The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029864	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228157 chromosome, complete genome	4807408	930259	937571	4807408	protease,integrase	Dickeya_phage(16.67%)	6	931510:931524	942689:942703
AYT81340.1|930259_931378_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYT81341.1|931374_933321_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931510:931524	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYT81342.1|933450_933672_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYT81343.1|933995_934316_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYT81344.1|934346_936623_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYT81345.1|937193_937571_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942689:942703	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029864	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228157 chromosome, complete genome	4807408	1008514	1085826	4807408	terminase,transposase,protease,tail,integrase	Salmonella_phage(73.33%)	93	990580:990599	1061187:1061206
990580:990599	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT81395.1|1008514_1009855_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYT81396.1|1009851_1010100_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYT81397.1|1010140_1010386_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYT81398.1|1010385_1011267_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYT81399.1|1011263_1012328_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYT81400.1|1012405_1013086_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYT81401.1|1013082_1013868_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYT81402.1|1013873_1014170_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYT81403.1|1014260_1014461_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYT81404.1|1014749_1015154_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYT81405.1|1015485_1015860_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYT81406.1|1015944_1016928_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYT81407.1|1016930_1017680_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYT81408.1|1017690_1018038_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYT81409.1|1018034_1018559_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYT81410.1|1018558_1019032_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYT81411.1|1019035_1019608_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYT81412.1|1019701_1019968_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYT81413.1|1020049_1020211_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT81414.1|1020643_1021141_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT81415.1|1021325_1021565_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYT81416.1|1021554_1021860_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYT81417.1|1021899_1022502_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYT81418.1|1022710_1023322_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYT81419.1|1023454_1024252_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYT81420.1|1024650_1024776_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT81421.1|1024911_1025361_-	lipoprotein	NA	NA	NA	NA	NA
AYT81422.1|1025577_1025967_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYT81423.1|1025953_1026235_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYT81424.1|1026234_1026849_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYT81425.1|1027067_1027322_+	hypothetical protein	NA	NA	NA	NA	NA
AYT81426.1|1027426_1027804_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYT81427.1|1027867_1028128_+	hypothetical protein	NA	NA	NA	NA	NA
AYT81428.1|1028217_1028970_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYT81429.1|1028935_1030339_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYT81430.1|1030338_1031808_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYT81431.1|1031899_1032430_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYT81432.1|1032444_1033677_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYT81433.1|1033681_1034179_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYT81434.1|1034190_1035132_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYT81435.1|1035173_1035542_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYT81436.1|1035507_1035915_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYT81437.1|1035911_1036466_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYT81438.1|1036452_1036842_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYT81439.1|1036816_1037380_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYT81440.1|1037383_1038529_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYT81441.1|1038540_1038981_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYT81442.1|1038984_1039437_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYT81443.1|1039614_1041567_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYT81444.1|1041566_1042217_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYT81445.1|1042220_1042523_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYT81446.1|1042525_1043557_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYT81447.1|1043553_1043889_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYT81448.1|1044083_1044815_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT81449.1|1044814_1045243_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT81450.1|1045301_1046057_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYT81451.1|1046144_1046282_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYT81452.1|1046297_1046651_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYT81453.1|1046651_1047851_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYT81454.1|1047847_1048528_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYT81455.1|1048527_1050039_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYT81456.1|1050053_1050572_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYT81457.1|1051493_1052195_-	hypothetical protein	NA	NA	NA	NA	NA
