The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029890	Salmonella enterica subsp. enterica serovar Typhi strain 343076_253155 chromosome, complete genome	4791587	930382	937694	4791587	protease,integrase	Dickeya_phage(16.67%)	6	931633:931647	942812:942826
AYT33603.1|930382_931501_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYT33604.1|931497_933444_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931633:931647	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYT33605.1|933573_933795_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYT33606.1|934118_934439_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYT33607.1|934469_936746_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYT33608.1|937316_937694_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942812:942826	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029890	Salmonella enterica subsp. enterica serovar Typhi strain 343076_253155 chromosome, complete genome	4791587	1008819	1086132	4791587	integrase,terminase,transposase,protease,tail	Salmonella_phage(73.33%)	93	990898:990917	1061493:1061512
990898:990917	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT33657.1|1008819_1010160_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYT33658.1|1010156_1010405_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYT33659.1|1010445_1010691_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYT33660.1|1010690_1011572_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYT33661.1|1011568_1012633_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYT33662.1|1012710_1013391_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYT33663.1|1013387_1014173_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYT33664.1|1014178_1014475_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYT33665.1|1014565_1014766_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYT33666.1|1015054_1015459_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYT33667.1|1015790_1016165_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYT33668.1|1016249_1017233_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYT33669.1|1017235_1017985_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYT33670.1|1017995_1018343_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYT33671.1|1018339_1018864_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYT33672.1|1018863_1019337_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYT33673.1|1019340_1019913_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYT33674.1|1020006_1020273_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYT33675.1|1020354_1020516_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT33676.1|1020948_1021446_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT33677.1|1021630_1021870_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYT33678.1|1021859_1022165_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYT33679.1|1022204_1022807_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYT33680.1|1023015_1023627_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYT33681.1|1023759_1024557_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYT33682.1|1024955_1025081_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT33683.1|1025216_1025666_-	lipoprotein	NA	NA	NA	NA	NA
AYT33684.1|1025882_1026272_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYT33685.1|1026258_1026540_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYT33686.1|1026539_1027154_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYT33687.1|1027373_1027628_+	hypothetical protein	NA	NA	NA	NA	NA
AYT33688.1|1027732_1028110_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYT33689.1|1028173_1028434_+	hypothetical protein	NA	NA	NA	NA	NA
AYT33690.1|1028523_1029276_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYT33691.1|1029241_1030645_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYT33692.1|1030644_1032114_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYT33693.1|1032205_1032736_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYT33694.1|1032750_1033983_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYT33695.1|1033987_1034485_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYT33696.1|1034496_1035438_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYT33697.1|1035479_1035848_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYT33698.1|1035813_1036221_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYT33699.1|1036217_1036772_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYT33700.1|1036758_1037148_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYT33701.1|1037122_1037686_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYT33702.1|1037689_1038835_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYT33703.1|1038846_1039287_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYT33704.1|1039290_1039743_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYT33705.1|1039920_1041873_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYT33706.1|1041872_1042523_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYT33707.1|1042526_1042829_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYT33708.1|1042831_1043863_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYT33709.1|1043859_1044195_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYT33710.1|1044389_1045121_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT33711.1|1045120_1045549_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT33712.1|1045607_1046363_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYT33713.1|1046450_1046588_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYT33714.1|1046603_1046957_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYT33715.1|1046957_1048157_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYT33716.1|1048153_1048834_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYT33717.1|1048833_1050345_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYT33718.1|1050359_1050878_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYT33719.1|1051799_1052501_-	hypothetical protein	NA	NA	NA	NA	NA
