The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029933	Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 chromosome, complete genome	4782854	930478	937790	4782854	integrase,protease	Dickeya_phage(16.67%)	6	931729:931743	942908:942922
AYS02710.1|930478_931597_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS02711.1|931593_933540_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931729:931743	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS02712.1|933669_933891_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS02713.1|934214_934535_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS02714.1|934565_936842_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS02715.1|937412_937790_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942908:942922	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029933	Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 chromosome, complete genome	4782854	1008733	1086045	4782854	protease,tail,terminase,integrase,transposase	Salmonella_phage(73.33%)	93	990799:990818	1061406:1061425
990799:990818	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS02765.1|1008733_1010074_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS02766.1|1010070_1010319_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS02767.1|1010359_1010605_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS02768.1|1010604_1011486_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS02769.1|1011482_1012547_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS02770.1|1012624_1013305_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS02771.1|1013301_1014087_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS02772.1|1014092_1014389_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS02773.1|1014479_1014680_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS02774.1|1014968_1015373_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS02775.1|1015704_1016079_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS02776.1|1016163_1017147_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS02777.1|1017149_1017899_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS02778.1|1017909_1018257_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYS02779.1|1018253_1018778_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS02780.1|1018777_1019251_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS02781.1|1019254_1019827_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS02782.1|1019920_1020187_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS02783.1|1020268_1020430_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS02784.1|1020862_1021360_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS02785.1|1021544_1021784_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS02786.1|1021773_1022079_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS02787.1|1022118_1022721_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS02788.1|1022929_1023541_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS02789.1|1023673_1024471_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS02790.1|1024869_1024995_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS02791.1|1025130_1025580_-	lipoprotein	NA	NA	NA	NA	NA
AYS02792.1|1025796_1026186_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS02793.1|1026172_1026454_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS02794.1|1026453_1027068_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS02795.1|1027286_1027541_+	hypothetical protein	NA	NA	NA	NA	NA
AYS02796.1|1027645_1028023_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS02797.1|1028086_1028347_+	hypothetical protein	NA	NA	NA	NA	NA
AYS02798.1|1028436_1029189_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS02799.1|1029154_1030558_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS02800.1|1030557_1032027_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS02801.1|1032118_1032649_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS02802.1|1032663_1033896_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS02803.1|1033900_1034398_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS02804.1|1034409_1035351_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS02805.1|1035392_1035761_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS02806.1|1035726_1036134_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS02807.1|1036130_1036685_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS02808.1|1036671_1037061_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS02809.1|1037035_1037599_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS02810.1|1037602_1038748_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS02811.1|1038759_1039200_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS02812.1|1039203_1039656_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS02813.1|1039833_1041786_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS02814.1|1041785_1042436_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS02815.1|1042439_1042742_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS02816.1|1042744_1043776_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS02817.1|1043772_1044108_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS02818.1|1044302_1045034_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS02819.1|1045033_1045462_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS02820.1|1045520_1046276_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS02821.1|1046363_1046501_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS02822.1|1046516_1046870_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS02823.1|1046870_1048070_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS02824.1|1048066_1048747_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS02825.1|1048746_1050258_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS02826.1|1050272_1050791_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS02827.1|1051712_1052414_-	hypothetical protein	NA	NA	NA	NA	NA