AYT81458.1|1052507_1052786_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYT81459.1|1053211_1055824_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYT81460.1|1056031_1057042_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYT81461.1|1057204_1057750_+	hypothetical protein	NA	NA	NA	NA	NA
AYT81462.1|1057746_1058856_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYT81463.1|1058954_1061063_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYT81464.1|1061075_1062983_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061187:1061206	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT81465.1|1062997_1064251_+	inner membrane protein	NA	NA	NA	NA	NA
AYT81466.1|1064255_1065896_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYT81467.1|1065892_1066456_+	lipoprotein	NA	NA	NA	NA	NA
AYT81468.1|1066709_1066877_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYT81469.1|1066976_1067495_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYT81470.1|1067563_1069324_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYT81471.1|1069509_1069962_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYT81472.1|1070033_1071086_-	outer membrane protein A	NA	NA	NA	NA	NA
AYT81473.1|1071440_1071950_-	cell division inhibitor	NA	NA	NA	NA	NA
AYT81474.1|1072166_1072772_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYT81475.1|1072758_1074912_-	inner membrane protein	NA	NA	NA	NA	NA
AYT81476.1|1074930_1075377_-	hypothetical protein	NA	NA	NA	NA	NA
AYT81477.1|1075500_1077555_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYT81478.1|1077590_1078049_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYT81479.1|1078143_1078806_-	hypothetical protein	NA	NA	NA	NA	NA
AYT81480.1|1078976_1079393_+	hypothetical protein	NA	NA	NA	NA	NA
AYT81481.1|1079437_1079755_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYT81482.1|1079812_1081024_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYT81483.1|1082155_1082614_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT81484.1|1083350_1083632_+	acylphosphatase	NA	NA	NA	NA	NA
AYT81485.1|1083628_1083958_-	sulfite reductase	NA	NA	NA	NA	NA
AYT81486.1|1084044_1084704_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYT81487.1|1085367_1085826_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029864	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228157 chromosome, complete genome	4807408	1528644	1602214	4807408	transposase,tRNA,protease,tail,head,plate	Burkholderia_virus(42.11%)	81	NA	NA
AYT81886.1|1528644_1529103_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT81887.1|1529605_1529887_+	stress response protein	NA	NA	NA	NA	NA
AYT81888.1|1530155_1530977_+|protease	serine protease	protease	NA	NA	NA	NA
AYT81889.1|1531011_1531341_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYT81890.1|1531327_1531690_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYT81891.1|1531801_1531972_-	hypothetical protein	NA	NA	NA	NA	NA
AYT81892.1|1532106_1533141_+	hypothetical protein	NA	NA	NA	NA	NA
AYT81893.1|1533315_1534704_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYT81894.1|1534714_1536244_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYT81895.1|1536770_1537715_+	hypothetical protein	NA	NA	NA	NA	NA
AYT81896.1|1537896_1538286_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYT81897.1|1538257_1538710_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYT81898.1|1538904_1539135_-	hypothetical protein	NA	NA	NA	NA	NA
AYT81899.1|1539131_1539815_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYT81900.1|1539811_1540027_-	hypothetical protein	NA	NA	NA	NA	NA
AYT81901.1|1540019_1540403_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYT81902.1|1540399_1540702_-	hypothetical protein	NA	NA	NA	NA	NA
AYT81903.1|1540711_1540984_-	hypothetical protein	NA	NA	NA	NA	NA
AYT81904.1|1541272_1541803_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYT81905.1|1541830_1542100_-	hypothetical protein	NA	NA	NA	NA	NA
AYT81906.1|1542102_1543269_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYT81907.1|1543279_1545049_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYT81908.1|1545226_1545658_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYT81909.1|1545653_1546250_+	hypothetical protein	NA	NA	NA	NA	NA
AYT81910.1|1546493_1546844_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYT81911.1|1547558_1548209_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYT81912.1|1548205_1548532_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYT81913.1|1548531_1548843_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYT81914.1|1548842_1549388_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYT81915.1|1549384_1550980_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYT81916.1|1550979_1552476_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYT81917.1|1552456_1553278_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYT81918.1|1553280_1553739_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYT81919.1|1553953_1555069_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYT81920.1|1555083_1556037_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYT81921.1|1556046_1556385_+	hypothetical protein	NA	NA	NA	NA	NA
