The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029900	Salmonella enterica subsp. enterica serovar Typhi strain 343076_232188 chromosome, complete genome	4800621	930278	937590	4800621	integrase,protease	Dickeya_phage(16.67%)	6	931529:931543	942708:942722
AYT12147.1|930278_931397_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYT12148.1|931393_933340_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931529:931543	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYT12149.1|933469_933691_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYT12150.1|934014_934335_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYT12151.1|934365_936642_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYT12152.1|937212_937590_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942708:942722	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029900	Salmonella enterica subsp. enterica serovar Typhi strain 343076_232188 chromosome, complete genome	4800621	1008719	1086031	4800621	tail,transposase,integrase,terminase,protease	Salmonella_phage(73.33%)	93	990785:990804	1061392:1061411
990785:990804	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT12202.1|1008719_1010060_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYT12203.1|1010056_1010305_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYT12204.1|1010345_1010591_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYT12205.1|1010590_1011472_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYT12206.1|1011468_1012533_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYT12207.1|1012610_1013291_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYT12208.1|1013287_1014073_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYT12209.1|1014078_1014375_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYT12210.1|1014465_1014666_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYT12211.1|1014954_1015359_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYT12212.1|1015690_1016065_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYT12213.1|1016149_1017133_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYT12214.1|1017135_1017885_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYT12215.1|1017895_1018243_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYT12216.1|1018239_1018764_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYT12217.1|1018763_1019237_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYT12218.1|1019240_1019813_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYT12219.1|1019906_1020173_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYT12220.1|1020254_1020416_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT12221.1|1020848_1021346_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT12222.1|1021530_1021770_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYT12223.1|1021759_1022065_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYT12224.1|1022104_1022707_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYT12225.1|1022915_1023527_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYT12226.1|1023659_1024457_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYT12227.1|1024855_1024981_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT12228.1|1025116_1025566_-	lipoprotein	NA	NA	NA	NA	NA
AYT12229.1|1025782_1026172_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYT12230.1|1026158_1026440_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYT12231.1|1026439_1027054_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYT12232.1|1027272_1027527_+	hypothetical protein	NA	NA	NA	NA	NA
AYT12233.1|1027631_1028009_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYT12234.1|1028072_1028333_+	hypothetical protein	NA	NA	NA	NA	NA
AYT12235.1|1028422_1029175_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYT12236.1|1029140_1030544_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYT12237.1|1030543_1032013_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYT12238.1|1032104_1032635_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYT12239.1|1032649_1033882_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYT12240.1|1033886_1034384_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYT12241.1|1034395_1035337_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYT12242.1|1035378_1035747_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYT12243.1|1035712_1036120_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYT12244.1|1036116_1036671_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYT12245.1|1036657_1037047_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYT12246.1|1037021_1037585_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYT12247.1|1037588_1038734_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYT12248.1|1038745_1039186_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYT12249.1|1039189_1039642_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYT12250.1|1039819_1041772_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYT12251.1|1041771_1042422_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYT12252.1|1042425_1042728_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYT12253.1|1042730_1043762_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYT12254.1|1043758_1044094_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYT12255.1|1044288_1045020_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT12256.1|1045019_1045448_+	bacteriophage protein	NA	NA	NA	NA	NA
AYT12257.1|1045506_1046262_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYT12258.1|1046349_1046487_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYT12259.1|1046502_1046856_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYT12260.1|1046856_1048056_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYT12261.1|1048052_1048733_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYT12262.1|1048732_1050244_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYT12263.1|1050258_1050777_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYT12264.1|1051698_1052400_-	hypothetical protein	NA	NA	NA	NA	NA
AYT12265.1|1052712_1052991_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYT12266.1|1053416_1056029_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYT12267.1|1056236_1057247_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYT12268.1|1057409_1057955_+	hypothetical protein	NA	NA	NA	NA	NA
