The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029881	Salmonella enterica subsp. enterica serovar Typhi strain 343076_269157 chromosome, complete genome	4791108	930261	937573	4791108	integrase,protease	Dickeya_phage(16.67%)	6	931512:931526	942691:942705
AYT37958.1|930261_931380_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYT37959.1|931376_933323_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931512:931526	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYT37960.1|933452_933674_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYT37961.1|933997_934318_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYT37962.1|934348_936625_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYT37963.1|937195_937573_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942691:942705	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029881	Salmonella enterica subsp. enterica serovar Typhi strain 343076_269157 chromosome, complete genome	4791108	1008542	1085855	4791108	terminase,protease,tail,integrase,transposase	Salmonella_phage(73.33%)	93	990621:990640	1061216:1061235
990621:990640	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT38013.1|1008542_1009883_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYT38014.1|1009879_1010128_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYT38015.1|1010168_1010414_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYT38016.1|1010413_1011295_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYT38017.1|1011291_1012356_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYT38018.1|1012433_1013114_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYT38019.1|1013110_1013896_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYT38020.1|1013901_1014198_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYT38021.1|1014288_1014489_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYT38022.1|1014777_1015182_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYT38023.1|1015513_1015888_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYT38024.1|1015972_1016956_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYT38025.1|1016958_1017708_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYT38026.1|1017718_1018066_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYT38027.1|1018062_1018587_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYT38028.1|1018586_1019060_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYT38029.1|1019063_1019636_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYT38030.1|1019729_1019996_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYT38031.1|1020077_1020239_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT38032.1|1020671_1021169_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT38033.1|1021353_1021593_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYT38034.1|1021582_1021888_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYT38035.1|1021927_1022530_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYT38036.1|1022738_1023350_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYT38037.1|1023482_1024280_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYT38038.1|1024678_1024804_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT38039.1|1024939_1025389_-	lipoprotein	NA	NA	NA	NA	NA
AYT38040.1|1025605_1025995_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYT38041.1|1025981_1026263_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYT38042.1|1026262_1026877_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYT38043.1|1027096_1027351_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38044.1|1027455_1027833_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYT38045.1|1027896_1028157_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38046.1|1028246_1028999_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYT38047.1|1028964_1030368_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYT38048.1|1030367_1031837_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYT38049.1|1031928_1032459_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYT38050.1|1032473_1033706_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYT38051.1|1033710_1034208_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYT38052.1|1034219_1035161_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYT38053.1|1035202_1035571_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYT38054.1|1035536_1035944_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYT38055.1|1035940_1036495_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYT38056.1|1036481_1036871_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYT38057.1|1036845_1037409_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYT38058.1|1037412_1038558_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYT38059.1|1038569_1039010_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYT38060.1|1039013_1039466_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYT38061.1|1039643_1041596_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYT38062.1|1041595_1042246_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYT38063.1|1042249_1042552_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYT38064.1|1042554_1043586_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYT38065.1|1043582_1043918_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYT38066.1|1044112_1044844_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT38067.1|1044843_1045272_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT38068.1|1045330_1046086_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYT38069.1|1046173_1046311_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYT38070.1|1046326_1046680_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYT38071.1|1046680_1047880_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYT38072.1|1047876_1048557_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYT38073.1|1048556_1050068_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYT38074.1|1050082_1050601_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYT38075.1|1051522_1052224_-	hypothetical protein	NA	NA	NA	NA	NA