AYT81922.1|1556386_1556833_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYT81923.1|1556832_1557297_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYT81924.1|1557293_1557548_+	hypothetical protein	NA	NA	NA	NA	NA
AYT81925.1|1557537_1558965_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYT81926.1|1558964_1559486_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYT81927.1|1559488_1559770_+	hypothetical protein	NA	NA	NA	NA	NA
AYT81928.1|1559867_1560203_+	hypothetical protein	NA	NA	NA	NA	NA
AYT81929.1|1560378_1562844_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYT81930.1|1562843_1563728_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYT81931.1|1563724_1563940_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYT81932.1|1563927_1565082_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYT81933.1|1565078_1565606_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYT81934.1|1565662_1566010_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYT81935.1|1566000_1567104_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYT81936.1|1567096_1567675_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYT81937.1|1567677_1568703_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYT81938.1|1569216_1569834_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYT81939.1|1570327_1570720_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	51.1	6.8e-19
AYT81940.1|1571316_1571889_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYT81941.1|1572169_1573552_+	amino acid permease	NA	NA	NA	NA	NA
AYT81942.1|1573613_1573949_-	hypothetical protein	NA	NA	NA	NA	NA
AYT81943.1|1574075_1574807_+	two-component response regulator	NA	NA	NA	NA	NA
AYT81944.1|1575287_1576439_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYT81945.1|1576591_1578298_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYT81946.1|1578405_1579710_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYT81947.1|1579785_1580715_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYT81948.1|1580711_1582115_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYT81949.1|1582282_1583929_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYT81950.1|1584128_1585304_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYT81951.1|1585406_1586915_+	hypothetical protein	NA	NA	NA	NA	NA
AYT81952.1|1587620_1588622_+	adenosine deaminase	NA	NA	NA	NA	NA
AYT81953.1|1588695_1589811_-	oxidoreductase	NA	NA	NA	NA	NA
AYT81954.1|1589913_1590069_+	hypothetical protein	NA	NA	NA	NA	NA
AYT81955.1|1590367_1590583_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYT81956.1|1590671_1591112_+	hypothetical protein	NA	NA	NA	NA	NA
AYT81957.1|1591188_1591770_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYT81958.1|1591769_1592348_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYT81959.1|1592340_1594362_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYT81960.1|1594362_1595421_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYT81961.1|1595424_1596045_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYT81962.1|1596047_1596740_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYT81963.1|1596739_1597375_+	endonuclease III	NA	NA	NA	NA	NA
AYT81964.1|1597975_1599481_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYT81965.1|1599585_1600191_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYT81966.1|1600939_1602214_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029864	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228157 chromosome, complete genome	4807408	1783251	1787663	4807408		Escherichia_phage(50.0%)	6	NA	NA
AYT82150.1|1783251_1783491_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYT82151.1|1784363_1785173_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYT82152.1|1785245_1785623_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYT82153.1|1785770_1786313_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYT82154.1|1786504_1787233_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYT82155.1|1787249_1787663_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029864	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228157 chromosome, complete genome	4807408	1991517	1998751	4807408		Morganella_phage(33.33%)	7	NA	NA
AYT82346.1|1991517_1992948_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYT82347.1|1993021_1993717_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYT82348.1|1993796_1994108_-	hypothetical protein	NA	NA	NA	NA	NA
AYT82349.1|1994758_1995943_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYT82350.1|1996402_1996615_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYT82351.1|1997060_1998329_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYT82352.1|1998331_1998751_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029864	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228157 chromosome, complete genome	4807408	2105051	2115558	4807408		Enterobacteria_phage(37.5%)	10	NA	NA
AYT82449.1|2105051_2106365_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYT82450.1|2106391_2107471_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYT82451.1|2107475_2108249_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYT82452.1|2108264_2109239_-	reductase RfbI	NA	NA	NA	NA	NA
AYT82453.1|2109244_2109796_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYT82454.1|2109796_2110675_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYT82455.1|2110722_2111622_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYT82456.1|2111621_2112707_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYT82457.1|2113083_2113977_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYT82458.1|2114154_2115558_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029864	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228157 chromosome, complete genome	4807408	2191449	2200620	4807408	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYT82517.1|2191449_2193483_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYT82518.1|2193723_2194182_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYT82519.1|2194353_2194884_+	lipoprotein	NA	NA	NA	NA	NA