AYT33720.1|1052813_1053092_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYT33721.1|1053517_1056130_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYT33722.1|1056337_1057348_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYT33723.1|1057510_1058056_+	hypothetical protein	NA	NA	NA	NA	NA
AYT33724.1|1058052_1059162_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYT33725.1|1059260_1061369_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYT33726.1|1061381_1063289_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061493:1061512	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT33727.1|1063303_1064557_+	inner membrane protein	NA	NA	NA	NA	NA
AYT33728.1|1064561_1066202_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYT33729.1|1066198_1066762_+	lipoprotein	NA	NA	NA	NA	NA
AYT33730.1|1067015_1067183_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYT33731.1|1067282_1067801_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYT33732.1|1067869_1069630_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYT33733.1|1069815_1070268_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYT33734.1|1070339_1071392_-	outer membrane protein A	NA	NA	NA	NA	NA
AYT33735.1|1071746_1072256_-	cell division inhibitor	NA	NA	NA	NA	NA
AYT33736.1|1072472_1073078_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYT33737.1|1073064_1075218_-	inner membrane protein	NA	NA	NA	NA	NA
AYT33738.1|1075236_1075683_-	hypothetical protein	NA	NA	NA	NA	NA
AYT33739.1|1075806_1077861_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYT33740.1|1077896_1078355_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYT33741.1|1078449_1079112_-	hypothetical protein	NA	NA	NA	NA	NA
AYT33742.1|1079282_1079699_+	hypothetical protein	NA	NA	NA	NA	NA
AYT33743.1|1079743_1080061_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYT33744.1|1080118_1081330_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYT33745.1|1082461_1082920_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT33746.1|1083656_1083938_+	acylphosphatase	NA	NA	NA	NA	NA
AYT33747.1|1083934_1084264_-	sulfite reductase	NA	NA	NA	NA	NA
AYT33748.1|1084350_1085010_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYT33749.1|1085673_1086132_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029890	Salmonella enterica subsp. enterica serovar Typhi strain 343076_253155 chromosome, complete genome	4791587	1530687	1603773	4791587	transposase,plate,protease,tail,tRNA,head	Burkholderia_virus(42.11%)	81	NA	NA
AYT34153.1|1530687_1531146_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT34154.1|1531648_1531930_+	stress response protein	NA	NA	NA	NA	NA
AYT34155.1|1532198_1533020_+|protease	serine protease	protease	NA	NA	NA	NA
AYT34156.1|1533054_1533384_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYT34157.1|1533370_1533733_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYT34158.1|1533844_1534015_-	hypothetical protein	NA	NA	NA	NA	NA
AYT34159.1|1534149_1535184_+	hypothetical protein	NA	NA	NA	NA	NA
AYT34160.1|1535358_1536747_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYT34161.1|1536757_1538287_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYT34162.1|1538813_1539758_+	hypothetical protein	NA	NA	NA	NA	NA
AYT34163.1|1539939_1540329_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYT34164.1|1540300_1540753_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYT34165.1|1540947_1541178_-	hypothetical protein	NA	NA	NA	NA	NA
AYT34166.1|1541174_1541858_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYT34167.1|1541854_1542070_-	hypothetical protein	NA	NA	NA	NA	NA
AYT34168.1|1542062_1542446_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYT34169.1|1542442_1542745_-	hypothetical protein	NA	NA	NA	NA	NA
AYT34170.1|1542754_1543027_-	hypothetical protein	NA	NA	NA	NA	NA
AYT34171.1|1543315_1543846_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYT34172.1|1543873_1544143_-	hypothetical protein	NA	NA	NA	NA	NA
AYT34173.1|1544145_1545312_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYT34174.1|1545322_1547092_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYT34175.1|1547269_1547701_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYT34176.1|1547696_1548293_+	hypothetical protein	NA	NA	NA	NA	NA
AYT34177.1|1548536_1548887_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYT34178.1|1549601_1550252_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYT34179.1|1550248_1550575_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYT34180.1|1550574_1550886_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYT34181.1|1550885_1551431_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYT34182.1|1551427_1553023_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYT34183.1|1553022_1554519_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYT34184.1|1554499_1555321_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYT34185.1|1555323_1555782_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYT34186.1|1555996_1557112_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYT34187.1|1557126_1558080_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYT34188.1|1558089_1558428_+	hypothetical protein	NA	NA	NA	NA	NA
AYT34189.1|1558429_1558876_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYT34190.1|1558875_1559340_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYT34191.1|1559336_1559591_+	hypothetical protein	NA	NA	NA	NA	NA
AYT34192.1|1559580_1561008_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYT34193.1|1561007_1561529_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYT34194.1|1561531_1561813_+	hypothetical protein	NA	NA	NA	NA	NA
AYT34195.1|1561910_1562246_+	hypothetical protein	NA	NA	NA	NA	NA