AYT38076.1|1052536_1052815_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYT38077.1|1053240_1055853_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYT38078.1|1056060_1057071_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYT38079.1|1057233_1057779_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38080.1|1057775_1058885_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYT38081.1|1058983_1061092_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYT38082.1|1061104_1063012_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061216:1061235	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT38083.1|1063026_1064280_+	inner membrane protein	NA	NA	NA	NA	NA
AYT38084.1|1064284_1065925_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYT38085.1|1065921_1066485_+	lipoprotein	NA	NA	NA	NA	NA
AYT38086.1|1066738_1066906_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYT38087.1|1067005_1067524_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYT38088.1|1067592_1069353_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYT38089.1|1069538_1069991_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYT38090.1|1070062_1071115_-	outer membrane protein A	NA	NA	NA	NA	NA
AYT38091.1|1071469_1071979_-	cell division inhibitor	NA	NA	NA	NA	NA
AYT38092.1|1072195_1072801_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYT38093.1|1072787_1074941_-	inner membrane protein	NA	NA	NA	NA	NA
AYT38094.1|1074959_1075406_-	hypothetical protein	NA	NA	NA	NA	NA
AYT38095.1|1075529_1077584_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYT38096.1|1077619_1078078_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYT38097.1|1078172_1078835_-	hypothetical protein	NA	NA	NA	NA	NA
AYT38098.1|1079005_1079422_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38099.1|1079466_1079784_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYT38100.1|1079841_1081053_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYT38101.1|1082184_1082643_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT38102.1|1083379_1083661_+	acylphosphatase	NA	NA	NA	NA	NA
AYT38103.1|1083657_1083987_-	sulfite reductase	NA	NA	NA	NA	NA
AYT38104.1|1084073_1084733_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYT38105.1|1085396_1085855_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029881	Salmonella enterica subsp. enterica serovar Typhi strain 343076_269157 chromosome, complete genome	4791108	1530410	1603496	4791108	plate,head,protease,tail,tRNA,transposase	Burkholderia_virus(42.11%)	81	NA	NA
AYT38509.1|1530410_1530869_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT38510.1|1531371_1531653_+	stress response protein	NA	NA	NA	NA	NA
AYT38511.1|1531921_1532743_+|protease	serine protease	protease	NA	NA	NA	NA
AYT38512.1|1532777_1533107_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYT38513.1|1533093_1533456_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYT38514.1|1533567_1533738_-	hypothetical protein	NA	NA	NA	NA	NA
AYT38515.1|1533872_1534907_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38516.1|1535081_1536470_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYT38517.1|1536480_1538010_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYT38518.1|1538536_1539481_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38519.1|1539662_1540052_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYT38520.1|1540023_1540476_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYT38521.1|1540670_1540901_-	hypothetical protein	NA	NA	NA	NA	NA
AYT38522.1|1540897_1541581_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYT38523.1|1541577_1541793_-	hypothetical protein	NA	NA	NA	NA	NA
AYT38524.1|1541785_1542169_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYT38525.1|1542165_1542468_-	hypothetical protein	NA	NA	NA	NA	NA
AYT38526.1|1542477_1542750_-	hypothetical protein	NA	NA	NA	NA	NA
AYT38527.1|1543038_1543569_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYT38528.1|1543596_1543866_-	hypothetical protein	NA	NA	NA	NA	NA
AYT38529.1|1543868_1545035_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYT38530.1|1545045_1546815_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYT38531.1|1546992_1547424_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYT38532.1|1547419_1548016_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38533.1|1548259_1548610_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYT38534.1|1549324_1549975_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYT38535.1|1549971_1550298_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYT38536.1|1550297_1550609_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYT38537.1|1550608_1551154_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYT38538.1|1551150_1552746_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYT38539.1|1552745_1554242_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYT38540.1|1554222_1555044_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYT38541.1|1555046_1555505_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYT38542.1|1555719_1556835_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYT38543.1|1556849_1557803_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYT38544.1|1557812_1558151_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38545.1|1558152_1558599_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYT38546.1|1558598_1559063_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYT38547.1|1559059_1559314_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38548.1|1559303_1560731_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYT38549.1|1560730_1561252_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYT38550.1|1561254_1561536_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38551.1|1561633_1561969_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38552.1|1562144_1564610_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYT38553.1|1564609_1565494_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYT38554.1|1565490_1565706_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYT38555.1|1565693_1566848_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYT38556.1|1566844_1567372_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYT38557.1|1567428_1567776_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYT38558.1|1567766_1568870_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYT38559.1|1568862_1569441_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYT38560.1|1569443_1570469_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYT38561.1|1570520_1570955_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	44.9	1.3e-23
AYT38562.1|1570954_1571572_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYT38563.1|1572598_1573171_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYT38564.1|1573451_1574834_+	amino acid permease	NA	NA	NA	NA	NA
AYT38565.1|1574895_1575231_-	hypothetical protein	NA	NA	NA	NA	NA
AYT38566.1|1575357_1576089_+	two-component response regulator	NA	NA	NA	NA	NA
AYT38567.1|1576569_1577721_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYT38568.1|1577873_1579580_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYT38569.1|1579687_1580992_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYT38570.1|1581067_1581997_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYT38571.1|1581993_1583397_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYT38572.1|1583564_1585211_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYT38573.1|1585410_1586586_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYT38574.1|1586688_1588197_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38575.1|1588902_1589904_+	adenosine deaminase	NA	NA	NA	NA	NA
AYT38576.1|1589977_1591093_-	oxidoreductase	NA	NA	NA	NA	NA
AYT38577.1|1591195_1591351_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38578.1|1591649_1591865_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYT38579.1|1591953_1592394_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38580.1|1592470_1593052_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYT38581.1|1593051_1593630_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYT38582.1|1593622_1595644_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYT38583.1|1595644_1596703_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYT38584.1|1596706_1597327_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYT38585.1|1597329_1598022_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYT38586.1|1598021_1598657_+	endonuclease III	NA	NA	NA	NA	NA
AYT38587.1|1599257_1600763_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYT38588.1|1600867_1601473_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYT38589.1|1602221_1603496_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029881	Salmonella enterica subsp. enterica serovar Typhi strain 343076_269157 chromosome, complete genome	4791108	1691002	1754867	4791108	portal,terminase,plate,capsid,tail,tRNA,transposase	Enterobacteria_phage(75.0%)	74	NA	NA
AYT38676.1|1691002_1691752_-	vitamin B12 ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	4.6e-08
AYT38677.1|1691751_1692303_-	glutathione peroxidase	NA	NA	NA	NA	NA
AYT38678.1|1692394_1693375_-	vitamin B12 ABC transporter permease	NA	NA	NA	NA	NA
AYT38679.1|1693582_1693912_-	hypothetical protein	NA	NA	NA	NA	NA
AYT38680.1|1694019_1694382_-	hypothetical protein	NA	NA	NA	NA	NA
AYT38681.1|1694384_1695512_-	Integrase	NA	A0A0M4RTQ0	Salmonella_phage	51.4	7.0e-85
AYT38682.1|1695814_1696093_+	DNA-binding protein	NA	NA	NA	NA	NA
AYT38683.1|1696107_1696446_+	hypothetical protein	NA	A0A0A7NV42	Enterobacteria_phage	82.8	1.1e-46
AYT38684.1|1696456_1696735_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	4.5e-33
AYT38685.1|1696746_1696989_+	hypothetical protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AYT38686.1|1696985_1697099_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	94.6	3.6e-10
AYT38687.1|1697186_1697390_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	82.1	3.3e-25
AYT38688.1|1697386_1697605_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38689.1|1697713_1698103_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38690.1|1698099_1700940_+	Phage replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
AYT38691.1|1701016_1701976_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.3e-177
AYT38692.1|1701980_1702295_+	Plasmid stability protein	NA	A0A0A7NPT5	Enterobacteria_phage	51.4	9.2e-19
AYT38693.1|1702378_1703221_-	hypothetical protein	NA	NA	NA	NA	NA
AYT38694.1|1703260_1703758_-	hypothetical protein	NA	NA	NA	NA	NA
AYT38695.1|1704406_1705453_-|portal	Presumed portal vertex protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