AYS02828.1|1052726_1053005_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS02829.1|1053430_1056043_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS02830.1|1056250_1057261_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS02831.1|1057423_1057969_+	hypothetical protein	NA	NA	NA	NA	NA
AYS02832.1|1057965_1059075_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS02833.1|1059173_1061282_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS02834.1|1061294_1063202_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061406:1061425	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS02835.1|1063216_1064470_+	inner membrane protein	NA	NA	NA	NA	NA
AYS02836.1|1064474_1066115_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS02837.1|1066111_1066675_+	lipoprotein	NA	NA	NA	NA	NA
AYS02838.1|1066928_1067096_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS02839.1|1067195_1067714_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS02840.1|1067782_1069543_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS02841.1|1069728_1070181_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS02842.1|1070252_1071305_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS02843.1|1071659_1072169_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS02844.1|1072385_1072991_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS02845.1|1072977_1075131_-	inner membrane protein	NA	NA	NA	NA	NA
AYS02846.1|1075149_1075596_-	hypothetical protein	NA	NA	NA	NA	NA
AYS02847.1|1075719_1077774_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS02848.1|1077809_1078268_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS02849.1|1078362_1079025_-	hypothetical protein	NA	NA	NA	NA	NA
AYS02850.1|1079195_1079612_+	hypothetical protein	NA	NA	NA	NA	NA
AYS02851.1|1079656_1079974_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS02852.1|1080031_1081243_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS02853.1|1082374_1082833_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS02854.1|1083569_1083851_+	acylphosphatase	NA	NA	NA	NA	NA
AYS02855.1|1083847_1084177_-	sulfite reductase	NA	NA	NA	NA	NA
AYS02856.1|1084263_1084923_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS02857.1|1085586_1086045_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029933	Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 chromosome, complete genome	4782854	1528863	1602175	4782854	tail,plate,head,transposase,protease,tRNA	Burkholderia_virus(43.24%)	79	NA	NA
AYS03257.1|1528863_1529322_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS03258.1|1529824_1530106_+	stress response protein	NA	NA	NA	NA	NA
AYS03259.1|1530374_1531196_+|protease	serine protease	protease	NA	NA	NA	NA
AYS03260.1|1531230_1531560_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS03261.1|1531546_1531909_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS03262.1|1532020_1532191_-	hypothetical protein	NA	NA	NA	NA	NA
AYS03263.1|1532325_1533360_+	hypothetical protein	NA	NA	NA	NA	NA
AYS03264.1|1533534_1534923_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS03265.1|1534933_1536463_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS03266.1|1536989_1537934_+	hypothetical protein	NA	NA	NA	NA	NA
AYS03267.1|1538115_1538505_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS03268.1|1538476_1538929_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS03269.1|1539123_1539354_-	hypothetical protein	NA	NA	NA	NA	NA
AYS03270.1|1539350_1540034_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS03271.1|1540030_1540246_-	hypothetical protein	NA	NA	NA	NA	NA
AYS03272.1|1540238_1540622_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYS03273.1|1540618_1540921_-	hypothetical protein	NA	NA	NA	NA	NA
AYS03274.1|1540930_1541203_-	hypothetical protein	NA	NA	NA	NA	NA
AYS03275.1|1541491_1542022_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS03276.1|1542049_1542319_-	hypothetical protein	NA	NA	NA	NA	NA
AYS03277.1|1542321_1543488_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS03278.1|1543498_1545268_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS03279.1|1545445_1545877_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYS03280.1|1545872_1546469_+	hypothetical protein	NA	NA	NA	NA	NA
AYS03281.1|1546712_1547063_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS03282.1|1547777_1548428_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS03283.1|1548424_1548751_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYS03284.1|1548750_1549062_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS03285.1|1549061_1549607_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS03286.1|1549603_1551199_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS03287.1|1551198_1552695_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS03288.1|1552675_1553497_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS03289.1|1553499_1553958_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS03290.1|1554172_1555288_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS03291.1|1555302_1556256_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS03292.1|1556265_1556604_+	hypothetical protein	NA	NA	NA	NA	NA
AYS03293.1|1556605_1557052_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS03294.1|1557051_1557516_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS03295.1|1557512_1557767_+	hypothetical protein	NA	NA	NA	NA	NA
AYS03296.1|1557756_1559184_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS03297.1|1559183_1559705_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS03298.1|1559707_1559989_+	hypothetical protein	NA	NA	NA	NA	NA
AYS03299.1|1560086_1560422_+	hypothetical protein	NA	NA	NA	NA	NA
AYS03300.1|1560597_1563063_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS03301.1|1563062_1563947_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS03302.1|1563943_1564159_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS03303.1|1564146_1565301_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS03304.1|1565297_1565825_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS03305.1|1565881_1566229_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS03306.1|1566219_1567323_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS03307.1|1567315_1567894_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS03308.1|1567896_1568922_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYS03309.1|1569435_1570053_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS03310.1|1571091_1571664_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYS03311.1|1571944_1573327_+	amino acid permease	NA	NA	NA	NA	NA
