565380_1565908_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS29590.1|1565964_1566312_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS29591.1|1566302_1567406_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS29592.1|1567398_1567977_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS29593.1|1567979_1569005_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYS29594.1|1569518_1570136_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS29595.1|1571646_1572219_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYS29596.1|1572499_1573882_+	amino acid permease	NA	NA	NA	NA	NA
AYS29597.1|1573943_1574279_-	hypothetical protein	NA	NA	NA	NA	NA
AYS29598.1|1574405_1575137_+	two-component response regulator	NA	NA	NA	NA	NA
AYS29599.1|1575617_1576769_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYS29600.1|1576921_1578628_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYS29601.1|1578735_1580040_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYS29602.1|1580115_1581045_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYS29603.1|1581041_1582445_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYS29604.1|1582612_1584259_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYS29605.1|1584458_1585634_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYS29606.1|1585736_1587245_+	hypothetical protein	NA	NA	NA	NA	NA
AYS29607.1|1587950_1588952_+	adenosine deaminase	NA	NA	NA	NA	NA
AYS29608.1|1589025_1590141_-	oxidoreductase	NA	NA	NA	NA	NA
AYS29609.1|1590243_1590399_+	hypothetical protein	NA	NA	NA	NA	NA
AYS29610.1|1590697_1590913_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYS29611.1|1591001_1591442_+	hypothetical protein	NA	NA	NA	NA	NA
AYS29612.1|1591518_1592100_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYS29613.1|1592099_1592678_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYS29614.1|1592670_1594692_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYS29615.1|1594692_1595751_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYS29616.1|1595754_1596375_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYS29617.1|1596377_1597070_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYS29618.1|1597069_1597705_+	endonuclease III	NA	NA	NA	NA	NA
AYS29619.1|1598305_1599811_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYS29620.1|1599915_1600521_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYS29621.1|1601269_1602544_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029886	Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 chromosome, complete genome	4783528	1783580	1787992	4783528		Escherichia_phage(50.0%)	6	NA	NA
AYS29805.1|1783580_1783820_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYS29806.1|1784692_1785502_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS29807.1|1785574_1785952_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS29808.1|1786099_1786642_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS29809.1|1786833_1787562_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS29810.1|1787578_1787992_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029886	Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 chromosome, complete genome	4783528	1991845	1999079	4783528		Morganella_phage(33.33%)	7	NA	NA
AYS30000.1|1991845_1993276_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYS30001.1|1993349_1994045_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYS30002.1|1994124_1994436_-	hypothetical protein	NA	NA	NA	NA	NA
AYS30003.1|1995086_1996271_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYS30004.1|1996730_1996943_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYS30005.1|1997388_1998657_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYS30006.1|1998659_1999079_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029886	Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 chromosome, complete genome	4783528	2105380	2115887	4783528		Enterobacteria_phage(37.5%)	10	NA	NA
AYS30103.1|2105380_2106694_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS30104.1|2106720_2107800_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS30105.1|2107804_2108578_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS30106.1|2108593_2109568_-	reductase RfbI	NA	NA	NA	NA	NA
AYS30107.1|2109573_2110125_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS30108.1|2110125_2111004_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS30109.1|2111051_2111951_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS30110.1|2111950_2113036_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS30111.1|2113412_2114306_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS30112.1|2114483_2115887_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029886	Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 chromosome, complete genome	4783528	2193116	2202287	4783528	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS30171.1|2193116_2195150_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS30172.1|2195390_2195849_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS30173.1|2196020_2196551_+	lipoprotein	NA	NA	NA	NA	NA
AYS30174.1|2196607_2197075_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS30175.1|2197121_2197841_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS30176.1|2197837_2199523_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS30177.1|2199745_2200477_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS30178.1|2200536_2200644_+	hypothetical protein	NA	NA	NA	NA	NA
AYS30179.1|2200624_2201356_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS30180.1|2201339_2202287_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029886	Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 chromosome, complete genome	4783528	2737724	2751116	4783528	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS30609.1|2737724_2737943_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS30610.1|2738033_2739134_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS30611.1|2739130_2739616_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS30612.1|2739612_2742690_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS30613.1|2742682_2742802_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS30614.1|2742816_2743119_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS30615.1|2743173_2743689_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS30616.1|2743698_2744871_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS30617.1|2745013_2745586_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS30618.1|2746263_2747379_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS30619.1|2747459_2751116_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029886	Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 chromosome, complete genome	4783528	3067864	3111567	4783528	tRNA,transposase,protease,bacteriocin	Bacillus_virus(33.33%)	44	NA	NA
AYS30906.1|3067864_3068323_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS30907.1|3068512_3069592_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS30908.1|3069693_3070857_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS30909.1|3070878_3071925_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS30910.1|3072298_3072724_+	hypothetical protein	NA	NA	NA	NA	NA
AYS30911.1|3072749_3073328_+	hypothetical protein	NA	NA	NA	NA	NA
AYS30912.1|3073361_3074036_+	hypothetical protein	NA	NA	NA	NA	NA
AYS30913.1|3074017_3074701_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS30914.1|3074694_3075351_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS30915.1|3075455_3075914_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS30916.1|3076102_3078094_-	transketolase	NA	NA	NA	NA	NA