AYT82520.1|2194940_2195408_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYT82521.1|2195454_2196174_-	two-component system response regulator	NA	NA	NA	NA	NA
AYT82522.1|2196170_2197856_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYT82523.1|2198078_2198810_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYT82524.1|2198869_2198977_+	hypothetical protein	NA	NA	NA	NA	NA
AYT82525.1|2198957_2199689_-	ABC transporter permease	NA	NA	NA	NA	NA
AYT82526.1|2199672_2200620_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029864	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228157 chromosome, complete genome	4807408	2736056	2749448	4807408	tail	Salmonella_phage(70.0%)	11	NA	NA
AYT82955.1|2736056_2736275_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYT82956.1|2736365_2737466_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT82957.1|2737462_2737948_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT82958.1|2737944_2741022_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYT82959.1|2741014_2741134_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT82960.1|2741148_2741451_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT82961.1|2741505_2742021_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT82962.1|2742030_2743203_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT82963.1|2743345_2743918_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT82964.1|2744595_2745711_+	glycosyltransferase	NA	NA	NA	NA	NA
AYT82965.1|2745791_2749448_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029864	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228157 chromosome, complete genome	4807408	3066927	3110629	4807408	protease,bacteriocin,transposase,tRNA	Bacillus_virus(33.33%)	44	NA	NA
AYT83254.1|3066927_3067386_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT83255.1|3067575_3068655_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYT83256.1|3068756_3069920_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYT83257.1|3069941_3070988_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYT83258.1|3071361_3071787_+	hypothetical protein	NA	NA	NA	NA	NA
AYT83259.1|3071812_3072391_+	hypothetical protein	NA	NA	NA	NA	NA
AYT83260.1|3072424_3073099_+	hypothetical protein	NA	NA	NA	NA	NA
AYT83261.1|3073080_3073764_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYT83262.1|3073757_3074414_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYT83263.1|3074518_3074977_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT83264.1|3075165_3077157_-	transketolase	NA	NA	NA	NA	NA
AYT83265.1|3077432_3078191_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYT83266.1|3078291_3079212_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYT83267.1|3079439_3081416_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYT83268.1|3081424_3081556_-	hypothetical protein	NA	NA	NA	NA	NA
AYT83269.1|3081850_3082150_-	membrane protein	NA	NA	NA	NA	NA
AYT83270.1|3082205_3083360_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYT83271.1|3083852_3085247_+	galactose-proton symport	NA	NA	NA	NA	NA
AYT83272.1|3085325_3085823_+	hypothetical protein	NA	NA	NA	NA	NA
AYT83273.1|3085918_3086626_+	endonuclease I	NA	NA	NA	NA	NA
AYT83274.1|3086702_3087434_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYT83275.1|3087453_3088401_+	glutathione synthetase	NA	NA	NA	NA	NA
AYT83276.1|3088616_3089180_+	hypothetical protein	NA	NA	NA	NA	NA
AYT83277.1|3089179_3089596_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYT83278.1|3089642_3090329_-	global regulatory protein	NA	NA	NA	NA	NA
AYT83279.1|3090458_3091439_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYT83280.1|3091456_3092161_+	hypothetical protein	NA	NA	NA	NA	NA
AYT83281.1|3092179_3092746_+	hypothetical protein	NA	NA	NA	NA	NA
AYT83282.1|3092742_3093033_+	hypothetical protein	NA	NA	NA	NA	NA
AYT83283.1|3093040_3093634_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYT83284.1|3093626_3094763_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYT83285.1|3094853_3095861_-	hypothetical protein	NA	NA	NA	NA	NA
AYT83286.1|3095993_3097040_-	L-asparaginase	NA	NA	NA	NA	NA
AYT83287.1|3097358_3097817_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT83288.1|3097938_3098658_-	hypothetical protein	NA	NA	NA	NA	NA
AYT83289.1|3098707_3099034_-	hypothetical protein	NA	NA	NA	NA	NA
AYT83290.1|3099033_3099753_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYT83291.1|3099907_3100960_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYT83292.1|3100987_3101263_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYT83293.1|3101375_3102461_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYT83294.1|3102677_3103934_+	nucleoside permease	NA	NA	NA	NA	NA
AYT83295.1|3106544_3107252_+	hypothetical protein	NA	NA	NA	NA	NA
AYT83296.1|3109841_3110108_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYT83297.1|3110350_3110629_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029864	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228157 chromosome, complete genome	4807408	3488860	3526918	4807408	capsid,terminase,transposase,plate,tail,portal,integrase	Salmonella_phage(82.05%)	46	3483824:3483838	3495990:3496004
