The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029862	Salmonella enterica subsp. enterica serovar Typhi strain 343077_214162 chromosome, complete genome	4814028	930495	937807	4814028	integrase,protease	Dickeya_phage(16.67%)	6	931746:931760	942925:942939
AYT68441.1|930495_931614_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYT68442.1|931610_933557_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931746:931760	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYT68443.1|933686_933908_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYT68444.1|934231_934552_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYT68445.1|934582_936859_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYT68446.1|937429_937807_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942925:942939	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029862	Salmonella enterica subsp. enterica serovar Typhi strain 343077_214162 chromosome, complete genome	4814028	1008945	1086257	4814028	tail,protease,integrase,terminase,transposase	Salmonella_phage(73.33%)	93	991011:991030	1061618:1061637
991011:991030	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT68496.1|1008945_1010286_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYT68497.1|1010282_1010531_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYT68498.1|1010571_1010817_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYT68499.1|1010816_1011698_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYT68500.1|1011694_1012759_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYT68501.1|1012836_1013517_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYT68502.1|1013513_1014299_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYT68503.1|1014304_1014601_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYT68504.1|1014691_1014892_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYT68505.1|1015180_1015585_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYT68506.1|1015916_1016291_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYT68507.1|1016375_1017359_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYT68508.1|1017361_1018111_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYT68509.1|1018121_1018469_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYT68510.1|1018465_1018990_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYT68511.1|1018989_1019463_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYT68512.1|1019466_1020039_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYT68513.1|1020132_1020399_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYT68514.1|1020480_1020642_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT68515.1|1021074_1021572_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT68516.1|1021756_1021996_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYT68517.1|1021985_1022291_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYT68518.1|1022330_1022933_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYT68519.1|1023141_1023753_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYT68520.1|1023885_1024683_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYT68521.1|1025081_1025207_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT68522.1|1025342_1025792_-	lipoprotein	NA	NA	NA	NA	NA
AYT68523.1|1026008_1026398_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYT68524.1|1026384_1026666_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYT68525.1|1026665_1027280_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYT68526.1|1027498_1027753_+	hypothetical protein	NA	NA	NA	NA	NA
AYT68527.1|1027857_1028235_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYT68528.1|1028298_1028559_+	hypothetical protein	NA	NA	NA	NA	NA
AYT68529.1|1028648_1029401_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYT68530.1|1029366_1030770_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYT68531.1|1030769_1032239_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYT68532.1|1032330_1032861_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYT68533.1|1032875_1034108_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYT68534.1|1034112_1034610_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYT68535.1|1034621_1035563_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYT68536.1|1035604_1035973_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYT68537.1|1035938_1036346_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYT68538.1|1036342_1036897_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYT68539.1|1036883_1037273_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYT68540.1|1037247_1037811_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYT68541.1|1037814_1038960_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYT68542.1|1038971_1039412_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYT68543.1|1039415_1039868_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYT68544.1|1040045_1041998_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYT68545.1|1041997_1042648_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYT68546.1|1042651_1042954_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYT68547.1|1042956_1043988_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYT68548.1|1043984_1044320_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYT68549.1|1044514_1045246_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT68550.1|1045245_1045674_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT68551.1|1045732_1046488_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYT68552.1|1046575_1046713_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYT68553.1|1046728_1047082_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYT68554.1|1047082_1048282_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYT68555.1|1048278_1048959_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYT68556.1|1048958_1050470_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYT68557.1|1050484_1051003_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYT68558.1|1051924_1052626_-	hypothetical protein	NA	NA	NA	NA	NA