AYT34196.1|1562421_1564887_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYT34197.1|1564886_1565771_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYT34198.1|1565767_1565983_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYT34199.1|1565970_1567125_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYT34200.1|1567121_1567649_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYT34201.1|1567705_1568053_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYT34202.1|1568043_1569147_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYT34203.1|1569139_1569718_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYT34204.1|1569720_1570746_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYT34205.1|1571259_1571877_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYT34206.1|1572370_1572883_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	48.6	8.8e-19
AYT34207.1|1572875_1573448_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYT34208.1|1573728_1575111_+	amino acid permease	NA	NA	NA	NA	NA
AYT34209.1|1575172_1575508_-	hypothetical protein	NA	NA	NA	NA	NA
AYT34210.1|1575634_1576366_+	two-component response regulator	NA	NA	NA	NA	NA
AYT34211.1|1576846_1577998_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYT34212.1|1578150_1579857_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYT34213.1|1579964_1581269_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYT34214.1|1581344_1582274_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYT34215.1|1582270_1583674_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYT34216.1|1583841_1585488_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYT34217.1|1585687_1586863_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYT34218.1|1586965_1588474_+	hypothetical protein	NA	NA	NA	NA	NA
AYT34219.1|1589179_1590181_+	adenosine deaminase	NA	NA	NA	NA	NA
AYT34220.1|1590254_1591370_-	oxidoreductase	NA	NA	NA	NA	NA
AYT34221.1|1591472_1591628_+	hypothetical protein	NA	NA	NA	NA	NA
AYT34222.1|1591926_1592142_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYT34223.1|1592230_1592671_+	hypothetical protein	NA	NA	NA	NA	NA
AYT34224.1|1592747_1593329_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYT34225.1|1593328_1593907_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYT34226.1|1593899_1595921_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYT34227.1|1595921_1596980_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYT34228.1|1596983_1597604_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYT34229.1|1597606_1598299_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYT34230.1|1598298_1598934_+	endonuclease III	NA	NA	NA	NA	NA
AYT34231.1|1599534_1601040_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYT34232.1|1601144_1601750_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYT34233.1|1602498_1603773_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029890	Salmonella enterica subsp. enterica serovar Typhi strain 343076_253155 chromosome, complete genome	4791587	1691279	1755144	4791587	terminase,portal,transposase,plate,capsid,tail,tRNA	Enterobacteria_phage(75.0%)	74	NA	NA
AYT34320.1|1691279_1692029_-	vitamin B12 ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	4.6e-08
AYT34321.1|1692028_1692580_-	glutathione peroxidase	NA	NA	NA	NA	NA
AYT34322.1|1692671_1693652_-	vitamin B12 ABC transporter permease	NA	NA	NA	NA	NA
AYT34323.1|1693859_1694189_-	hypothetical protein	NA	NA	NA	NA	NA
AYT34324.1|1694296_1694659_-	hypothetical protein	NA	NA	NA	NA	NA
AYT34325.1|1694661_1695789_-	Integrase	NA	A0A0M4RTQ0	Salmonella_phage	51.4	7.0e-85
AYT34326.1|1696091_1696370_+	DNA-binding protein	NA	NA	NA	NA	NA
AYT34327.1|1696384_1696723_+	hypothetical protein	NA	A0A0A7NV42	Enterobacteria_phage	82.8	1.1e-46
AYT34328.1|1696733_1697012_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	4.5e-33
AYT34329.1|1697023_1697266_+	hypothetical protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AYT34330.1|1697262_1697376_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	94.6	3.6e-10
AYT34331.1|1697463_1697667_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	82.1	3.3e-25
AYT34332.1|1697663_1697882_+	hypothetical protein	NA	NA	NA	NA	NA
AYT34333.1|1697990_1698380_+	hypothetical protein	NA	NA	NA	NA	NA
AYT34334.1|1698376_1701217_+	Phage replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
AYT34335.1|1701293_1702253_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.3e-177
AYT34336.1|1702257_1702572_+	Plasmid stability protein	NA	A0A0A7NPT5	Enterobacteria_phage	51.4	9.2e-19
AYT34337.1|1702655_1703498_-	hypothetical protein	NA	NA	NA	NA	NA
AYT34338.1|1703537_1704035_-	hypothetical protein	NA	NA	NA	NA	NA
AYT34339.1|1704683_1705730_-|portal	Presumed portal vertex protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
AYT34340.1|1705729_1707481_-|terminase	Phage terminase ATPase subunit	terminase	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
AYT34341.1|1707635_1708472_+|capsid	Phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.2	7.2e-119
AYT34342.1|1708495_1709548_+|capsid	Phage major capsid protein	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	1.5e-198
AYT34343.1|1709593_1710394_+|terminase	Phage terminase endonuclease subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	98.1	7.8e-139
AYT34344.1|1710495_1710990_+	Head completion/stabilization protein	NA	A0A0A7NPU2	Enterobacteria_phage	98.8	3.0e-88
AYT34345.1|1710989_1711190_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
AYT34346.1|1711192_1711516_+	hypothetical protein	NA	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AYT34347.1|1711512_1711905_+	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
AYT34348.1|1711901_1712309_+	hypothetical protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.0	6.5e-65
AYT34349.1|1712446_1712914_+|tail	tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
AYT34350.1|1712897_1713542_+|tail	Phage tail completion protein	tail	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
AYT34351.1|1713538_1714120_+|plate	Baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	8.6e-103
AYT34352.1|1714116_1714467_+|plate	Phage baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AYT34353.1|1714470_1715367_+|plate	Baseplate assembly protein J	plate	A0A0A7NPY5	Enterobacteria_phage	99.0	1.2e-156
AYT34354.1|1715359_1715890_+|tail	Phage tail fiber	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	2.1e-92
AYT34355.1|1715892_1718058_+	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	82.7	0.0e+00