3483824:3483838	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYT83626.1|3488860_3490507_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYT83627.1|3490646_3490745_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYT83628.1|3491000_3491330_+	hypothetical protein	NA	NA	NA	NA	NA
AYT83629.1|3491370_3492423_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYT83630.1|3492818_3493388_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYT83631.1|3493513_3493735_+	hypothetical protein	NA	NA	NA	NA	NA
AYT83632.1|3493767_3494277_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYT83633.1|3494451_3494676_+	hypothetical protein	NA	NA	NA	NA	NA
AYT83634.1|3494698_3495040_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYT83635.1|3495107_3495341_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYT83636.1|3495340_3495568_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYT83637.1|3495564_3496422_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3495990:3496004	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYT83638.1|3496418_3498833_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYT83639.1|3498986_3499175_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYT83640.1|3501142_3502057_+	hypothetical protein	NA	NA	NA	NA	NA
AYT83641.1|3502053_3502794_+	hypothetical protein	NA	NA	NA	NA	NA
AYT83642.1|3502828_3503866_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYT83643.1|3503865_3505632_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYT83644.1|3505774_3506608_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYT83645.1|3506624_3507683_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYT83646.1|3507686_3508337_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYT83647.1|3508369_3508897_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYT83648.1|3508896_3509100_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYT83649.1|3509103_3509319_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYT83650.1|3509338_3509812_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYT83651.1|3509813_3510191_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYT83652.1|3510187_3510616_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYT83653.1|3510711_3511143_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYT83654.1|3511135_3511582_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYT83655.1|3511650_3512229_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYT83656.1|3512225_3512585_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYT83657.1|3512571_3513480_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYT83658.1|3513472_3514078_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT83659.1|3514074_3515589_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYT83660.1|3515588_3516182_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYT83661.1|3516153_3516594_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYT83662.1|3517016_3517589_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT83663.1|3517731_3518904_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT83664.1|3518913_3519429_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT83665.1|3519483_3519786_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT83666.1|3519800_3519920_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT83667.1|3519912_3522990_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYT83668.1|3522986_3523472_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT83669.1|3523468_3524569_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT83670.1|3524659_3524878_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYT83671.1|3526459_3526918_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029864	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228157 chromosome, complete genome	4807408	3793280	3810689	4807408	transposase,integrase	Escherichia_phage(30.0%)	17	3791536:3791595	3815486:3816253
3791536:3791595	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
AYT83890.1|3793280_3796247_-|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYT83891.1|3796249_3796810_-	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYT83892.1|3796935_3797499_-	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYT83893.1|3797488_3798502_-|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYT83894.1|3798533_3799133_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	31.4	3.1e-15
AYT83895.1|3799329_3799710_+	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYT83896.1|3799616_3800543_+	sulfonamide-resistant dihydropteroate synthase sul1	NA	NA	NA	NA	NA
AYT83897.1|3800776_3801499_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYT83898.1|3801531_3801798_+	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
AYT83899.1|3801980_3802841_+	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AYT83900.1|3803420_3804143_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYT83901.1|3804203_3805040_-	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYT83902.1|3805039_3805843_-	streptomycin phosphotransferase	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
AYT83903.1|3805903_3806719_-	dihydropteroate synthase	NA	NA	NA	NA	NA
AYT83904.1|3807026_3807878_-	replication protein	NA	NA	NA	NA	NA
AYT83905.1|3808633_3809356_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYT83906.1|3809384_3810689_-|integrase	integrase	integrase	NA	NA	NA	NA
3815486:3816253	attR	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAATGGCGGAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAGCAGAGATAGCGCTGATGTCCGGCGGTGCTTTTGCCGTTACGCACCACCCCGTCAGTAGCTGAACAGGAGGGACAGCTGATAGAAACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACC	NA	NA	NA	NA
>prophage 12