AYT68559.1|1052938_1053217_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYT68560.1|1053642_1056255_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYT68561.1|1056462_1057473_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYT68562.1|1057635_1058181_+	hypothetical protein	NA	NA	NA	NA	NA
AYT68563.1|1058177_1059287_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYT68564.1|1059385_1061494_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYT68565.1|1061506_1063414_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061618:1061637	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT68566.1|1063428_1064682_+	inner membrane protein	NA	NA	NA	NA	NA
AYT68567.1|1064686_1066327_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYT68568.1|1066323_1066887_+	lipoprotein	NA	NA	NA	NA	NA
AYT68569.1|1067140_1067308_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYT68570.1|1067407_1067926_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYT68571.1|1067994_1069755_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYT68572.1|1069940_1070393_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYT68573.1|1070464_1071517_-	outer membrane protein A	NA	NA	NA	NA	NA
AYT68574.1|1071871_1072381_-	cell division inhibitor	NA	NA	NA	NA	NA
AYT68575.1|1072597_1073203_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYT68576.1|1073189_1075343_-	inner membrane protein	NA	NA	NA	NA	NA
AYT68577.1|1075361_1075808_-	hypothetical protein	NA	NA	NA	NA	NA
AYT68578.1|1075931_1077986_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYT68579.1|1078021_1078480_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYT68580.1|1078574_1079237_-	hypothetical protein	NA	NA	NA	NA	NA
AYT68581.1|1079407_1079824_+	hypothetical protein	NA	NA	NA	NA	NA
AYT68582.1|1079868_1080186_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYT68583.1|1080243_1081455_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYT68584.1|1082586_1083045_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT68585.1|1083781_1084063_+	acylphosphatase	NA	NA	NA	NA	NA
AYT68586.1|1084059_1084389_-	sulfite reductase	NA	NA	NA	NA	NA
AYT68587.1|1084475_1085135_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYT68588.1|1085798_1086257_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029862	Salmonella enterica subsp. enterica serovar Typhi strain 343077_214162 chromosome, complete genome	4814028	1529075	1602645	4814028	tail,tRNA,head,plate,protease,transposase	Burkholderia_virus(42.11%)	81	NA	NA
AYT68988.1|1529075_1529534_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT68989.1|1530036_1530318_+	stress response protein	NA	NA	NA	NA	NA
AYT68990.1|1530586_1531408_+|protease	serine protease	protease	NA	NA	NA	NA
AYT68991.1|1531442_1531772_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYT68992.1|1531758_1532121_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYT68993.1|1532232_1532403_-	hypothetical protein	NA	NA	NA	NA	NA
AYT68994.1|1532537_1533572_+	hypothetical protein	NA	NA	NA	NA	NA
AYT68995.1|1533746_1535135_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYT68996.1|1535145_1536675_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYT68997.1|1537201_1538146_+	hypothetical protein	NA	NA	NA	NA	NA
AYT68998.1|1538327_1538717_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYT68999.1|1538688_1539141_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYT69000.1|1539335_1539566_-	hypothetical protein	NA	NA	NA	NA	NA
AYT69001.1|1539562_1540246_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYT69002.1|1540242_1540458_-	hypothetical protein	NA	NA	NA	NA	NA
AYT69003.1|1540450_1540834_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYT69004.1|1540830_1541133_-	hypothetical protein	NA	NA	NA	NA	NA
AYT69005.1|1541142_1541415_-	hypothetical protein	NA	NA	NA	NA	NA
AYT69006.1|1541703_1542234_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYT69007.1|1542261_1542531_-	hypothetical protein	NA	NA	NA	NA	NA
AYT69008.1|1542533_1543700_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYT69009.1|1543710_1545480_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYT69010.1|1545657_1546089_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYT69011.1|1546084_1546681_+	hypothetical protein	NA	NA	NA	NA	NA
AYT69012.1|1546924_1547275_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYT69013.1|1547989_1548640_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYT69014.1|1548636_1548963_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYT69015.1|1548962_1549274_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYT69016.1|1549273_1549819_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYT69017.1|1549815_1551411_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYT69018.1|1551410_1552907_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYT69019.1|1552887_1553709_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYT69020.1|1553711_1554170_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYT69021.1|1554384_1555500_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYT69022.1|1555514_1556468_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYT69023.1|1556477_1556816_+	hypothetical protein	NA	NA	NA	NA	NA