AYT34356.1|1718059_1718587_+|tail	Phage tail fiber	tail	A0A0C4UR05	Shigella_phage	94.9	8.9e-91
AYT34357.1|1718615_1719149_-|tail	Phage tail fiber	tail	C9DGR0	Escherichia_phage	98.9	3.2e-96
AYT34358.1|1719151_1720045_-	hypothetical protein	NA	C9DGR1	Escherichia_phage	99.3	1.1e-178
AYT34359.1|1720176_1720764_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	97.9	2.3e-103
AYT34360.1|1720799_1721288_-|tail	tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
AYT34361.1|1721300_1724108_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	98.1	0.0e+00
AYT34362.1|1724258_1724633_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
AYT34363.1|1724688_1725201_-|tail	tail protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AYT34364.1|1725200_1726385_-|tail	tail protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	3.4e-223
AYT34365.1|1726542_1727646_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	1.1e-194
AYT34366.1|1727810_1728446_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
AYT34367.1|1728442_1729555_-	molybdenum cofactor biosynthesis protein A	NA	NA	NA	NA	NA
AYT34368.1|1729547_1730936_-	Chondro-6-sulfatase	NA	S5VT21	Leptospira_phage	27.4	1.3e-48
AYT34369.1|1730935_1731208_-	His-Xaa-Ser system protein HsxD	NA	NA	NA	NA	NA
AYT34370.1|1731460_1731721_+	hypothetical protein	NA	NA	NA	NA	NA
AYT34371.1|1731911_1732052_+	hok/gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AYT34372.1|1732460_1732760_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AYT34373.1|1732764_1735152_-|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AYT34374.1|1735167_1736151_-|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AYT34375.1|1736452_1736809_-	50S ribosomal subunit protein L20	NA	NA	NA	NA	NA
AYT34376.1|1736859_1737057_-	50S ribosomal subunit protein L35	NA	NA	NA	NA	NA
AYT34377.1|1737152_1737695_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	6.3e-15
AYT34378.1|1737698_1739627_-|tRNA	threonyl-tRNA synthetase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.6e-129
AYT34379.1|1740209_1740338_+	hypothetical protein	NA	NA	NA	NA	NA
AYT34380.1|1740518_1741742_+	O-antigen polymerase	NA	NA	NA	NA	NA
AYT34381.1|1743295_1743610_-	hypothetical protein	NA	NA	NA	NA	NA
AYT34382.1|1743752_1744712_+	outer membrane protein	NA	NA	NA	NA	NA
AYT34383.1|1744760_1745519_-	outer membrane protein	NA	NA	NA	NA	NA
AYT34384.1|1745807_1746740_+	6-phosphofructokinase isozyme	NA	NA	NA	NA	NA
AYT34385.1|1746836_1747127_+	hypothetical protein	NA	NA	NA	NA	NA
AYT34386.1|1747233_1748094_+	hypothetical protein	NA	NA	NA	NA	NA
AYT34387.1|1748136_1748673_-	hypothetical protein	NA	NA	NA	NA	NA
AYT34388.1|1748821_1749490_+	hydrolase	NA	NA	NA	NA	NA
AYT34389.1|1749627_1750227_+	hypothetical protein	NA	NA	NA	NA	NA
AYT34390.1|1750363_1751755_+	sodium:dicarboxylate symporter	NA	NA	NA	NA	NA
AYT34391.1|1751857_1752100_-	cell division activator CedA	NA	NA	NA	NA	NA
AYT34392.1|1752316_1754569_+	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	50.0	1.3e-143
AYT34393.1|1754685_1755144_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 5
CP029890	Salmonella enterica subsp. enterica serovar Typhi strain 343076_253155 chromosome, complete genome	4791587	1823418	1827830	4791587		Escherichia_phage(50.0%)	6	NA	NA
AYT34464.1|1823418_1823658_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AYT34465.1|1824530_1825340_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYT34466.1|1825412_1825790_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYT34467.1|1825937_1826480_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYT34468.1|1826671_1827400_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYT34469.1|1827416_1827830_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 6
CP029890	Salmonella enterica subsp. enterica serovar Typhi strain 343076_253155 chromosome, complete genome	4791587	2031710	2038944	4791587		Morganella_phage(33.33%)	7	NA	NA
AYT34659.1|2031710_2033141_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYT34660.1|2033214_2033910_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYT34661.1|2033989_2034301_-	hypothetical protein	NA	NA	NA	NA	NA
AYT34662.1|2034951_2036136_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYT34663.1|2036595_2036808_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYT34664.1|2037253_2038522_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYT34665.1|2038524_2038944_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 7
CP029890	Salmonella enterica subsp. enterica serovar Typhi strain 343076_253155 chromosome, complete genome	4791587	2122686	2133193	4791587		Enterobacteria_phage(37.5%)	10	NA	NA
AYT34742.1|2122686_2124000_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYT34743.1|2124026_2125106_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYT34744.1|2125110_2125884_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYT34745.1|2125899_2126874_-	reductase RfbI	NA	NA	NA	NA	NA
AYT34746.1|2126879_2127431_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYT34747.1|2127431_2128310_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYT34748.1|2128357_2129257_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYT34749.1|2129256_2130342_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYT34750.1|2130718_2131612_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYT34751.1|2131789_2133193_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 8
CP029890	Salmonella enterica subsp. enterica serovar Typhi strain 343076_253155 chromosome, complete genome	4791587	2753692	2767084	4791587	tail	Salmonella_phage(70.0%)	11	NA	NA
AYT35246.1|2753692_2753911_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYT35247.1|2754001_2755102_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT35248.1|2755098_2755584_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT35249.1|2755580_2758658_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYT35250.1|2758650_2758770_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT35251.1|2758784_2759087_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT35252.1|2759141_2759657_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT35253.1|2759666_2760839_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT35254.1|2760981_2761554_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT35255.1|2762231_2763347_+	glycosyltransferase	NA	NA	NA	NA	NA