AYS30917.1|3078369_3079128_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS30918.1|3079228_3080149_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS30919.1|3080376_3082353_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS30920.1|3082361_3082493_-	hypothetical protein	NA	NA	NA	NA	NA
AYS30921.1|3082787_3083087_-	membrane protein	NA	NA	NA	NA	NA
AYS30922.1|3083142_3084297_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS30923.1|3084789_3086184_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS30924.1|3086262_3086760_+	hypothetical protein	NA	NA	NA	NA	NA
AYS30925.1|3086855_3087563_+	endonuclease I	NA	NA	NA	NA	NA
AYS30926.1|3087639_3088371_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS30927.1|3088390_3089338_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS30928.1|3089553_3090117_+	hypothetical protein	NA	NA	NA	NA	NA
AYS30929.1|3090116_3090533_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS30930.1|3090579_3091266_-	global regulatory protein	NA	NA	NA	NA	NA
AYS30931.1|3091395_3092376_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS30932.1|3092393_3093098_+	hypothetical protein	NA	NA	NA	NA	NA
AYS30933.1|3093116_3093683_+	hypothetical protein	NA	NA	NA	NA	NA
AYS30934.1|3093679_3093970_+	hypothetical protein	NA	NA	NA	NA	NA
AYS30935.1|3093977_3094571_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS30936.1|3094563_3095700_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS30937.1|3095790_3096798_-	hypothetical protein	NA	NA	NA	NA	NA
AYS30938.1|3096930_3097977_-	L-asparaginase	NA	NA	NA	NA	NA
AYS30939.1|3098295_3098754_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS30940.1|3098876_3099596_-	hypothetical protein	NA	NA	NA	NA	NA
AYS30941.1|3099645_3099972_-	hypothetical protein	NA	NA	NA	NA	NA
AYS30942.1|3099971_3100691_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS30943.1|3100845_3101898_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS30944.1|3101925_3102201_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS30945.1|3102313_3103399_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS30946.1|3103615_3104872_+	nucleoside permease	NA	NA	NA	NA	NA
AYS30947.1|3107482_3108190_+	hypothetical protein	NA	NA	NA	NA	NA
AYS30948.1|3110779_3111046_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS30949.1|3111288_3111567_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029886	Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 chromosome, complete genome	4783528	3489267	3527325	4783528	portal,integrase,plate,terminase,capsid,transposase,tail	Salmonella_phage(82.05%)	46	3484231:3484245	3496397:3496411
3484231:3484245	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS31277.1|3489267_3490914_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS31278.1|3491053_3491152_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS31279.1|3491407_3491737_+	hypothetical protein	NA	NA	NA	NA	NA
AYS31280.1|3491777_3492830_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS31281.1|3493225_3493795_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS31282.1|3493920_3494142_+	hypothetical protein	NA	NA	NA	NA	NA
AYS31283.1|3494174_3494684_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS31284.1|3494858_3495083_+	hypothetical protein	NA	NA	NA	NA	NA
AYS31285.1|3495105_3495447_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS31286.1|3495514_3495748_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS31287.1|3495747_3495975_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS31288.1|3495971_3496829_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3496397:3496411	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS31289.1|3496825_3499240_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS31290.1|3499393_3499582_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS31291.1|3501549_3502464_+	hypothetical protein	NA	NA	NA	NA	NA
AYS31292.1|3502460_3503201_+	hypothetical protein	NA	NA	NA	NA	NA
AYS31293.1|3503235_3504273_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS31294.1|3504272_3506039_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS31295.1|3506181_3507015_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS31296.1|3507031_3508090_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS31297.1|3508093_3508744_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS31298.1|3508776_3509304_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS31299.1|3509303_3509507_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS31300.1|3509510_3509726_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS31301.1|3509745_3510219_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS31302.1|3510220_3510598_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS31303.1|3510594_3511023_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS31304.1|3511118_3511550_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS31305.1|3511542_3511989_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS31306.1|3512057_3512636_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS31307.1|3512632_3512992_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS31308.1|3512978_3513887_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS31309.1|3513879_3514485_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS31310.1|3514481_3515996_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYS31311.1|3515995_3516589_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS31312.1|3516560_3517001_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS31313.1|3517423_3517996_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS31314.1|3518138_3519311_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS31315.1|3519320_3519836_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS31316.1|3519890_3520193_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS31317.1|3520207_3520327_+	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS31318.1|3520319_3523397_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS31319.1|3523393_3523879_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS31320.1|3523875_3524976_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS31321.1|3525066_3525285_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS31322.1|3526866_3527325_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029886	Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 chromosome, complete genome	4783528	4443181	4517438	4783528	portal,integrase,plate,terminase,capsid,tail	Salmonella_phage(82.98%)	76	4504682:4504698	4517597:4517613
AYS32093.1|4443181_4445131_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS32094.1|4445202_4446111_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32095.1|4446184_4447084_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32096.1|4447125_4447485_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32097.1|4447584_4447854_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32098.1|4447985_4449260_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS32099.1|4449479_4449857_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32100.1|4449943_4450162_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS32101.1|4450229_4451330_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS32102.1|4451326_4451812_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS32103.1|4451811_4454592_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS32104.1|4454584_4454704_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS32105.1|4454718_4455021_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS32106.1|4455075_4455591_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS32107.1|4455600_4456773_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS32108.1|4457307_4458030_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS32109.1|4458227_4458635_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS32110.1|4458641_4460261_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS32111.1|4460257_4460863_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS32112.1|4460855_4461764_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	96.7	4.4e-154