AYT69024.1|1556817_1557264_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYT69025.1|1557263_1557728_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYT69026.1|1557724_1557979_+	hypothetical protein	NA	NA	NA	NA	NA
AYT69027.1|1557968_1559396_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYT69028.1|1559395_1559917_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYT69029.1|1559919_1560201_+	hypothetical protein	NA	NA	NA	NA	NA
AYT69030.1|1560298_1560634_+	hypothetical protein	NA	NA	NA	NA	NA
AYT69031.1|1560809_1563275_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYT69032.1|1563274_1564159_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYT69033.1|1564155_1564371_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYT69034.1|1564358_1565513_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYT69035.1|1565509_1566037_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYT69036.1|1566093_1566441_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYT69037.1|1566431_1567535_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYT69038.1|1567527_1568106_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYT69039.1|1568108_1569134_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYT69040.1|1569185_1569620_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	45.4	3.8e-23
AYT69041.1|1569619_1570237_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYT69042.1|1571747_1572320_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYT69043.1|1572600_1573983_+	amino acid permease	NA	NA	NA	NA	NA
AYT69044.1|1574044_1574380_-	hypothetical protein	NA	NA	NA	NA	NA
AYT69045.1|1574506_1575238_+	two-component response regulator	NA	NA	NA	NA	NA
AYT69046.1|1575718_1576870_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYT69047.1|1577022_1578729_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYT69048.1|1578836_1580141_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYT69049.1|1580216_1581146_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYT69050.1|1581142_1582546_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYT69051.1|1582713_1584360_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYT69052.1|1584559_1585735_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYT69053.1|1585837_1587346_+	hypothetical protein	NA	NA	NA	NA	NA
AYT69054.1|1588051_1589053_+	adenosine deaminase	NA	NA	NA	NA	NA
AYT69055.1|1589126_1590242_-	oxidoreductase	NA	NA	NA	NA	NA
AYT69056.1|1590344_1590500_+	hypothetical protein	NA	NA	NA	NA	NA
AYT69057.1|1590798_1591014_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYT69058.1|1591102_1591543_+	hypothetical protein	NA	NA	NA	NA	NA
AYT69059.1|1591619_1592201_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYT69060.1|1592200_1592779_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYT69061.1|1592771_1594793_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYT69062.1|1594793_1595852_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYT69063.1|1595855_1596476_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYT69064.1|1596478_1597171_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYT69065.1|1597170_1597806_+	endonuclease III	NA	NA	NA	NA	NA
AYT69066.1|1598406_1599912_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYT69067.1|1600016_1600622_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYT69068.1|1601370_1602645_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029862	Salmonella enterica subsp. enterica serovar Typhi strain 343077_214162 chromosome, complete genome	4814028	1783682	1788094	4814028		Escherichia_phage(50.0%)	6	NA	NA
AYT69252.1|1783682_1783922_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYT69253.1|1784794_1785604_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYT69254.1|1785676_1786054_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYT69255.1|1786201_1786744_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYT69256.1|1786935_1787664_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYT69257.1|1787680_1788094_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029862	Salmonella enterica subsp. enterica serovar Typhi strain 343077_214162 chromosome, complete genome	4814028	1991947	1999181	4814028		Morganella_phage(33.33%)	7	NA	NA
AYT69447.1|1991947_1993378_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYT69448.1|1993451_1994147_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYT69449.1|1994226_1994538_-	hypothetical protein	NA	NA	NA	NA	NA
AYT69450.1|1995188_1996373_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYT69451.1|1996832_1997045_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYT69452.1|1997490_1998759_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYT69453.1|1998761_1999181_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029862	Salmonella enterica subsp. enterica serovar Typhi strain 343077_214162 chromosome, complete genome	4814028	2105481	2115988	4814028		Enterobacteria_phage(37.5%)	10	NA	NA
AYT69550.1|2105481_2106795_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYT69551.1|2106821_2107901_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYT69552.1|2107905_2108679_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYT69553.1|2108694_2109669_-	reductase RfbI	NA	NA	NA	NA	NA