AYT12269.1|1057951_1059061_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYT12270.1|1059159_1061268_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYT12271.1|1061280_1063188_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061392:1061411	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYT12272.1|1063202_1064456_+	inner membrane protein	NA	NA	NA	NA	NA
AYT12273.1|1064460_1066101_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYT12274.1|1066097_1066661_+	lipoprotein	NA	NA	NA	NA	NA
AYT12275.1|1066914_1067082_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYT12276.1|1067181_1067700_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYT12277.1|1067768_1069529_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYT12278.1|1069714_1070167_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYT12279.1|1070238_1071291_-	outer membrane protein A	NA	NA	NA	NA	NA
AYT12280.1|1071645_1072155_-	cell division inhibitor	NA	NA	NA	NA	NA
AYT12281.1|1072371_1072977_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYT12282.1|1072963_1075117_-	inner membrane protein	NA	NA	NA	NA	NA
AYT12283.1|1075135_1075582_-	hypothetical protein	NA	NA	NA	NA	NA
AYT12284.1|1075705_1077760_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYT12285.1|1077795_1078254_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYT12286.1|1078348_1079011_-	hypothetical protein	NA	NA	NA	NA	NA
AYT12287.1|1079181_1079598_+	hypothetical protein	NA	NA	NA	NA	NA
AYT12288.1|1079642_1079960_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYT12289.1|1080017_1081229_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYT12290.1|1082360_1082819_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT12291.1|1083555_1083837_+	acylphosphatase	NA	NA	NA	NA	NA
AYT12292.1|1083833_1084163_-	sulfite reductase	NA	NA	NA	NA	NA
AYT12293.1|1084249_1084909_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYT12294.1|1085572_1086031_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029900	Salmonella enterica subsp. enterica serovar Typhi strain 343076_232188 chromosome, complete genome	4800621	1528849	1602419	4800621	tail,head,transposase,tRNA,plate,protease	Burkholderia_virus(42.11%)	81	NA	NA
AYT12693.1|1528849_1529308_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT12694.1|1529810_1530092_+	stress response protein	NA	NA	NA	NA	NA
AYT12695.1|1530360_1531182_+|protease	serine protease	protease	NA	NA	NA	NA
AYT12696.1|1531216_1531546_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYT12697.1|1531532_1531895_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYT12698.1|1532006_1532177_-	hypothetical protein	NA	NA	NA	NA	NA
AYT12699.1|1532311_1533346_+	hypothetical protein	NA	NA	NA	NA	NA
AYT12700.1|1533520_1534909_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYT12701.1|1534919_1536449_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYT12702.1|1536975_1537920_+	hypothetical protein	NA	NA	NA	NA	NA
AYT12703.1|1538101_1538491_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYT12704.1|1538462_1538915_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYT12705.1|1539109_1539340_-	hypothetical protein	NA	NA	NA	NA	NA
AYT12706.1|1539336_1540020_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYT12707.1|1540016_1540232_-	hypothetical protein	NA	NA	NA	NA	NA
AYT12708.1|1540224_1540608_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYT12709.1|1540604_1540907_-	hypothetical protein	NA	NA	NA	NA	NA
AYT12710.1|1540916_1541189_-	hypothetical protein	NA	NA	NA	NA	NA
AYT12711.1|1541477_1542008_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYT12712.1|1542035_1542305_-	hypothetical protein	NA	NA	NA	NA	NA
AYT12713.1|1542307_1543474_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYT12714.1|1543484_1545254_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYT12715.1|1545431_1545863_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYT12716.1|1545858_1546455_+	hypothetical protein	NA	NA	NA	NA	NA
AYT12717.1|1546698_1547049_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYT12718.1|1547763_1548414_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYT12719.1|1548410_1548737_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYT12720.1|1548736_1549048_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYT12721.1|1549047_1549593_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYT12722.1|1549589_1551185_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYT12723.1|1551184_1552681_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYT12724.1|1552661_1553483_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYT12725.1|1553485_1553944_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYT12726.1|1554158_1555274_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYT12727.1|1555288_1556242_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYT12728.1|1556251_1556590_+	hypothetical protein	NA	NA	NA	NA	NA
AYT12729.1|1556591_1557038_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYT12730.1|1557037_1557502_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYT12731.1|1557498_1557753_+	hypothetical protein	NA	NA	NA	NA	NA
AYT12732.1|1557742_1559170_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYT12733.1|1559169_1559691_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYT12734.1|1559693_1559975_+	hypothetical protein	NA	NA	NA	NA	NA
AYT12735.1|1560072_1560408_+	hypothetical protein	NA	NA	NA	NA	NA
AYT12736.1|1560583_1563049_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYT12737.1|1563048_1563933_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYT12738.1|1563929_1564145_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYT12739.1|1564132_1565287_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYT12740.1|1565283_1565811_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYT12741.1|1565867_1566215_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYT12742.1|1566205_1567309_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYT12743.1|1567301_1567880_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYT12744.1|1567882_1568908_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYT12745.1|1569421_1570039_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYT12746.1|1570532_1570925_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	51.1	6.8e-19