AYS32113.1|4461750_4462110_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS32114.1|4462106_4462685_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS32115.1|4462753_4463200_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS32116.1|4463192_4463624_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYS32117.1|4463719_4464145_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS32118.1|4464144_4464522_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS32119.1|4464526_4464997_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS32120.1|4465016_4465232_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS32121.1|4465235_4465439_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS32122.1|4465438_4465903_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS32123.1|4465996_4466647_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS32124.1|4466650_4467715_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS32125.1|4467731_4468565_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS32126.1|4468707_4470474_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS32127.1|4470470_4471517_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS32128.1|4471565_4472261_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32129.1|4472280_4473345_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32130.1|4473341_4474406_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32131.1|4475330_4475660_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYS32132.1|4475656_4477726_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYS32133.1|4477716_4478577_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS32134.1|4478573_4479158_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS32135.1|4479154_4479382_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS32136.1|4479381_4479615_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS32137.1|4479682_4480024_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS32138.1|4479987_4480188_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS32139.1|4480195_4480705_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS32140.1|4480737_4480980_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS32141.1|4481096_4481729_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS32142.1|4481732_4482758_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS32143.1|4482864_4483218_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS32144.1|4483834_4484122_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32145.1|4484132_4485023_+	methyltransferase	NA	NA	NA	NA	NA
AYS32146.1|4485022_4485769_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32147.1|4486070_4488041_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS32148.1|4488060_4489365_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS32149.1|4489387_4490083_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS32150.1|4490108_4490903_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS32151.1|4490912_4491980_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS32152.1|4492024_4493761_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS32153.1|4493760_4496256_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS32154.1|4496279_4497326_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS32155.1|4497328_4498606_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS32156.1|4498850_4499390_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS32157.1|4500243_4501755_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS32158.1|4501738_4503328_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32159.1|4503491_4504505_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4504682:4504698	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS32160.1|4504931_4505225_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32161.1|4505221_4505710_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32162.1|4505889_4506342_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32163.1|4511564_4512026_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32164.1|4512022_4512244_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS32165.1|4513100_4513883_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32166.1|4514509_4514734_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32167.1|4514863_4515868_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYS32168.1|4516178_4517438_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4517597:4517613	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029886	Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 chromosome, complete genome	4783528	4659690	4669949	4783528	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYS32305.1|4659690_4660767_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS32306.1|4660763_4661837_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS32307.1|4661811_4662975_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32308.1|4663250_4663817_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS32309.1|4663832_4664072_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS32310.1|4664075_4664936_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS32311.1|4665358_4665682_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS32312.1|4665665_4666166_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYS32313.1|4666162_4666390_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32314.1|4666386_4666707_+	P4 phage protein	NA	NA	NA	NA	NA
AYS32315.1|4666721_4667396_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYS32316.1|4667392_4669054_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYS32317.1|4669790_4669949_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029887	Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence	216908	3612	57130	216908	transposase,holin	Escherichia_phage(43.75%)	56	NA	NA
AYS32412.1|3612_3888_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS32413.1|3806_4310_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS32414.1|4636_4861_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32415.1|5516_5777_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32416.1|5865_6357_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32417.1|6361_6670_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32418.1|6877_7258_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32419.1|7343_7592_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32420.1|7629_7851_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYS32421.1|8013_8397_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32422.1|8711_8936_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32423.1|9022_9487_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32424.1|9669_12099_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32425.1|12221_12668_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32426.1|12715_13522_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32427.1|13749_13992_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32428.1|14069_14402_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32429.1|14901_16083_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32430.1|16091_16388_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYS32431.1|16451_16919_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32432.1|17778_18555_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32433.1|18704_19481_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32434.1|19669_20011_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32435.1|20111_20375_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYS32436.1|20608_21307_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYS32437.1|21461_21758_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32438.1|21845_24230_-	periplasmic protein	NA	NA	NA	NA	NA