AYT69554.1|2109674_2110226_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYT69555.1|2110226_2111105_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYT69556.1|2111152_2112052_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYT69557.1|2112051_2113137_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYT69558.1|2113513_2114407_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYT69559.1|2114584_2115988_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029862	Salmonella enterica subsp. enterica serovar Typhi strain 343077_214162 chromosome, complete genome	4814028	2191879	2201050	4814028	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYT69618.1|2191879_2193913_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYT69619.1|2194153_2194612_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYT69620.1|2194783_2195314_+	lipoprotein	NA	NA	NA	NA	NA
AYT69621.1|2195370_2195838_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYT69622.1|2195884_2196604_-	two-component system response regulator	NA	NA	NA	NA	NA
AYT69623.1|2196600_2198286_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYT69624.1|2198508_2199240_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYT69625.1|2199299_2199407_+	hypothetical protein	NA	NA	NA	NA	NA
AYT69626.1|2199387_2200119_-	ABC transporter permease	NA	NA	NA	NA	NA
AYT69627.1|2200102_2201050_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029862	Salmonella enterica subsp. enterica serovar Typhi strain 343077_214162 chromosome, complete genome	4814028	2736487	2749879	4814028	tail	Salmonella_phage(70.0%)	11	NA	NA
AYT70056.1|2736487_2736706_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYT70057.1|2736796_2737897_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT70058.1|2737893_2738379_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT70059.1|2738375_2741453_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYT70060.1|2741445_2741565_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT70061.1|2741579_2741882_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT70062.1|2741936_2742452_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT70063.1|2742461_2743634_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT70064.1|2743776_2744349_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT70065.1|2745026_2746142_+	glycosyltransferase	NA	NA	NA	NA	NA
AYT70066.1|2746222_2749879_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029862	Salmonella enterica subsp. enterica serovar Typhi strain 343077_214162 chromosome, complete genome	4814028	3066633	3110336	4814028	tRNA,bacteriocin,transposase,protease	Bacillus_virus(33.33%)	44	NA	NA
AYT70353.1|3066633_3067092_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT70354.1|3067281_3068361_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYT70355.1|3068462_3069626_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYT70356.1|3069647_3070694_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYT70357.1|3071067_3071493_+	hypothetical protein	NA	NA	NA	NA	NA
AYT70358.1|3071518_3072097_+	hypothetical protein	NA	NA	NA	NA	NA
AYT70359.1|3072130_3072805_+	hypothetical protein	NA	NA	NA	NA	NA
AYT70360.1|3072786_3073470_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYT70361.1|3073463_3074120_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYT70362.1|3074224_3074683_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT70363.1|3074871_3076863_-	transketolase	NA	NA	NA	NA	NA
AYT70364.1|3077138_3077897_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYT70365.1|3077997_3078918_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYT70366.1|3079145_3081122_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYT70367.1|3081130_3081262_-	hypothetical protein	NA	NA	NA	NA	NA
AYT70368.1|3081556_3081856_-	membrane protein	NA	NA	NA	NA	NA
AYT70369.1|3081911_3083066_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYT70370.1|3083558_3084953_+	galactose-proton symport	NA	NA	NA	NA	NA
AYT70371.1|3085031_3085529_+	hypothetical protein	NA	NA	NA	NA	NA
AYT70372.1|3085624_3086332_+	endonuclease I	NA	NA	NA	NA	NA
AYT70373.1|3086408_3087140_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYT70374.1|3087159_3088107_+	glutathione synthetase	NA	NA	NA	NA	NA
AYT70375.1|3088322_3088886_+	hypothetical protein	NA	NA	NA	NA	NA
AYT70376.1|3088885_3089302_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYT70377.1|3089348_3090035_-	global regulatory protein	NA	NA	NA	NA	NA
AYT70378.1|3090164_3091145_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYT70379.1|3091162_3091867_+	hypothetical protein	NA	NA	NA	NA	NA
AYT70380.1|3091885_3092452_+	hypothetical protein	NA	NA	NA	NA	NA
AYT70381.1|3092448_3092739_+	hypothetical protein	NA	NA	NA	NA	NA
AYT70382.1|3092746_3093340_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYT70383.1|3093332_3094469_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYT70384.1|3094559_3095567_-	hypothetical protein	NA	NA	NA	NA	NA
AYT70385.1|3095699_3096746_-	L-asparaginase	NA	NA	NA	NA	NA
AYT70386.1|3097064_3097523_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT70387.1|3097645_3098365_-	hypothetical protein	NA	NA	NA	NA	NA
AYT70388.1|3098414_3098741_-	hypothetical protein	NA	NA	NA	NA	NA