AYS03312.1|1573388_1573724_-	hypothetical protein	NA	NA	NA	NA	NA
AYS03313.1|1573850_1574582_+	two-component response regulator	NA	NA	NA	NA	NA
AYS03314.1|1575062_1576214_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYS03315.1|1576366_1578073_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYS03316.1|1578180_1579485_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYS03317.1|1579560_1580490_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYS03318.1|1580486_1581890_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYS03319.1|1582057_1583704_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYS03320.1|1583903_1585079_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYS03321.1|1585181_1586690_+	hypothetical protein	NA	NA	NA	NA	NA
AYS03322.1|1587395_1588397_+	adenosine deaminase	NA	NA	NA	NA	NA
AYS03323.1|1588470_1589586_-	oxidoreductase	NA	NA	NA	NA	NA
AYS03324.1|1589688_1589844_+	hypothetical protein	NA	NA	NA	NA	NA
AYS03325.1|1590142_1590358_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYS03326.1|1590446_1590887_+	hypothetical protein	NA	NA	NA	NA	NA
AYS03327.1|1590963_1591545_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYS03328.1|1591544_1592123_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYS03329.1|1594323_1595382_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYS03330.1|1595385_1596006_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYS03331.1|1596008_1596701_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYS03332.1|1596700_1597336_+	endonuclease III	NA	NA	NA	NA	NA
AYS03333.1|1597936_1599442_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYS03334.1|1599546_1600152_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYS03335.1|1600900_1602175_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029933	Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 chromosome, complete genome	4782854	1783212	1787624	4782854		Escherichia_phage(50.0%)	6	NA	NA
AYS03519.1|1783212_1783452_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYS03520.1|1784324_1785134_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS03521.1|1785206_1785584_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS03522.1|1785731_1786274_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS03523.1|1786465_1787194_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS03524.1|1787210_1787624_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029933	Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 chromosome, complete genome	4782854	1991477	1998711	4782854		Morganella_phage(33.33%)	7	NA	NA
AYS03714.1|1991477_1992908_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYS03715.1|1992981_1993677_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYS03716.1|1993756_1994068_-	hypothetical protein	NA	NA	NA	NA	NA
AYS03717.1|1994718_1995903_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYS03718.1|1996362_1996575_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYS03719.1|1997020_1998289_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYS03720.1|1998291_1998711_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029933	Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 chromosome, complete genome	4782854	2105012	2115519	4782854		Enterobacteria_phage(37.5%)	10	NA	NA
AYS03817.1|2105012_2106326_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS03818.1|2106352_2107432_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS03819.1|2107436_2108210_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS03820.1|2108225_2109200_-	reductase RfbI	NA	NA	NA	NA	NA
AYS03821.1|2109205_2109757_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS03822.1|2109757_2110636_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS03823.1|2110683_2111583_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS03824.1|2111582_2112668_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS03825.1|2113044_2113938_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS03826.1|2114115_2115519_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029933	Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 chromosome, complete genome	4782854	2192748	2201919	4782854	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS03886.1|2192748_2194782_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS03887.1|2195022_2195481_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS03888.1|2195652_2196183_+	lipoprotein	NA	NA	NA	NA	NA
AYS03889.1|2196239_2196707_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS03890.1|2196753_2197473_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS03891.1|2197469_2199155_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS03892.1|2199377_2200109_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS03893.1|2200168_2200276_+	hypothetical protein	NA	NA	NA	NA	NA
AYS03894.1|2200256_2200988_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS03895.1|2200971_2201919_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029933	Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 chromosome, complete genome	4782854	2737228	2750620	4782854	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS04324.1|2737228_2737447_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS04325.1|2737537_2738638_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS04326.1|2738634_2739120_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS04327.1|2739116_2742194_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS04328.1|2742186_2742306_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS04329.1|2742320_2742623_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS04330.1|2742677_2743193_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS04331.1|2743202_2744375_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS04332.1|2744517_2745090_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS04333.1|2745767_2746883_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS04334.1|2746963_2750620_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029933	Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 chromosome, complete genome	4782854	3068059	3111762	4782854	bacteriocin,protease,tRNA,transposase	Bacillus_virus(33.33%)	44	NA	NA