AYT38696.1|1705452_1707204_-|terminase	Phage terminase ATPase subunit	terminase	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
AYT38697.1|1707358_1708195_+|capsid	Phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.2	7.2e-119
AYT38698.1|1708218_1709271_+|capsid	Phage major capsid protein	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	1.5e-198
AYT38699.1|1709316_1710117_+|terminase	Phage terminase endonuclease subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	98.1	7.8e-139
AYT38700.1|1710218_1710713_+	Head completion/stabilization protein	NA	A0A0A7NPU2	Enterobacteria_phage	98.8	3.0e-88
AYT38701.1|1710712_1710913_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
AYT38702.1|1710915_1711239_+	hypothetical protein	NA	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AYT38703.1|1711235_1711628_+	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
AYT38704.1|1711624_1712032_+	hypothetical protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.0	6.5e-65
AYT38705.1|1712169_1712637_+|tail	tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
AYT38706.1|1712620_1713265_+|tail	Phage tail completion protein	tail	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
AYT38707.1|1713261_1713843_+|plate	Baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	8.6e-103
AYT38708.1|1713839_1714190_+|plate	Phage baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AYT38709.1|1714193_1715090_+|plate	Baseplate assembly protein J	plate	A0A0A7NPY5	Enterobacteria_phage	99.0	1.2e-156
AYT38710.1|1715082_1715613_+|tail	Phage tail fiber	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	2.1e-92
AYT38711.1|1715615_1717781_+	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	82.7	0.0e+00
AYT38712.1|1717782_1718310_+|tail	Phage tail fiber	tail	A0A0C4UR05	Shigella_phage	94.9	8.9e-91
AYT38713.1|1718338_1718872_-|tail	Phage tail fiber	tail	C9DGR0	Escherichia_phage	98.9	3.2e-96
AYT38714.1|1718874_1719768_-	hypothetical protein	NA	C9DGR1	Escherichia_phage	99.3	1.1e-178
AYT38715.1|1719899_1720487_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	97.9	2.3e-103
AYT38716.1|1720522_1721011_-|tail	tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
AYT38717.1|1721023_1723831_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	98.1	0.0e+00
AYT38718.1|1723981_1724356_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
AYT38719.1|1724411_1724924_-|tail	tail protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AYT38720.1|1724923_1726108_-|tail	tail protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	3.4e-223
AYT38721.1|1726265_1727369_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	1.1e-194
AYT38722.1|1727533_1728169_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
AYT38723.1|1728165_1729278_-	molybdenum cofactor biosynthesis protein A	NA	NA	NA	NA	NA
AYT38724.1|1729270_1730659_-	Chondro-6-sulfatase	NA	S5VT21	Leptospira_phage	27.4	1.3e-48
AYT38725.1|1730658_1730931_-	His-Xaa-Ser system protein HsxD	NA	NA	NA	NA	NA
AYT38726.1|1731183_1731444_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38727.1|1731634_1731775_+	hok/gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AYT38728.1|1732183_1732483_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AYT38729.1|1732487_1734875_-|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AYT38730.1|1734890_1735874_-|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AYT38731.1|1736175_1736532_-	50S ribosomal subunit protein L20	NA	NA	NA	NA	NA
AYT38732.1|1736582_1736780_-	50S ribosomal subunit protein L35	NA	NA	NA	NA	NA
AYT38733.1|1736875_1737418_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	6.3e-15
AYT38734.1|1737421_1739350_-|tRNA	threonyl-tRNA synthetase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.6e-129
AYT38735.1|1739932_1740061_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38736.1|1740241_1741465_+	O-antigen polymerase	NA	NA	NA	NA	NA
AYT38737.1|1743018_1743333_-	hypothetical protein	NA	NA	NA	NA	NA
AYT38738.1|1743475_1744435_+	outer membrane protein	NA	NA	NA	NA	NA
AYT38739.1|1744483_1745242_-	outer membrane protein	NA	NA	NA	NA	NA
AYT38740.1|1745530_1746463_+	6-phosphofructokinase isozyme	NA	NA	NA	NA	NA
AYT38741.1|1746559_1746850_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38742.1|1746956_1747817_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38743.1|1747859_1748396_-	hypothetical protein	NA	NA	NA	NA	NA
AYT38744.1|1748544_1749213_+	hydrolase	NA	NA	NA	NA	NA
AYT38745.1|1749350_1749950_+	hypothetical protein	NA	NA	NA	NA	NA
AYT38746.1|1750086_1751478_+	sodium:dicarboxylate symporter	NA	NA	NA	NA	NA
AYT38747.1|1751580_1751823_-	cell division activator CedA	NA	NA	NA	NA	NA
AYT38748.1|1752039_1754292_+	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	50.0	1.3e-143
AYT38749.1|1754408_1754867_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 5
CP029881	Salmonella enterica subsp. enterica serovar Typhi strain 343076_269157 chromosome, complete genome	4791108	1823140	1827552	4791108		Escherichia_phage(50.0%)	6	NA	NA
AYT38820.1|1823140_1823380_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AYT38821.1|1824252_1825062_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYT38822.1|1825134_1825512_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYT38823.1|1825659_1826202_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYT38824.1|1826393_1827122_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYT38825.1|1827138_1827552_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 6
CP029881	Salmonella enterica subsp. enterica serovar Typhi strain 343076_269157 chromosome, complete genome	4791108	2031433	2038667	4791108		Morganella_phage(33.33%)	7	NA	NA