CP029864	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228157 chromosome, complete genome	4807408	4467067	4541324	4807408	capsid,terminase,plate,tail,portal,integrase	Salmonella_phage(82.98%)	76	4528568:4528584	4541483:4541499
AYT84470.1|4467067_4469017_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYT84471.1|4469088_4469997_+	hypothetical protein	NA	NA	NA	NA	NA
AYT84472.1|4470070_4470970_+	hypothetical protein	NA	NA	NA	NA	NA
AYT84473.1|4471011_4471371_+	hypothetical protein	NA	NA	NA	NA	NA
AYT84474.1|4471470_4471740_-	hypothetical protein	NA	NA	NA	NA	NA
AYT84475.1|4471871_4473146_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYT84476.1|4473365_4473743_+	hypothetical protein	NA	NA	NA	NA	NA
AYT84477.1|4473829_4474048_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYT84478.1|4474115_4475216_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYT84479.1|4475212_4475698_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYT84480.1|4475697_4478478_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYT84481.1|4478470_4478590_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYT84482.1|4478604_4478907_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYT84483.1|4478961_4479477_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYT84484.1|4479486_4480659_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYT84485.1|4481193_4481916_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYT84486.1|4482113_4482521_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYT84487.1|4482527_4484147_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYT84488.1|4484143_4484749_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT84489.1|4484741_4485650_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYT84490.1|4485636_4485996_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYT84491.1|4485992_4486571_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYT84492.1|4486639_4487086_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYT84493.1|4487078_4487510_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYT84494.1|4487605_4488031_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYT84495.1|4488030_4488408_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYT84496.1|4488412_4488883_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYT84497.1|4488902_4489118_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYT84498.1|4489121_4489325_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYT84499.1|4489324_4489789_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYT84500.1|4489882_4490533_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYT84501.1|4490536_4491601_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYT84502.1|4491617_4492451_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYT84503.1|4492593_4494360_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYT84504.1|4494356_4495403_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYT84505.1|4495451_4496147_-	hypothetical protein	NA	NA	NA	NA	NA
AYT84506.1|4496166_4497231_-	hypothetical protein	NA	NA	NA	NA	NA
AYT84507.1|4497227_4498292_-	hypothetical protein	NA	NA	NA	NA	NA
AYT84508.1|4499216_4499546_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYT84509.1|4499542_4501612_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYT84510.1|4501602_4502463_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYT84511.1|4502459_4503044_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYT84512.1|4503040_4503268_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYT84513.1|4503267_4503501_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYT84514.1|4503568_4503910_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYT84515.1|4503873_4504074_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYT84516.1|4504081_4504591_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYT84517.1|4504623_4504866_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYT84518.1|4504982_4505615_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYT84519.1|4505618_4506644_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYT84520.1|4506750_4507104_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYT84521.1|4507720_4508008_+	hypothetical protein	NA	NA	NA	NA	NA
AYT84522.1|4508018_4508909_+	methyltransferase	NA	NA	NA	NA	NA
AYT84523.1|4508908_4509655_+	hypothetical protein	NA	NA	NA	NA	NA
AYT84524.1|4509956_4511927_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT84525.1|4511946_4513251_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT84526.1|4513273_4513969_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYT84527.1|4513994_4514789_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT84528.1|4514798_4515866_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT84529.1|4515910_4517647_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYT84530.1|4517646_4520142_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT84531.1|4520165_4521212_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYT84532.1|4521214_4522492_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYT84533.1|4522736_4523276_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT84534.1|4524129_4525641_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYT84535.1|4525624_4527214_+	hypothetical protein	NA	NA	NA	NA	NA
AYT84536.1|4527377_4528391_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4528568:4528584	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYT84537.1|4528817_4529111_+	hypothetical protein	NA	NA	NA	NA	NA
AYT84538.1|4529107_4529596_+	hypothetical protein	NA	NA	NA	NA	NA
AYT84539.1|4529775_4530228_-	hypothetical protein	NA	NA	NA	NA	NA
AYT84540.1|4535450_4535912_+	hypothetical protein	NA	NA	NA	NA	NA