AYS04621.1|3068059_3068518_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS04622.1|3068707_3069787_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS04623.1|3069888_3071052_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS04624.1|3071073_3072120_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS04625.1|3072493_3072919_+	hypothetical protein	NA	NA	NA	NA	NA
AYS04626.1|3072944_3073523_+	hypothetical protein	NA	NA	NA	NA	NA
AYS04627.1|3073556_3074231_+	hypothetical protein	NA	NA	NA	NA	NA
AYS04628.1|3074212_3074896_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS04629.1|3074889_3075546_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS04630.1|3075650_3076109_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS04631.1|3076297_3078289_-	transketolase	NA	NA	NA	NA	NA
AYS04632.1|3078564_3079323_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS04633.1|3079423_3080344_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS04634.1|3080571_3082548_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS04635.1|3082556_3082688_-	hypothetical protein	NA	NA	NA	NA	NA
AYS04636.1|3082982_3083282_-	membrane protein	NA	NA	NA	NA	NA
AYS04637.1|3083337_3084492_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS04638.1|3084984_3086379_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS04639.1|3086457_3086955_+	hypothetical protein	NA	NA	NA	NA	NA
AYS04640.1|3087050_3087758_+	endonuclease I	NA	NA	NA	NA	NA
AYS04641.1|3087834_3088566_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS04642.1|3088585_3089533_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS04643.1|3089748_3090312_+	hypothetical protein	NA	NA	NA	NA	NA
AYS04644.1|3090311_3090728_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS04645.1|3090774_3091461_-	global regulatory protein	NA	NA	NA	NA	NA
AYS04646.1|3091590_3092571_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS04647.1|3092588_3093293_+	hypothetical protein	NA	NA	NA	NA	NA
AYS04648.1|3093311_3093878_+	hypothetical protein	NA	NA	NA	NA	NA
AYS04649.1|3093874_3094165_+	hypothetical protein	NA	NA	NA	NA	NA
AYS04650.1|3094172_3094766_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS04651.1|3094758_3095895_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS04652.1|3095985_3096993_-	hypothetical protein	NA	NA	NA	NA	NA
AYS04653.1|3097125_3098172_-	L-asparaginase	NA	NA	NA	NA	NA
AYS04654.1|3098490_3098949_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS04655.1|3099071_3099791_-	hypothetical protein	NA	NA	NA	NA	NA
AYS04656.1|3099840_3100167_-	hypothetical protein	NA	NA	NA	NA	NA
AYS04657.1|3100166_3100886_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS04658.1|3101040_3102093_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS04659.1|3102120_3102396_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS04660.1|3102508_3103594_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS04661.1|3103810_3105067_+	nucleoside permease	NA	NA	NA	NA	NA
AYS04662.1|3107677_3108385_+	hypothetical protein	NA	NA	NA	NA	NA
AYS04663.1|3110974_3111241_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS04664.1|3111483_3111762_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029933	Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 chromosome, complete genome	4782854	3488865	3526923	4782854	capsid,tail,plate,terminase,integrase,transposase,portal	Salmonella_phage(82.05%)	46	3483829:3483843	3495995:3496009
3483829:3483843	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS04992.1|3488865_3490512_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS04993.1|3490651_3490750_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS04994.1|3491005_3491335_+	hypothetical protein	NA	NA	NA	NA	NA
AYS04995.1|3491375_3492428_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS04996.1|3492823_3493393_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS04997.1|3493518_3493740_+	hypothetical protein	NA	NA	NA	NA	NA
AYS04998.1|3493772_3494282_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS04999.1|3494456_3494681_+	hypothetical protein	NA	NA	NA	NA	NA
AYS05000.1|3494703_3495045_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS05001.1|3495112_3495346_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS05002.1|3495345_3495573_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS05003.1|3495569_3496427_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3495995:3496009	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS05004.1|3496423_3498838_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS05005.1|3498991_3499180_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS05006.1|3501147_3502062_+	hypothetical protein	NA	NA	NA	NA	NA
AYS05007.1|3502058_3502799_+	hypothetical protein	NA	NA	NA	NA	NA