AYT39015.1|2031433_2032864_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYT39016.1|2032937_2033633_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYT39017.1|2033712_2034024_-	hypothetical protein	NA	NA	NA	NA	NA
AYT39018.1|2034674_2035859_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYT39019.1|2036318_2036531_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYT39020.1|2036976_2038245_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYT39021.1|2038247_2038667_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 7
CP029881	Salmonella enterica subsp. enterica serovar Typhi strain 343076_269157 chromosome, complete genome	4791108	2122409	2132916	4791108		Enterobacteria_phage(37.5%)	10	NA	NA
AYT39098.1|2122409_2123723_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYT39099.1|2123749_2124829_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYT39100.1|2124833_2125607_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYT39101.1|2125622_2126597_-	reductase RfbI	NA	NA	NA	NA	NA
AYT39102.1|2126602_2127154_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYT39103.1|2127154_2128033_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYT39104.1|2128080_2128980_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYT39105.1|2128979_2130065_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYT39106.1|2130441_2131335_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYT39107.1|2131512_2132916_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 8
CP029881	Salmonella enterica subsp. enterica serovar Typhi strain 343076_269157 chromosome, complete genome	4791108	2753414	2766806	4791108	tail	Salmonella_phage(70.0%)	11	NA	NA
AYT39603.1|2753414_2753633_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYT39604.1|2753723_2754824_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT39605.1|2754820_2755306_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT39606.1|2755302_2758380_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYT39607.1|2758372_2758492_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT39608.1|2758506_2758809_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT39609.1|2758863_2759379_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT39610.1|2759388_2760561_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT39611.1|2760703_2761276_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT39612.1|2761953_2763069_+	glycosyltransferase	NA	NA	NA	NA	NA
AYT39613.1|2763149_2766806_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029881	Salmonella enterica subsp. enterica serovar Typhi strain 343076_269157 chromosome, complete genome	4791108	3084279	3127982	4791108	bacteriocin,tRNA,transposase,protease	Bacillus_virus(33.33%)	44	NA	NA
AYT39901.1|3084279_3084738_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT39902.1|3084927_3086007_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYT39903.1|3086108_3087272_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYT39904.1|3087293_3088340_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYT39905.1|3088713_3089139_+	hypothetical protein	NA	NA	NA	NA	NA
AYT39906.1|3089164_3089743_+	hypothetical protein	NA	NA	NA	NA	NA
AYT39907.1|3089776_3090451_+	hypothetical protein	NA	NA	NA	NA	NA
AYT39908.1|3090432_3091116_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYT39909.1|3091109_3091766_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYT39910.1|3091870_3092329_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT39911.1|3092517_3094509_-	transketolase	NA	NA	NA	NA	NA
AYT39912.1|3094784_3095543_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYT39913.1|3095643_3096564_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYT39914.1|3096791_3098768_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYT39915.1|3098776_3098908_-	hypothetical protein	NA	NA	NA	NA	NA
AYT39916.1|3099202_3099502_-	membrane protein	NA	NA	NA	NA	NA
AYT39917.1|3099557_3100712_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYT39918.1|3101204_3102599_+	galactose-proton symport	NA	NA	NA	NA	NA
AYT39919.1|3102677_3103175_+	hypothetical protein	NA	NA	NA	NA	NA
AYT39920.1|3103270_3103978_+	endonuclease I	NA	NA	NA	NA	NA
AYT39921.1|3104054_3104786_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYT39922.1|3104805_3105753_+	glutathione synthetase	NA	NA	NA	NA	NA
AYT39923.1|3105968_3106532_+	hypothetical protein	NA	NA	NA	NA	NA
AYT39924.1|3106531_3106948_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYT39925.1|3106994_3107681_-	global regulatory protein	NA	NA	NA	NA	NA
AYT39926.1|3107810_3108791_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYT39927.1|3108808_3109513_+	hypothetical protein	NA	NA	NA	NA	NA
AYT39928.1|3109531_3110098_+	hypothetical protein	NA	NA	NA	NA	NA
AYT39929.1|3110094_3110385_+	hypothetical protein	NA	NA	NA	NA	NA
AYT39930.1|3110392_3110986_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYT39931.1|3110978_3112115_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYT39932.1|3112205_3113213_-	hypothetical protein	NA	NA	NA	NA	NA
AYT39933.1|3113345_3114392_-	L-asparaginase	NA	NA	NA	NA	NA
AYT39934.1|3114710_3115169_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT39935.1|3115291_3116011_-	hypothetical protein	NA	NA	NA	NA	NA
AYT39936.1|3116060_3116387_-	hypothetical protein	NA	NA	NA	NA	NA
AYT39937.1|3116386_3117106_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYT39938.1|3117260_3118313_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYT39939.1|3118340_3118616_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYT39940.1|3118728_3119814_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYT39941.1|3120030_3121287_+	nucleoside permease	NA	NA	NA	NA	NA