AYT70389.1|3098740_3099460_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYT70390.1|3099614_3100667_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYT70391.1|3100694_3100970_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYT70392.1|3101082_3102168_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYT70393.1|3102384_3103641_+	nucleoside permease	NA	NA	NA	NA	NA
AYT70394.1|3106251_3106959_+	hypothetical protein	NA	NA	NA	NA	NA
AYT70395.1|3109548_3109815_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYT70396.1|3110057_3110336_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029862	Salmonella enterica subsp. enterica serovar Typhi strain 343077_214162 chromosome, complete genome	4814028	3201256	3245744	4814028	tail,tRNA,capsid,protease,integrase	Cronobacter_phage(68.42%)	49	3202519:3202542	3251655:3251678
AYT70473.1|3201256_3202498_+|tRNA	tRNA nucleotidyltransferase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	47.7	3.2e-91
3202519:3202542	attL	TTGCCTGATGGCGCTGCGCTTATC	NA	NA	NA	NA
AYT70474.1|3202602_3203424_-	bacitracin resistance protein	NA	NA	NA	NA	NA
AYT70475.1|3203521_3203884_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AYT70476.1|3203987_3204599_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AYT70477.1|3204848_3205862_-|protease	glycoprotease	protease	A0A0R6PI74	Moraxella_phage	59.5	6.3e-109
AYT70478.1|3206089_3206305_+	30S ribosomal subunit protein S21	NA	NA	NA	NA	NA
AYT70479.1|3206540_3208286_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.6e-72
AYT70480.1|3208300_3210283_+	RNA polymerase sigma-70 factor	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
AYT70481.1|3210406_3210913_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AYT70482.1|3211225_3211849_+	hypothetical protein	NA	NA	NA	NA	NA
AYT70483.1|3212499_3214203_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	9.9e-224
AYT70484.1|3214202_3214748_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	73.1	1.5e-64
AYT70485.1|3214719_3215445_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.8	2.3e-68
AYT70486.1|3215434_3215962_-	hypothetical protein	NA	A0A0U2QV64	Escherichia_phage	52.6	3.1e-51
AYT70487.1|3215979_3218007_-|tail	tail protein	tail	F1BUK3	Cronobacter_phage	47.7	3.4e-154
AYT70488.1|3218016_3218604_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	2.2e-90
AYT70489.1|3218596_3219781_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.8e-179
AYT70490.1|3219777_3220107_-	hypothetical protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
AYT70491.1|3220103_3222074_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	71.1	6.4e-275
AYT70492.1|3222261_3222519_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
AYT70493.1|3222665_3222998_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	6.7e-36
AYT70494.1|3222997_3223339_-	hypothetical protein	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
AYT70495.1|3223335_3223629_-	hypothetical protein	NA	C7BGD7	Burkholderia_phage	46.2	1.3e-14
AYT70496.1|3223638_3224094_-	phage protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
AYT70497.1|3224090_3225218_-|tail	tail sheath	tail	F1BUL5	Cronobacter_phage	83.7	1.9e-175
AYT70498.1|3225214_3225922_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	77.4	1.0e-102
AYT70499.1|3225918_3226425_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	3.4e-63
AYT70500.1|3226421_3226925_-	hypothetical protein	NA	F1BUL8	Cronobacter_phage	82.7	1.8e-64
AYT70501.1|3226970_3227672_-	hypothetical protein	NA	F1BUM0	Cronobacter_phage	66.8	9.4e-88
AYT70502.1|3227675_3228698_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
AYT70503.1|3228759_3229563_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	1.6e-78
AYT70504.1|3229723_3231499_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.6	5.2e-292
AYT70505.1|3231495_3232557_+	hypothetical protein	NA	F1BUM7	Cronobacter_phage	77.1	2.3e-162
AYT70506.1|3232553_3232877_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
AYT70507.1|3233176_3235198_-	replication protein A	NA	F1BUM9	Cronobacter_phage	75.1	1.7e-299
AYT70508.1|3235194_3236055_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.7	2.2e-131
AYT70509.1|3236045_3236279_-	hypothetical protein	NA	NA	NA	NA	NA
AYT70510.1|3236346_3236748_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
AYT70511.1|3236747_3237173_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
AYT70512.1|3237162_3237390_-	hypothetical protein	NA	NA	NA	NA	NA
AYT70513.1|3237399_3237903_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
AYT70514.1|3237933_3238155_-	hypothetical protein	NA	NA	NA	NA	NA
AYT70515.1|3238298_3238880_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
AYT70516.1|3238896_3239463_+	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
AYT70517.1|3239466_3240504_+|integrase	integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
AYT70518.1|3240493_3242275_+	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
AYT70519.1|3242532_3243300_-	siderophore interacting protein	NA	NA	NA	NA	NA
AYT70520.1|3243534_3244179_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AYT70521.1|3244175_3245744_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	3.8e-12
3251655:3251678	attR	TTGCCTGATGGCGCTGCGCTTATC	NA	NA	NA	NA
>prophage 11
CP029862	Salmonella enterica subsp. enterica serovar Typhi strain 343077_214162 chromosome, complete genome	4814028	3519854	3557912	4814028	transposase,tail,portal,capsid,plate,integrase,terminase	Salmonella_phage(82.05%)	46	3514818:3514832	3526984:3526998