AYS05008.1|3502833_3503871_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS05009.1|3503870_3505637_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS05010.1|3505779_3506613_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS05011.1|3506629_3507688_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS05012.1|3507691_3508342_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS05013.1|3508374_3508902_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS05014.1|3508901_3509105_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS05015.1|3509108_3509324_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS05016.1|3509343_3509817_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS05017.1|3509818_3510196_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS05018.1|3510192_3510621_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS05019.1|3510716_3511148_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS05020.1|3511140_3511587_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS05021.1|3511655_3512234_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS05022.1|3512230_3512590_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS05023.1|3512576_3513485_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS05024.1|3513477_3514083_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS05025.1|3514079_3515594_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYS05026.1|3515593_3516187_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS05027.1|3516158_3516599_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS05028.1|3517021_3517594_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS05029.1|3517736_3518909_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS05030.1|3518918_3519434_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS05031.1|3519488_3519791_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS05032.1|3519805_3519925_+	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS05033.1|3519917_3522995_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS05034.1|3522991_3523477_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS05035.1|3523473_3524574_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS05036.1|3524664_3524883_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS05037.1|3526464_3526923_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029933	Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 chromosome, complete genome	4782854	4442619	4516876	4782854	tail,capsid,plate,terminase,integrase,portal	Salmonella_phage(82.98%)	76	4504120:4504136	4517035:4517051
AYS05809.1|4442619_4444569_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS05810.1|4444640_4445549_+	hypothetical protein	NA	NA	NA	NA	NA
AYS05811.1|4445622_4446522_+	hypothetical protein	NA	NA	NA	NA	NA
AYS05812.1|4446563_4446923_+	hypothetical protein	NA	NA	NA	NA	NA
AYS05813.1|4447022_4447292_-	hypothetical protein	NA	NA	NA	NA	NA
AYS05814.1|4447423_4448698_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS05815.1|4448917_4449295_+	hypothetical protein	NA	NA	NA	NA	NA
AYS05816.1|4449381_4449600_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS05817.1|4449667_4450768_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS05818.1|4450764_4451250_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS05819.1|4451249_4454030_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS05820.1|4454022_4454142_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS05821.1|4454156_4454459_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS05822.1|4454513_4455029_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS05823.1|4455038_4456211_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS05824.1|4456745_4457468_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS05825.1|4457665_4458073_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS05826.1|4458079_4459699_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS05827.1|4459695_4460301_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS05828.1|4460293_4461202_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	96.7	4.4e-154
AYS05829.1|4461188_4461548_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS05830.1|4461544_4462123_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS05831.1|4462191_4462638_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS05832.1|4462630_4463062_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYS05833.1|4463157_4463583_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS05834.1|4463582_4463960_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS05835.1|4463964_4464435_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS05836.1|4464454_4464670_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS05837.1|4464673_4464877_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS05838.1|4464876_4465341_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS05839.1|4465434_4466085_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS05840.1|4466088_4467153_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS05841.1|4467169_4468003_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS05842.1|4468145_4469912_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS05843.1|4469908_4470955_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS05844.1|4471003_4471699_-	hypothetical protein	NA	NA	NA	NA	NA
AYS05845.1|4471718_4472783_-	hypothetical protein	NA	NA	NA	NA	NA
AYS05846.1|4472779_4473844_-	hypothetical protein	NA	NA	NA	NA	NA
AYS05847.1|4474768_4475098_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYS05848.1|4475094_4477164_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYS05849.1|4477154_4478015_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS05850.1|4478011_4478596_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS05851.1|4478592_4478820_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS05852.1|4478819_4479053_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS05853.1|4479120_4479462_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS05854.1|4479425_4479626_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS05855.1|4479633_4480143_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS05856.1|4480175_4480418_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS05857.1|4480534_4481167_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS05858.1|4481170_4482196_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS05859.1|4482302_4482656_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS05860.1|4483272_4483560_+	hypothetical protein	NA	NA	NA	NA	NA
AYS05861.1|4483570_4484461_+	methyltransferase	NA	NA	NA	NA	NA
AYS05862.1|4484460_4485207_+	hypothetical protein	NA	NA	NA	NA	NA