AYT39942.1|3123897_3124605_+	hypothetical protein	NA	NA	NA	NA	NA
AYT39943.1|3127194_3127461_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYT39944.1|3127703_3127982_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029881	Salmonella enterica subsp. enterica serovar Typhi strain 343076_269157 chromosome, complete genome	4791108	3497286	3535344	4791108	portal,terminase,plate,capsid,tail,integrase,transposase	Salmonella_phage(82.05%)	46	3492250:3492264	3504416:3504430
3492250:3492264	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYT40266.1|3497286_3498933_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYT40267.1|3499072_3499171_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYT40268.1|3499426_3499756_+	hypothetical protein	NA	NA	NA	NA	NA
AYT40269.1|3499796_3500849_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYT40270.1|3501244_3501814_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYT40271.1|3501939_3502161_+	hypothetical protein	NA	NA	NA	NA	NA
AYT40272.1|3502193_3502703_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYT40273.1|3502877_3503102_+	hypothetical protein	NA	NA	NA	NA	NA
AYT40274.1|3503124_3503466_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYT40275.1|3503533_3503767_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYT40276.1|3503766_3503994_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYT40277.1|3503990_3504848_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3504416:3504430	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYT40278.1|3504844_3507259_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYT40279.1|3507412_3507601_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYT40280.1|3509568_3510483_+	hypothetical protein	NA	NA	NA	NA	NA
AYT40281.1|3510479_3511220_+	hypothetical protein	NA	NA	NA	NA	NA
AYT40282.1|3511254_3512292_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYT40283.1|3512291_3514058_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYT40284.1|3514200_3515034_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYT40285.1|3515050_3516109_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYT40286.1|3516112_3516763_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYT40287.1|3516795_3517323_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYT40288.1|3517322_3517526_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYT40289.1|3517529_3517745_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYT40290.1|3517764_3518238_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYT40291.1|3518239_3518617_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYT40292.1|3518613_3519042_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYT40293.1|3519137_3519569_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYT40294.1|3519561_3520008_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYT40295.1|3520076_3520655_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYT40296.1|3520651_3521011_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYT40297.1|3520997_3521906_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYT40298.1|3521898_3522504_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT40299.1|3522500_3524015_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYT40300.1|3524014_3524608_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYT40301.1|3524579_3525020_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYT40302.1|3525442_3526015_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT40303.1|3526157_3527330_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT40304.1|3527339_3527855_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT40305.1|3527909_3528212_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT40306.1|3528226_3528346_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT40307.1|3528338_3531416_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYT40308.1|3531412_3531898_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT40309.1|3531894_3532995_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT40310.1|3533085_3533304_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYT40311.1|3534885_3535344_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029881	Salmonella enterica subsp. enterica serovar Typhi strain 343076_269157 chromosome, complete genome	4791108	4450703	4524973	4791108	portal,plate,terminase,capsid,tail,integrase	Salmonella_phage(82.61%)	75	4512217:4512233	4525132:4525148
AYT41081.1|4450703_4452653_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYT41082.1|4452724_4453633_+	hypothetical protein	NA	NA	NA	NA	NA
AYT41083.1|4453706_4454606_+	hypothetical protein	NA	NA	NA	NA	NA
AYT41084.1|4454647_4455007_+	hypothetical protein	NA	NA	NA	NA	NA
AYT41085.1|4455106_4455376_-	hypothetical protein	NA	NA	NA	NA	NA
AYT41086.1|4455507_4456782_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYT41087.1|4457001_4457379_+	hypothetical protein	NA	NA	NA	NA	NA