3514818:3514832	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYT70762.1|3519854_3521501_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYT70763.1|3521640_3521739_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYT70764.1|3521994_3522324_+	hypothetical protein	NA	NA	NA	NA	NA
AYT70765.1|3522364_3523417_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYT70766.1|3523812_3524382_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYT70767.1|3524507_3524729_+	hypothetical protein	NA	NA	NA	NA	NA
AYT70768.1|3524761_3525271_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYT70769.1|3525445_3525670_+	hypothetical protein	NA	NA	NA	NA	NA
AYT70770.1|3525692_3526034_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYT70771.1|3526101_3526335_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYT70772.1|3526334_3526562_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYT70773.1|3526558_3527416_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3526984:3526998	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYT70774.1|3527412_3529827_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYT70775.1|3529980_3530169_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYT70776.1|3532136_3533051_+	hypothetical protein	NA	NA	NA	NA	NA
AYT70777.1|3533047_3533788_+	hypothetical protein	NA	NA	NA	NA	NA
AYT70778.1|3533822_3534860_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYT70779.1|3534859_3536626_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYT70780.1|3536768_3537602_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYT70781.1|3537618_3538677_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYT70782.1|3538680_3539331_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYT70783.1|3539363_3539891_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYT70784.1|3539890_3540094_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYT70785.1|3540097_3540313_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYT70786.1|3540332_3540806_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYT70787.1|3540807_3541185_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYT70788.1|3541181_3541610_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYT70789.1|3541705_3542137_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYT70790.1|3542129_3542576_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYT70791.1|3542644_3543223_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYT70792.1|3543219_3543579_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYT70793.1|3543565_3544474_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYT70794.1|3544466_3545072_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT70795.1|3545068_3546583_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.0	4.4e-199
AYT70796.1|3546582_3547176_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYT70797.1|3547147_3547588_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYT70798.1|3548010_3548583_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT70799.1|3548725_3549898_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT70800.1|3549907_3550423_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT70801.1|3550477_3550780_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT70802.1|3550794_3550914_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT70803.1|3550906_3553984_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYT70804.1|3553980_3554466_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT70805.1|3554462_3555563_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT70806.1|3555653_3555872_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYT70807.1|3557453_3557912_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 12
CP029862	Salmonella enterica subsp. enterica serovar Typhi strain 343077_214162 chromosome, complete genome	4814028	4473768	4547932	4814028	tail,portal,capsid,plate,integrase,terminase	Salmonella_phage(82.98%)	76	4535269:4535285	4548091:4548107
AYT71578.1|4473768_4475718_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYT71579.1|4475789_4476698_+	hypothetical protein	NA	NA	NA	NA	NA
AYT71580.1|4476771_4477671_+	hypothetical protein	NA	NA	NA	NA	NA
AYT71581.1|4477712_4478072_+	hypothetical protein	NA	NA	NA	NA	NA
AYT71582.1|4478171_4478441_-	hypothetical protein	NA	NA	NA	NA	NA
AYT71583.1|4478572_4479847_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYT71584.1|4480066_4480444_+	hypothetical protein	NA	NA	NA	NA	NA
AYT71585.1|4480530_4480749_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYT71586.1|4480816_4481917_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYT71587.1|4481913_4482399_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYT71588.1|4482398_4485179_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYT71589.1|4485171_4485291_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYT71590.1|4485305_4485608_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYT71591.1|4485662_4486178_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYT71592.1|4486187_4487360_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYT71593.1|4487894_4488617_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYT71594.1|4488814_4489222_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYT71595.1|4489228_4490848_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYT71596.1|4490844_4491450_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT71597.1|4491442_4492351_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	95.4	7.0e-152