AYS05863.1|4485508_4487479_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS05864.1|4487498_4488803_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS05865.1|4488825_4489521_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS05866.1|4489546_4490341_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS05867.1|4490350_4491418_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS05868.1|4491462_4493199_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS05869.1|4493198_4495694_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS05870.1|4495717_4496764_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS05871.1|4496766_4498044_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS05872.1|4498288_4498828_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS05873.1|4499681_4501193_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS05874.1|4501176_4502766_+	hypothetical protein	NA	NA	NA	NA	NA
AYS05875.1|4502929_4503943_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4504120:4504136	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS05876.1|4504369_4504663_+	hypothetical protein	NA	NA	NA	NA	NA
AYS05877.1|4504659_4505148_+	hypothetical protein	NA	NA	NA	NA	NA
AYS05878.1|4505327_4505780_-	hypothetical protein	NA	NA	NA	NA	NA
AYS05879.1|4511002_4511464_+	hypothetical protein	NA	NA	NA	NA	NA
AYS05880.1|4511460_4511682_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS05881.1|4512538_4513321_+	hypothetical protein	NA	NA	NA	NA	NA
AYS05882.1|4513947_4514172_-	hypothetical protein	NA	NA	NA	NA	NA
AYS05883.1|4514301_4515306_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYS05884.1|4515616_4516876_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4517035:4517051	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029933	Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 chromosome, complete genome	4782854	4659128	4669387	4782854	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYS06021.1|4659128_4660205_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS06022.1|4660201_4661275_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS06023.1|4661249_4662413_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06024.1|4662688_4663255_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS06025.1|4663270_4663510_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS06026.1|4663513_4664374_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS06027.1|4664796_4665120_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS06028.1|4665103_4665604_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYS06029.1|4665600_4665828_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06030.1|4665824_4666145_+	P4 phage protein	NA	NA	NA	NA	NA
AYS06031.1|4666159_4666834_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYS06032.1|4666830_4668492_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYS06033.1|4669228_4669387_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029934	Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence	217083	3612	57130	217083	holin,transposase	Escherichia_phage(43.75%)	56	NA	NA
AYS06128.1|3612_3888_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS06129.1|3806_4310_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	6.3e-94
AYS06130.1|4636_4861_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06131.1|5516_5777_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06132.1|5865_6357_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06133.1|6361_6670_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06134.1|6877_7258_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06135.1|7343_7592_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06136.1|7629_7851_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYS06137.1|8013_8397_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06138.1|8711_8936_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06139.1|9022_9487_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06140.1|9669_12099_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06141.1|12221_12668_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06142.1|12715_13522_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06143.1|13749_13992_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06144.1|14069_14402_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06145.1|14901_16083_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06146.1|16091_16388_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYS06147.1|16451_16919_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06148.1|17778_18555_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06149.1|18704_19481_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06150.1|19669_20011_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06151.1|20111_20375_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYS06152.1|20608_21307_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYS06153.1|21461_21758_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06154.1|21845_24230_-	periplasmic protein	NA	NA	NA	NA	NA
AYS06155.1|24480_25089_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06156.1|25201_25498_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06157.1|25502_26099_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06158.1|26490_27372_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYS06159.1|27957_28473_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06160.1|29123_31580_-	periplasmic protein	NA	NA	NA	NA	NA
AYS06161.1|32216_33971_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYS06162.1|34156_35314_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYS06163.1|35673_36498_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYS06164.1|36512_37334_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06165.1|37616_38324_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06166.1|38538_39615_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYS06167.1|40149_41025_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYS06168.1|41278_41860_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06169.1|42466_42820_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06170.1|42871_43189_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06171.1|43188_43986_+	pilus assembly protein	NA	NA	NA	NA	NA