AYT35256.1|2763427_2767084_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029890	Salmonella enterica subsp. enterica serovar Typhi strain 343076_253155 chromosome, complete genome	4791587	3084356	3128059	4791587	protease,transposase,tRNA,bacteriocin	Bacillus_virus(33.33%)	44	NA	NA
AYT35544.1|3084356_3084815_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT35545.1|3085004_3086084_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYT35546.1|3086185_3087349_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYT35547.1|3087370_3088417_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYT35548.1|3088790_3089216_+	hypothetical protein	NA	NA	NA	NA	NA
AYT35549.1|3089241_3089820_+	hypothetical protein	NA	NA	NA	NA	NA
AYT35550.1|3089853_3090528_+	hypothetical protein	NA	NA	NA	NA	NA
AYT35551.1|3090509_3091193_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYT35552.1|3091186_3091843_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYT35553.1|3091947_3092406_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT35554.1|3092594_3094586_-	transketolase	NA	NA	NA	NA	NA
AYT35555.1|3094861_3095620_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYT35556.1|3095720_3096641_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYT35557.1|3096868_3098845_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYT35558.1|3098853_3098985_-	hypothetical protein	NA	NA	NA	NA	NA
AYT35559.1|3099279_3099579_-	membrane protein	NA	NA	NA	NA	NA
AYT35560.1|3099634_3100789_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYT35561.1|3101281_3102676_+	galactose-proton symport	NA	NA	NA	NA	NA
AYT35562.1|3102754_3103252_+	hypothetical protein	NA	NA	NA	NA	NA
AYT35563.1|3103347_3104055_+	endonuclease I	NA	NA	NA	NA	NA
AYT35564.1|3104131_3104863_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYT35565.1|3104882_3105830_+	glutathione synthetase	NA	NA	NA	NA	NA
AYT35566.1|3106045_3106609_+	hypothetical protein	NA	NA	NA	NA	NA
AYT35567.1|3106608_3107025_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYT35568.1|3107071_3107758_-	global regulatory protein	NA	NA	NA	NA	NA
AYT35569.1|3107887_3108868_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYT35570.1|3108885_3109590_+	hypothetical protein	NA	NA	NA	NA	NA
AYT35571.1|3109608_3110175_+	hypothetical protein	NA	NA	NA	NA	NA
AYT35572.1|3110171_3110462_+	hypothetical protein	NA	NA	NA	NA	NA
AYT35573.1|3110469_3111063_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYT35574.1|3111055_3112192_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYT35575.1|3112282_3113290_-	hypothetical protein	NA	NA	NA	NA	NA
AYT35576.1|3113422_3114469_-	L-asparaginase	NA	NA	NA	NA	NA
AYT35577.1|3114787_3115246_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT35578.1|3115368_3116088_-	hypothetical protein	NA	NA	NA	NA	NA
AYT35579.1|3116137_3116464_-	hypothetical protein	NA	NA	NA	NA	NA
AYT35580.1|3116463_3117183_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYT35581.1|3117337_3118390_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYT35582.1|3118417_3118693_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYT35583.1|3118805_3119891_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYT35584.1|3120107_3121364_+	nucleoside permease	NA	NA	NA	NA	NA
AYT35585.1|3123974_3124682_+	hypothetical protein	NA	NA	NA	NA	NA
AYT35586.1|3127271_3127538_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYT35587.1|3127780_3128059_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029890	Salmonella enterica subsp. enterica serovar Typhi strain 343076_253155 chromosome, complete genome	4791587	3497447	3535505	4791587	integrase,terminase,portal,transposase,plate,capsid,tail	Salmonella_phage(82.05%)	46	3492411:3492425	3504577:3504591
3492411:3492425	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYT35909.1|3497447_3499094_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYT35910.1|3499233_3499332_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYT35911.1|3499587_3499917_+	hypothetical protein	NA	NA	NA	NA	NA
AYT35912.1|3499957_3501010_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYT35913.1|3501405_3501975_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYT35914.1|3502100_3502322_+	hypothetical protein	NA	NA	NA	NA	NA
AYT35915.1|3502354_3502864_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYT35916.1|3503038_3503263_+	hypothetical protein	NA	NA	NA	NA	NA
AYT35917.1|3503285_3503627_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYT35918.1|3503694_3503928_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYT35919.1|3503927_3504155_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYT35920.1|3504151_3505009_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3504577:3504591	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYT35921.1|3505005_3507420_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYT35922.1|3507573_3507762_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYT35923.1|3509729_3510644_+	hypothetical protein	NA	NA	NA	NA	NA
AYT35924.1|3510640_3511381_+	hypothetical protein	NA	NA	NA	NA	NA
AYT35925.1|3511415_3512453_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYT35926.1|3512452_3514219_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYT35927.1|3514361_3515195_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYT35928.1|3515211_3516270_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYT35929.1|3516273_3516924_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYT35930.1|3516956_3517484_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYT35931.1|3517483_3517687_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYT35932.1|3517690_3517906_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYT35933.1|3517925_3518399_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYT35934.1|3518400_3518778_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYT35935.1|3518774_3519203_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYT35936.1|3519298_3519730_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYT35937.1|3519722_3520169_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYT35938.1|3520237_3520816_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYT35939.1|3520812_3521172_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYT35940.1|3521158_3522067_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYT35941.1|3522059_3522665_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT35942.1|3522661_3524176_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.0	4.4e-199