AYT12747.1|1571521_1572094_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYT12748.1|1572374_1573757_+	amino acid permease	NA	NA	NA	NA	NA
AYT12749.1|1573818_1574154_-	hypothetical protein	NA	NA	NA	NA	NA
AYT12750.1|1574280_1575012_+	two-component response regulator	NA	NA	NA	NA	NA
AYT12751.1|1575492_1576644_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYT12752.1|1576796_1578503_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYT12753.1|1578610_1579915_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYT12754.1|1579990_1580920_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYT12755.1|1580916_1582320_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYT12756.1|1582487_1584134_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYT12757.1|1584333_1585509_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYT12758.1|1585611_1587120_+	hypothetical protein	NA	NA	NA	NA	NA
AYT12759.1|1587825_1588827_+	adenosine deaminase	NA	NA	NA	NA	NA
AYT12760.1|1588900_1590016_-	oxidoreductase	NA	NA	NA	NA	NA
AYT12761.1|1590118_1590274_+	hypothetical protein	NA	NA	NA	NA	NA
AYT12762.1|1590572_1590788_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYT12763.1|1590876_1591317_+	hypothetical protein	NA	NA	NA	NA	NA
AYT12764.1|1591393_1591975_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYT12765.1|1591974_1592553_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYT12766.1|1592545_1594567_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYT12767.1|1594567_1595626_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYT12768.1|1595629_1596250_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYT12769.1|1596252_1596945_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYT12770.1|1596944_1597580_+	endonuclease III	NA	NA	NA	NA	NA
AYT12771.1|1598180_1599686_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYT12772.1|1599790_1600396_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYT12773.1|1601144_1602419_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029900	Salmonella enterica subsp. enterica serovar Typhi strain 343076_232188 chromosome, complete genome	4800621	1783456	1787868	4800621		Escherichia_phage(50.0%)	6	NA	NA
AYT12957.1|1783456_1783696_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYT12958.1|1784568_1785378_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYT12959.1|1785450_1785828_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYT12960.1|1785975_1786518_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYT12961.1|1786709_1787438_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYT12962.1|1787454_1787868_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029900	Salmonella enterica subsp. enterica serovar Typhi strain 343076_232188 chromosome, complete genome	4800621	1991722	1998956	4800621		Morganella_phage(33.33%)	7	NA	NA
AYT13153.1|1991722_1993153_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYT13154.1|1993226_1993922_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYT13155.1|1994001_1994313_-	hypothetical protein	NA	NA	NA	NA	NA
AYT13156.1|1994963_1996148_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYT13157.1|1996607_1996820_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYT13158.1|1997265_1998534_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYT13159.1|1998536_1998956_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029900	Salmonella enterica subsp. enterica serovar Typhi strain 343076_232188 chromosome, complete genome	4800621	2105256	2115763	4800621		Enterobacteria_phage(37.5%)	10	NA	NA
AYT13256.1|2105256_2106570_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYT13257.1|2106596_2107676_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYT13258.1|2107680_2108454_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYT13259.1|2108469_2109444_-	reductase RfbI	NA	NA	NA	NA	NA
AYT13260.1|2109449_2110001_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYT13261.1|2110001_2110880_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYT13262.1|2110927_2111827_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYT13263.1|2111826_2112912_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYT13264.1|2113288_2114182_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYT13265.1|2114359_2115763_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029900	Salmonella enterica subsp. enterica serovar Typhi strain 343076_232188 chromosome, complete genome	4800621	2191654	2200825	4800621	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYT13324.1|2191654_2193688_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYT13325.1|2193928_2194387_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYT13326.1|2194558_2195089_+	lipoprotein	NA	NA	NA	NA	NA
AYT13327.1|2195145_2195613_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYT13328.1|2195659_2196379_-	two-component system response regulator	NA	NA	NA	NA	NA
AYT13329.1|2196375_2198061_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYT13330.1|2198283_2199015_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYT13331.1|2199074_2199182_+	hypothetical protein	NA	NA	NA	NA	NA
AYT13332.1|2199162_2199894_-	ABC transporter permease	NA	NA	NA	NA	NA
AYT13333.1|2199877_2200825_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029900	Salmonella enterica subsp. enterica serovar Typhi strain 343076_232188 chromosome, complete genome	4800621	2736269	2749661	4800621	tail	Salmonella_phage(70.0%)	11	NA	NA
AYT13762.1|2736269_2736488_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYT13763.1|2736578_2737679_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT13764.1|2737675_2738161_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT13765.1|2738157_2741235_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYT13766.1|2741227_2741347_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT13767.1|2741361_2741664_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT13768.1|2741718_2742234_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT13769.1|2742243_2743416_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT13770.1|2743558_2744131_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT13771.1|2744808_2745924_+	glycosyltransferase	NA	NA	NA	NA	NA