AYT41088.1|4457465_4457684_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYT41089.1|4457751_4458852_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYT41090.1|4458848_4459334_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYT41091.1|4459333_4462114_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYT41092.1|4462106_4462226_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYT41093.1|4462240_4462543_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYT41094.1|4462597_4463113_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYT41095.1|4463122_4464295_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYT41096.1|4464829_4465552_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYT41097.1|4465749_4466157_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYT41098.1|4466163_4467783_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYT41099.1|4467779_4468385_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT41100.1|4468377_4469286_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYT41101.1|4469272_4469632_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYT41102.1|4469628_4470207_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYT41103.1|4470275_4470722_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYT41104.1|4470714_4471146_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
AYT41105.1|4471241_4471667_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYT41106.1|4471666_4472044_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYT41107.1|4472048_4472519_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYT41108.1|4472538_4472754_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYT41109.1|4472757_4472961_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYT41110.1|4472960_4473425_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYT41111.1|4473518_4474169_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYT41112.1|4474172_4475237_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYT41113.1|4475253_4476087_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYT41114.1|4476229_4477996_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYT41115.1|4477992_4479039_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYT41116.1|4479087_4479783_-	hypothetical protein	NA	NA	NA	NA	NA
AYT41117.1|4479802_4480867_-	hypothetical protein	NA	NA	NA	NA	NA
AYT41118.1|4480863_4481928_-	hypothetical protein	NA	NA	NA	NA	NA
AYT41119.1|4482852_4485261_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.1	0.0e+00
AYT41120.1|4485251_4486112_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYT41121.1|4486108_4486693_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYT41122.1|4486689_4486917_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYT41123.1|4486916_4487150_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYT41124.1|4487217_4487559_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYT41125.1|4487522_4487723_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYT41126.1|4487730_4488240_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYT41127.1|4488272_4488515_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYT41128.1|4488631_4489264_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYT41129.1|4489267_4490293_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYT41130.1|4490399_4490753_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYT41131.1|4491369_4491657_+	hypothetical protein	NA	NA	NA	NA	NA
AYT41132.1|4491667_4492558_+	methyltransferase	NA	NA	NA	NA	NA
AYT41133.1|4492557_4493304_+	hypothetical protein	NA	NA	NA	NA	NA
AYT41134.1|4493605_4495576_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT41135.1|4495595_4496900_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT41136.1|4496922_4497618_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYT41137.1|4497643_4498438_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT41138.1|4498447_4499515_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT41139.1|4499559_4501296_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYT41140.1|4501295_4503791_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT41141.1|4503814_4504861_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYT41142.1|4504863_4506141_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYT41143.1|4506385_4506925_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT41144.1|4507778_4509290_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYT41145.1|4509273_4510863_+	hypothetical protein	NA	NA	NA	NA	NA
AYT41146.1|4511026_4512040_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4512217:4512233	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYT41147.1|4512466_4512760_+	hypothetical protein	NA	NA	NA	NA	NA
AYT41148.1|4512756_4513245_+	hypothetical protein	NA	NA	NA	NA	NA
AYT41149.1|4513424_4513877_-	hypothetical protein	NA	NA	NA	NA	NA
AYT41150.1|4519099_4519561_+	hypothetical protein	NA	NA	NA	NA	NA
AYT41151.1|4519557_4519779_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYT41152.1|4520635_4521418_+	hypothetical protein	NA	NA	NA	NA	NA
AYT41153.1|4522044_4522269_-	hypothetical protein	NA	NA	NA	NA	NA
AYT41154.1|4522398_4523403_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYT41155.1|4523713_4524973_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4525132:4525148	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029881	Salmonella enterica subsp. enterica serovar Typhi strain 343076_269157 chromosome, complete genome	4791108	4667226	4673702	4791108	capsid	Enterobacteria_phage(66.67%)	8	NA	NA
AYT41292.1|4667226_4668303_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYT41293.1|4668299_4669373_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYT41294.1|4669347_4670511_-	hypothetical protein	NA	NA	NA	NA	NA
AYT41295.1|4670786_4671353_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYT41296.1|4671368_4671608_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYT41297.1|4671611_4672472_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYT41298.1|4672894_4673218_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYT41299.1|4673201_4673702_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