AYS06172.1|43988_45221_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06173.1|45222_45663_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06174.1|45640_47011_+	TrhB	NA	NA	NA	NA	NA
AYS06175.1|47019_47532_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06176.1|47532_48390_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYS06177.1|48399_49350_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06178.1|49358_52040_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06179.1|52673_52949_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYS06180.1|53077_55081_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYS06181.1|55143_56439_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06182.1|56432_56936_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS06183.1|56854_57130_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 2
CP029934	Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence	217083	82223	134584	217083	integrase,transposase	Escherichia_phage(50.0%)	63	107127:107141	131627:131641
AYS06203.1|82223_82727_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS06204.1|82645_82921_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS06205.1|82962_84819_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYS06206.1|85216_86092_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06207.1|86150_86528_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06208.1|86588_87575_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06209.1|87634_88687_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06210.1|88725_88995_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06211.1|89065_90193_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06212.1|90270_92283_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06213.1|92354_92576_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06214.1|92690_93923_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYS06215.1|94197_94722_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06216.1|94712_95678_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06217.1|95748_96684_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06218.1|96761_97682_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06219.1|97754_98690_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06220.1|98866_99823_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06221.1|100235_100505_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06222.1|100559_101150_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06223.1|101157_101415_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06224.1|101488_102025_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06225.1|102041_102497_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06226.1|102480_102708_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06227.1|102756_103011_-	hypothetical protein	NA	NA	NA	NA	NA
AYS06228.1|103078_104038_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06229.1|104048_104957_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06230.1|105261_106443_-	recombinase	NA	NA	NA	NA	NA
AYS06231.1|106657_106870_+	regulatory protein	NA	NA	NA	NA	NA
107127:107141	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYS06232.1|107176_107452_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	7.7e-46
107127:107141	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYS06233.1|107370_107874_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS06234.1|107980_108415_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYS06235.1|108432_108837_+	MerT	NA	NA	NA	NA	NA
AYS06236.1|108850_109126_+	mercuric transport protein	NA	NA	NA	NA	NA
AYS06237.1|109161_109584_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYS06238.1|109635_111330_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYS06239.1|111347_111710_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYS06240.1|111706_111943_+	mercury resistance protein	NA	NA	NA	NA	NA
AYS06241.1|111939_112647_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06242.1|112685_113990_+|integrase	integrase	integrase	NA	NA	NA	NA
AYS06243.1|114018_114741_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS06244.1|115496_116348_+	replication protein	NA	NA	NA	NA	NA
AYS06245.1|116655_117471_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYS06246.1|117531_118335_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS06247.1|118334_119171_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS06248.1|119231_119954_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS06249.1|120533_121394_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
120988:121002	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYS06250.1|121576_121843_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
120988:121002	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYS06251.1|121875_122598_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS06252.1|122831_123758_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYS06253.1|123664_124045_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYS06254.1|124241_124841_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYS06255.1|124872_125886_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYS06256.1|125875_126439_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYS06257.1|126564_127125_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYS06258.1|127127_130094_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYS06259.1|130160_130538_+	hypothetical protein	NA	NA	NA	NA	NA
AYS06260.1|130738_131398_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYS06261.1|131676_131952_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS06262.1|131870_132374_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	1.1e-93
AYS06263.1|132955_133711_+	replication protein	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
AYS06264.1|133886_134162_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS06265.1|134080_134584_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	92.8	1.4e-88