AYT71598.1|4492337_4492697_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYT71599.1|4492693_4493272_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYT71600.1|4493340_4493787_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYT71601.1|4493779_4494211_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYT71602.1|4494306_4494732_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYT71603.1|4494731_4495109_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYT71604.1|4495113_4495584_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYT71605.1|4495603_4495819_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYT71606.1|4495822_4496026_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYT71607.1|4496025_4496490_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYT71608.1|4496583_4497234_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYT71609.1|4497237_4498302_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYT71610.1|4498318_4499152_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYT71611.1|4499294_4501061_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYT71612.1|4501057_4502104_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYT71613.1|4502152_4502848_-	hypothetical protein	NA	NA	NA	NA	NA
AYT71614.1|4502867_4503932_-	hypothetical protein	NA	NA	NA	NA	NA
AYT71615.1|4503928_4504993_-	hypothetical protein	NA	NA	NA	NA	NA
AYT71616.1|4505917_4506247_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYT71617.1|4506243_4508313_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYT71618.1|4508303_4509164_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYT71619.1|4509160_4509745_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYT71620.1|4509741_4509969_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYT71621.1|4509968_4510202_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYT71622.1|4510269_4510611_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYT71623.1|4510574_4510775_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYT71624.1|4510782_4511292_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYT71625.1|4511324_4511567_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYT71626.1|4511683_4512316_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYT71627.1|4512319_4513345_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYT71628.1|4513451_4513805_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYT71629.1|4514421_4514709_+	hypothetical protein	NA	NA	NA	NA	NA
AYT71630.1|4514719_4515610_+	methyltransferase	NA	NA	NA	NA	NA
AYT71631.1|4515609_4516356_+	hypothetical protein	NA	NA	NA	NA	NA
AYT71632.1|4516657_4518628_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT71633.1|4518647_4519952_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT71634.1|4519974_4520670_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYT71635.1|4520695_4521490_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT71636.1|4521499_4522567_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT71637.1|4522611_4524348_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYT71638.1|4524347_4526843_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT71639.1|4526866_4527913_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYT71640.1|4527915_4529193_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYT71641.1|4529437_4529977_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT71642.1|4530830_4532342_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYT71643.1|4532325_4533915_+	hypothetical protein	NA	NA	NA	NA	NA
AYT71644.1|4534078_4535092_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4535269:4535285	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYT71645.1|4535518_4535812_+	hypothetical protein	NA	NA	NA	NA	NA
AYT71646.1|4535808_4536297_+	hypothetical protein	NA	NA	NA	NA	NA
AYT71647.1|4536476_4536929_-	hypothetical protein	NA	NA	NA	NA	NA
AYT71648.1|4542151_4542613_+	hypothetical protein	NA	NA	NA	NA	NA
AYT71649.1|4542609_4542831_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYT71650.1|4543687_4544470_+	hypothetical protein	NA	NA	NA	NA	NA
AYT71651.1|4545096_4545321_-	hypothetical protein	NA	NA	NA	NA	NA
AYT71652.1|4545450_4546362_-	hypothetical protein	NA	NA	NA	NA	NA
AYT71653.1|4546672_4547932_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4548091:4548107	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 13
CP029862	Salmonella enterica subsp. enterica serovar Typhi strain 343077_214162 chromosome, complete genome	4814028	4690184	4700443	4814028	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYT71790.1|4690184_4691261_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYT71791.1|4691257_4692331_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYT71792.1|4692305_4693469_-	hypothetical protein	NA	NA	NA	NA	NA
AYT71793.1|4693744_4694311_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYT71794.1|4694326_4694566_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYT71795.1|4694569_4695430_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYT71796.1|4695852_4696176_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYT71797.1|4696159_4696660_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYT71798.1|4696656_4696884_+	hypothetical protein	NA	NA	NA	NA	NA
AYT71799.1|4696880_4697201_+	P4 phage protein	NA	NA	NA	NA	NA
AYT71800.1|4697215_4697890_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYT71801.1|4697886_4699548_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYT71802.1|4700284_4700443_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