AYT84541.1|4535908_4536130_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYT84542.1|4536986_4537769_+	hypothetical protein	NA	NA	NA	NA	NA
AYT84543.1|4538395_4538620_-	hypothetical protein	NA	NA	NA	NA	NA
AYT84544.1|4538749_4539754_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYT84545.1|4540064_4541324_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4541483:4541499	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 13
CP029864	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228157 chromosome, complete genome	4807408	4683576	4693835	4807408	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYT84682.1|4683576_4684653_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYT84683.1|4684649_4685723_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYT84684.1|4685697_4686861_-	hypothetical protein	NA	NA	NA	NA	NA
AYT84685.1|4687136_4687703_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYT84686.1|4687718_4687958_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYT84687.1|4687961_4688822_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYT84688.1|4689244_4689568_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYT84689.1|4689551_4690052_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYT84690.1|4690048_4690276_+	hypothetical protein	NA	NA	NA	NA	NA
AYT84691.1|4690272_4690593_+	P4 phage protein	NA	NA	NA	NA	NA
AYT84692.1|4690607_4691282_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYT84693.1|4691278_4692940_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYT84694.1|4693676_4693835_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029865	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228157 plasmid pHCM2, complete sequence	106706	394	33365	106706		Salmonella_phage(100.0%)	34	NA	NA
AYT84785.1|394_952_-	hypothetical protein	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AYT84786.1|961_1381_-	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
AYT84787.1|1444_2089_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AYT84788.1|2088_2565_-	hypothetical protein	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AYT84789.1|2561_2975_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AYT84790.1|2976_4092_-	putative thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
AYT84791.1|4207_5137_-	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
AYT84792.1|5219_6362_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
AYT84793.1|6469_8785_-	ribonucleotide-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AYT84794.1|8862_9432_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
AYT84795.1|9444_10191_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
AYT84796.1|10180_12097_-	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AYT84797.1|12093_12330_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AYT84798.1|12326_13412_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
AYT84799.1|13838_14144_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.0	2.0e-50
AYT84800.1|14175_14670_-	hypothetical protein	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
AYT84801.1|14745_15390_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
AYT84802.1|16134_17190_+	putative replication protein A	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
AYT84803.1|17718_17922_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
AYT84804.1|17921_18227_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
AYT84805.1|18267_18543_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
AYT84806.1|18611_19022_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
AYT84807.1|19005_19377_-	hypothetical protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
AYT84808.1|19539_20382_-	putative lipoprotein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
AYT84809.1|20677_21754_-	putative recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AYT84810.1|21756_22023_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYT84811.1|22022_22967_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
AYT84812.1|23027_24056_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
AYT84813.1|24175_24607_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
AYT84814.1|24852_25443_+	hypothetical protein	NA	NA	NA	NA	NA
AYT84815.1|25536_25980_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.0e-71
AYT84816.1|25976_29495_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
AYT84817.1|29675_30911_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
AYT84818.1|31007_33365_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	90.7	0.0e+00
>prophage 2
CP029865	Salmonella enterica subsp. enterica serovar Typhi strain 343077_228157 plasmid pHCM2, complete sequence	106706	41855	106606	106706	tail	Salmonella_phage(93.51%)	79	NA	NA
AYT84831.1|41855_42161_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
AYT84832.1|42157_42310_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
AYT84833.1|42309_42516_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
AYT84834.1|42681_44004_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
AYT84835.1|44038_44296_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
AYT84836.1|44596_45391_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
AYT84837.1|45574_46627_+	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
AYT84838.1|46628_47840_-	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
AYT84839.1|47902_49243_-	putative DNA helicase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
AYT84840.1|49303_50029_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
AYT84841.1|50306_51362_+	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
AYT84842.1|51431_52187_-	hypothetical protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