AYT35943.1|3524175_3524769_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYT35944.1|3524740_3525181_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYT35945.1|3525603_3526176_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT35946.1|3526318_3527491_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT35947.1|3527500_3528016_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT35948.1|3528070_3528373_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT35949.1|3528387_3528507_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT35950.1|3528499_3531577_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYT35951.1|3531573_3532059_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT35952.1|3532055_3533156_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT35953.1|3533246_3533465_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYT35954.1|3535046_3535505_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029890	Salmonella enterica subsp. enterica serovar Typhi strain 343076_253155 chromosome, complete genome	4791587	4451176	4525446	4791587	integrase,terminase,portal,plate,capsid,tail	Salmonella_phage(82.61%)	75	4512690:4512706	4525605:4525621
AYT36723.1|4451176_4453126_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYT36724.1|4453197_4454106_+	hypothetical protein	NA	NA	NA	NA	NA
AYT36725.1|4454179_4455079_+	hypothetical protein	NA	NA	NA	NA	NA
AYT36726.1|4455120_4455480_+	hypothetical protein	NA	NA	NA	NA	NA
AYT36727.1|4455579_4455849_-	hypothetical protein	NA	NA	NA	NA	NA
AYT36728.1|4455980_4457255_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYT36729.1|4457474_4457852_+	hypothetical protein	NA	NA	NA	NA	NA
AYT36730.1|4457938_4458157_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYT36731.1|4458224_4459325_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYT36732.1|4459321_4459807_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYT36733.1|4459806_4462587_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYT36734.1|4462579_4462699_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYT36735.1|4462713_4463016_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYT36736.1|4463070_4463586_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYT36737.1|4463595_4464768_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYT36738.1|4465302_4466025_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYT36739.1|4466222_4466630_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYT36740.1|4466636_4468256_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYT36741.1|4468252_4468858_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT36742.1|4468850_4469759_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYT36743.1|4469745_4470105_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYT36744.1|4470101_4470680_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYT36745.1|4470748_4471195_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYT36746.1|4471187_4471619_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
AYT36747.1|4471714_4472140_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYT36748.1|4472139_4472517_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYT36749.1|4472521_4472992_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYT36750.1|4473011_4473227_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYT36751.1|4473230_4473434_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYT36752.1|4473433_4473898_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYT36753.1|4473991_4474642_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYT36754.1|4474645_4475710_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYT36755.1|4475726_4476560_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYT36756.1|4476702_4478469_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYT36757.1|4478465_4479512_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYT36758.1|4479560_4480256_-	hypothetical protein	NA	NA	NA	NA	NA
AYT36759.1|4480275_4481340_-	hypothetical protein	NA	NA	NA	NA	NA
AYT36760.1|4481336_4482401_-	hypothetical protein	NA	NA	NA	NA	NA
AYT36761.1|4483325_4485734_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.1	0.0e+00
AYT36762.1|4485724_4486585_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYT36763.1|4486581_4487166_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYT36764.1|4487162_4487390_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYT36765.1|4487389_4487623_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYT36766.1|4487690_4488032_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYT36767.1|4487995_4488196_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYT36768.1|4488203_4488713_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYT36769.1|4488745_4488988_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYT36770.1|4489104_4489737_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYT36771.1|4489740_4490766_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYT36772.1|4490872_4491226_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYT36773.1|4491842_4492130_+	hypothetical protein	NA	NA	NA	NA	NA
AYT36774.1|4492140_4493031_+	methyltransferase	NA	NA	NA	NA	NA
AYT36775.1|4493030_4493777_+	hypothetical protein	NA	NA	NA	NA	NA