AYS32439.1|24480_25089_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32440.1|25201_25498_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32441.1|25502_26099_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32442.1|26490_27372_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYS32443.1|27957_28473_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32444.1|29123_31580_-	periplasmic protein	NA	NA	NA	NA	NA
AYS32445.1|32216_33971_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYS32446.1|34156_35314_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYS32447.1|35673_36498_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYS32448.1|36512_37334_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32449.1|37616_38324_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32450.1|38538_39615_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYS32451.1|40149_41025_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYS32452.1|41278_41860_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32453.1|42466_42820_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32454.1|42871_43189_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32455.1|43188_43986_+	pilus assembly protein	NA	NA	NA	NA	NA
AYS32456.1|43988_45221_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32457.1|45222_45663_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32458.1|45640_47011_+	TrhB	NA	NA	NA	NA	NA
AYS32459.1|47019_47532_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32460.1|47532_48390_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYS32461.1|48399_49350_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32462.1|49358_52040_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32463.1|52673_52949_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYS32464.1|53077_55081_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYS32465.1|55143_56439_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32466.1|56432_56936_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS32467.1|56854_57130_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 2
CP029887	Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence	216908	81957	134410	216908	transposase,integrase	Escherichia_phage(50.0%)	63	106861:106875	131361:131375
AYS32487.1|81957_82461_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS32488.1|82379_82655_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS32489.1|82696_84553_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYS32490.1|84950_85826_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32491.1|85884_86262_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32492.1|86322_87309_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32493.1|87368_88421_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32494.1|88459_88729_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32495.1|88799_89927_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32496.1|90004_92017_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32497.1|92088_92310_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32498.1|92424_93657_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYS32499.1|93931_94456_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32500.1|94446_95412_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32501.1|95482_96418_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32502.1|96495_97416_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32503.1|97488_98424_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32504.1|98600_99557_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32505.1|99969_100239_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32506.1|100293_100884_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32507.1|100891_101149_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32508.1|101222_101759_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32509.1|101775_102231_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32510.1|102214_102442_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32511.1|102490_102745_-	hypothetical protein	NA	NA	NA	NA	NA
AYS32512.1|102812_103772_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32513.1|103782_104691_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32514.1|104995_106177_-	recombinase	NA	NA	NA	NA	NA
AYS32515.1|106391_106604_+	regulatory protein	NA	NA	NA	NA	NA
106861:106875	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYS32516.1|106910_107186_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	7.7e-46
106861:106875	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYS32517.1|107104_107608_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS32518.1|107714_108149_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYS32519.1|108166_108571_+	MerT	NA	NA	NA	NA	NA
AYS32520.1|108584_108860_+	mercuric transport protein	NA	NA	NA	NA	NA
AYS32521.1|108895_109318_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYS32522.1|109369_111064_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYS32523.1|111081_111444_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYS32524.1|111440_111677_+	mercury resistance protein	NA	NA	NA	NA	NA
AYS32525.1|111673_112381_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32526.1|112419_113724_+|integrase	integrase	integrase	NA	NA	NA	NA
AYS32527.1|113752_114475_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS32528.1|115230_116082_+	replication protein	NA	NA	NA	NA	NA
AYS32529.1|116389_117205_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYS32530.1|117265_118069_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS32531.1|118068_118905_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS32532.1|118965_119688_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS32533.1|120267_121128_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
120722:120736	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYS32534.1|121310_121577_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
120722:120736	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYS32535.1|121609_122332_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS32536.1|122565_123492_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYS32537.1|123398_123779_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYS32538.1|123975_124575_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYS32539.1|124606_125620_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYS32540.1|125609_126173_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYS32541.1|126298_126859_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYS32542.1|126861_129828_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYS32543.1|129894_130272_+	hypothetical protein	NA	NA	NA	NA	NA
AYS32544.1|130472_131132_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYS32545.1|131410_131686_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS32546.1|131604_132108_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS32547.1|132689_133445_+	replication protein	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
AYS32548.1|133712_133988_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS32549.1|133906_134410_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