AYT84843.1|52235_52595_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AYT84844.1|52594_53260_-	hypothetical protein	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
AYT84845.1|53590_54142_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
AYT84846.1|54192_54537_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.6	5.9e-27
AYT84847.1|54605_55325_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	1.5e-125
AYT84848.1|55311_55635_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
AYT84849.1|55749_58302_-	hypothetical protein	NA	A0A0A0YQM3	Citrobacter_virus	52.5	1.4e-152
AYT84850.1|58384_62773_-|tail	putative phage tail protein	tail	J9Q713	Salmonella_phage	86.7	0.0e+00
AYT84851.1|62787_63375_-|tail	putative phage tail protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
AYT84852.1|63362_64160_-	hypothetical protein	NA	J9Q7R4	Salmonella_phage	95.8	1.2e-155
AYT84853.1|64152_64884_-|tail	putative phage tail protein	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
AYT84854.1|64940_65276_-	hypothetical protein	NA	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AYT84855.1|65317_69901_-	hypothetical protein	NA	J9Q712	Salmonella_phage	92.9	0.0e+00
AYT84856.1|69908_70178_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AYT84857.1|70258_70576_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYT84858.1|70635_71382_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
AYT84859.1|71456_71840_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AYT84860.1|71841_72315_-	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AYT84861.1|72305_72650_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AYT84862.1|72747_73581_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
AYT84863.1|73580_74015_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
AYT84864.1|74058_74982_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
AYT84865.1|75056_75932_-	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
AYT84866.1|75958_76855_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
AYT84867.1|76877_78452_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
AYT84868.1|78485_79742_-	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
AYT84869.1|79744_80386_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.5	1.8e-109
AYT84870.1|80581_80848_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AYT84871.1|80857_81757_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
AYT84872.1|81753_82008_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AYT84873.1|82000_82639_-	putative ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	99.1	5.5e-111
AYT84874.1|82635_83304_-	hypothetical protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
AYT84875.1|83303_83984_-	hypothetical protein	NA	J9Q756	Salmonella_phage	99.6	7.4e-122
AYT84876.1|84066_85626_+	putative helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
AYT84877.1|85628_85907_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AYT84878.1|85966_86389_+	putative lipoprotein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
AYT84879.1|86393_86921_+	putative transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
AYT84880.1|87555_88206_+	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
AYT84881.1|88290_88518_+	hypothetical protein	NA	NA	NA	NA	NA
AYT84882.1|89149_89632_-	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
AYT84883.1|89837_90125_-	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
AYT84884.1|90245_90638_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
AYT84885.1|90766_91078_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
AYT84886.1|91154_91469_-	hypothetical protein	NA	NA	NA	NA	NA
AYT84887.1|91563_91782_-	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AYT84888.1|91792_92008_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
AYT84889.1|92150_92396_+	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
AYT84890.1|93832_95023_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
AYT84891.1|95032_95350_-	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
AYT84892.1|95434_95716_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
AYT84893.1|95889_96093_+	hypothetical protein	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
AYT84894.1|96153_96441_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
AYT84895.1|96437_96746_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
AYT84896.1|96757_97300_-	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
AYT84897.1|97296_97938_-	hypothetical protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
AYT84898.1|98029_98401_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
AYT84899.1|98511_98685_-	hypothetical protein	NA	J9Q801	Salmonella_phage	98.2	9.5e-26
AYT84900.1|98681_99371_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
AYT84901.1|99429_101133_-	putative DNA modification methylase	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
AYT84902.1|101256_101829_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AYT84903.1|101937_102780_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AYT84904.1|102888_103077_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AYT84905.1|103086_103581_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
AYT84906.1|103723_104332_-	putative ribonuclease H	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AYT84907.1|104917_105148_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AYT84908.1|105350_105944_-	hypothetical protein	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
AYT84909.1|106129_106606_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	100.0	1.2e-70