AYT36776.1|4494078_4496049_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT36777.1|4496068_4497373_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT36778.1|4497395_4498091_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYT36779.1|4498116_4498911_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT36780.1|4498920_4499988_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT36781.1|4500032_4501769_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYT36782.1|4501768_4504264_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT36783.1|4504287_4505334_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYT36784.1|4505336_4506614_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYT36785.1|4506858_4507398_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT36786.1|4508251_4509763_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYT36787.1|4509746_4511336_+	hypothetical protein	NA	NA	NA	NA	NA
AYT36788.1|4511499_4512513_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4512690:4512706	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYT36789.1|4512939_4513233_+	hypothetical protein	NA	NA	NA	NA	NA
AYT36790.1|4513229_4513718_+	hypothetical protein	NA	NA	NA	NA	NA
AYT36791.1|4513897_4514350_-	hypothetical protein	NA	NA	NA	NA	NA
AYT36792.1|4519572_4520034_+	hypothetical protein	NA	NA	NA	NA	NA
AYT36793.1|4520030_4520252_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYT36794.1|4521108_4521891_+	hypothetical protein	NA	NA	NA	NA	NA
AYT36795.1|4522517_4522742_-	hypothetical protein	NA	NA	NA	NA	NA
AYT36796.1|4522871_4523876_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYT36797.1|4524186_4525446_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4525605:4525621	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029890	Salmonella enterica subsp. enterica serovar Typhi strain 343076_253155 chromosome, complete genome	4791587	4667700	4674176	4791587	capsid	Enterobacteria_phage(66.67%)	8	NA	NA
AYT36934.1|4667700_4668777_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYT36935.1|4668773_4669847_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYT36936.1|4669821_4670985_-	hypothetical protein	NA	NA	NA	NA	NA
AYT36937.1|4671260_4671827_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYT36938.1|4671842_4672082_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYT36939.1|4672085_4672946_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYT36940.1|4673368_4673692_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYT36941.1|4673675_4674176_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
>prophage 1
CP029891	Salmonella enterica subsp. enterica serovar Typhi strain 343076_253155 plasmid pHCM2, complete sequence	106706	850	71013	106706		Salmonella_phage(97.65%)	88	NA	NA
AYT37037.1|850_1120_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AYT37038.1|1200_1518_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYT37039.1|1577_2324_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
AYT37040.1|2398_2782_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AYT37041.1|2783_3257_-	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AYT37042.1|3247_3592_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AYT37043.1|3689_4523_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
AYT37044.1|4522_4957_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
AYT37045.1|5000_5924_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
AYT37046.1|5998_6874_-	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
AYT37047.1|6900_7797_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
AYT37048.1|7819_9394_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
AYT37049.1|9427_10684_-	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
AYT37050.1|10686_11328_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.5	1.8e-109
AYT37051.1|11523_11790_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AYT37052.1|11799_12699_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
AYT37053.1|12695_12950_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AYT37054.1|12942_13581_-	putative ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	99.1	5.5e-111
AYT37055.1|13577_14246_-	hypothetical protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
AYT37056.1|14245_14926_-	hypothetical protein	NA	J9Q756	Salmonella_phage	99.6	7.4e-122
AYT37057.1|15008_16568_+	putative helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
AYT37058.1|16570_16849_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AYT37059.1|16908_17331_+	putative lipoprotein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
AYT37060.1|17335_17863_+	putative transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
AYT37061.1|18497_19148_+	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
AYT37062.1|19232_19460_+	hypothetical protein	NA	NA	NA	NA	NA
AYT37063.1|20091_20574_-	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
AYT37064.1|20779_21067_-	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
AYT37065.1|21187_21580_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
AYT37066.1|21708_22020_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
AYT37067.1|22096_22411_-	hypothetical protein	NA	NA	NA	NA	NA
AYT37068.1|22505_22724_-	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AYT37069.1|22734_22950_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
AYT37070.1|23092_23338_+	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
AYT37071.1|24774_25965_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
AYT37072.1|25974_26292_-	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
AYT37073.1|26376_26658_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
AYT37074.1|26831_27035_+	hypothetical protein	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
AYT37075.1|27095_27383_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
AYT37076.1|27379_27688_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
AYT37077.1|27699_28242_-	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
AYT37078.1|28238_28880_-	hypothetical protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
AYT37079.1|28971_29343_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
AYT37080.1|29453_29627_-	hypothetical protein	NA	J9Q801	Salmonella_phage	98.2	9.5e-26
AYT37081.1|29623_30313_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
AYT37082.1|30371_32075_-	putative DNA modification methylase	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
AYT37083.1|32198_32771_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AYT37084.1|32879_33722_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AYT37085.1|33830_34019_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AYT37086.1|34028_34523_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
AYT37087.1|34665_35274_-	putative ribonuclease H	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AYT37088.1|35859_36090_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AYT37089.1|36292_36886_-	hypothetical protein	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
AYT37090.1|37071_37998_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.1e-107
AYT37091.1|38042_38600_-	hypothetical protein	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AYT37092.1|38609_39029_-	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
AYT37093.1|39092_39737_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AYT37094.1|39736_40213_-	hypothetical protein	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AYT37095.1|40209_40623_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AYT37096.1|40624_41740_-	putative thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
AYT37097.1|41855_42785_-	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
AYT37098.1|42867_44010_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
AYT37099.1|44117_46433_-	ribonucleotide-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AYT37100.1|46510_47080_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
AYT37101.1|47092_47839_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
AYT37102.1|47828_49745_-	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AYT37103.1|49741_49978_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AYT37104.1|49974_51060_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
AYT37105.1|51486_51792_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.0	2.0e-50
AYT37106.1|51823_52318_-	hypothetical protein	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
AYT37107.1|52393_53038_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
AYT37108.1|53782_54838_+	putative replication protein A	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
AYT37109.1|55366_55570_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
AYT37110.1|55569_55875_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
AYT37111.1|55915_56191_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
AYT37112.1|56259_56670_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
AYT37113.1|56653_57025_-	hypothetical protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
AYT37114.1|57187_58030_-	putative lipoprotein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
AYT37115.1|58325_59402_-	putative recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AYT37116.1|59404_59671_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYT37117.1|59670_60615_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
AYT37118.1|60675_61704_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
AYT37119.1|61823_62255_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
AYT37120.1|62500_63091_+	hypothetical protein	NA	NA	NA	NA	NA
AYT37121.1|63184_63628_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.0e-71
AYT37122.1|63624_67143_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
AYT37123.1|67323_68559_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
AYT37124.1|68655_71013_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	90.7	0.0e+00
>prophage 2
CP029891	Salmonella enterica subsp. enterica serovar Typhi strain 343076_253155 plasmid pHCM2, complete sequence	106706	79503	106652	106706	tail	Salmonella_phage(88.0%)	25	NA	NA
AYT37137.1|79503_79809_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
AYT37138.1|79805_79958_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
AYT37139.1|79957_80164_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
AYT37140.1|80329_81652_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
AYT37141.1|81686_81944_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
AYT37142.1|82244_83039_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
AYT37143.1|83222_84275_+	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
AYT37144.1|84276_85488_-	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
AYT37145.1|85550_86891_-	putative DNA helicase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
AYT37146.1|86951_87677_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
AYT37147.1|87954_89010_+	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
AYT37148.1|89079_89835_-	hypothetical protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
AYT37149.1|89883_90243_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AYT37150.1|90242_90908_-	hypothetical protein	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
AYT37151.1|91238_91790_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
AYT37152.1|91840_92185_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.6	5.9e-27
AYT37153.1|92253_92973_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	1.5e-125
AYT37154.1|92959_93283_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
AYT37155.1|93397_95950_-	hypothetical protein	NA	A0A0A0YQM3	Citrobacter_virus	52.5	1.4e-152
AYT37156.1|96032_100421_-|tail	putative phage tail protein	tail	J9Q713	Salmonella_phage	86.7	0.0e+00
AYT37157.1|100435_101023_-|tail	putative phage tail protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
AYT37158.1|101010_101808_-	hypothetical protein	NA	J9Q7R4	Salmonella_phage	95.8	1.2e-155
AYT37159.1|101800_102532_-|tail	putative phage tail protein	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
AYT37160.1|102588_102924_-	hypothetical protein	NA	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AYT37161.1|102965_106652_-	gifsy-1 prophage VmtH	NA	J9Q712	Salmonella_phage	91.4	0.0e+00