AYT13772.1|2746004_2749661_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029900	Salmonella enterica subsp. enterica serovar Typhi strain 343076_232188 chromosome, complete genome	4800621	3067015	3110718	4800621	bacteriocin,tRNA,transposase,protease	Bacillus_virus(33.33%)	44	NA	NA
AYT14059.1|3067015_3067474_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT14060.1|3067663_3068743_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYT14061.1|3068844_3070008_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYT14062.1|3070029_3071076_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYT14063.1|3071449_3071875_+	hypothetical protein	NA	NA	NA	NA	NA
AYT14064.1|3071900_3072479_+	hypothetical protein	NA	NA	NA	NA	NA
AYT14065.1|3072512_3073187_+	hypothetical protein	NA	NA	NA	NA	NA
AYT14066.1|3073168_3073852_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYT14067.1|3073845_3074502_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYT14068.1|3074606_3075065_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT14069.1|3075253_3077245_-	transketolase	NA	NA	NA	NA	NA
AYT14070.1|3077520_3078279_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYT14071.1|3078379_3079300_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYT14072.1|3079527_3081504_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYT14073.1|3081512_3081644_-	hypothetical protein	NA	NA	NA	NA	NA
AYT14074.1|3081938_3082238_-	membrane protein	NA	NA	NA	NA	NA
AYT14075.1|3082293_3083448_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYT14076.1|3083940_3085335_+	galactose-proton symport	NA	NA	NA	NA	NA
AYT14077.1|3085413_3085911_+	hypothetical protein	NA	NA	NA	NA	NA
AYT14078.1|3086006_3086714_+	endonuclease I	NA	NA	NA	NA	NA
AYT14079.1|3086790_3087522_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYT14080.1|3087541_3088489_+	glutathione synthetase	NA	NA	NA	NA	NA
AYT14081.1|3088704_3089268_+	hypothetical protein	NA	NA	NA	NA	NA
AYT14082.1|3089267_3089684_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYT14083.1|3089730_3090417_-	global regulatory protein	NA	NA	NA	NA	NA
AYT14084.1|3090546_3091527_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYT14085.1|3091544_3092249_+	hypothetical protein	NA	NA	NA	NA	NA
AYT14086.1|3092267_3092834_+	hypothetical protein	NA	NA	NA	NA	NA
AYT14087.1|3092830_3093121_+	hypothetical protein	NA	NA	NA	NA	NA
AYT14088.1|3093128_3093722_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYT14089.1|3093714_3094851_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYT14090.1|3094941_3095949_-	hypothetical protein	NA	NA	NA	NA	NA
AYT14091.1|3096081_3097128_-	L-asparaginase	NA	NA	NA	NA	NA
AYT14092.1|3097446_3097905_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT14093.1|3098027_3098747_-	hypothetical protein	NA	NA	NA	NA	NA
AYT14094.1|3098796_3099123_-	hypothetical protein	NA	NA	NA	NA	NA
AYT14095.1|3099122_3099842_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYT14096.1|3099996_3101049_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYT14097.1|3101076_3101352_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYT14098.1|3101464_3102550_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYT14099.1|3102766_3104023_+	nucleoside permease	NA	NA	NA	NA	NA
AYT14100.1|3106633_3107341_+	hypothetical protein	NA	NA	NA	NA	NA
AYT14101.1|3109930_3110197_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYT14102.1|3110439_3110718_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029900	Salmonella enterica subsp. enterica serovar Typhi strain 343076_232188 chromosome, complete genome	4800621	3489194	3527252	4800621	tail,capsid,transposase,integrase,terminase,plate,portal	Salmonella_phage(82.05%)	46	3484158:3484172	3496324:3496338
3484158:3484172	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYT14431.1|3489194_3490841_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYT14432.1|3490980_3491079_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYT14433.1|3491334_3491664_+	hypothetical protein	NA	NA	NA	NA	NA
AYT14434.1|3491704_3492757_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYT14435.1|3493152_3493722_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYT14436.1|3493847_3494069_+	hypothetical protein	NA	NA	NA	NA	NA
AYT14437.1|3494101_3494611_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYT14438.1|3494785_3495010_+	hypothetical protein	NA	NA	NA	NA	NA
AYT14439.1|3495032_3495374_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYT14440.1|3495441_3495675_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYT14441.1|3495674_3495902_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYT14442.1|3495898_3496756_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3496324:3496338	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYT14443.1|3496752_3499167_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYT14444.1|3499320_3499509_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYT14445.1|3501476_3502391_+	hypothetical protein	NA	NA	NA	NA	NA
AYT14446.1|3502387_3503128_+	hypothetical protein	NA	NA	NA	NA	NA
AYT14447.1|3503162_3504200_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYT14448.1|3504199_3505966_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYT14449.1|3506108_3506942_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYT14450.1|3506958_3508017_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYT14451.1|3508020_3508671_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYT14452.1|3508703_3509231_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYT14453.1|3509230_3509434_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYT14454.1|3509437_3509653_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYT14455.1|3509672_3510146_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYT14456.1|3510147_3510525_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYT14457.1|3510521_3510950_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYT14458.1|3511045_3511477_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYT14459.1|3511469_3511916_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYT14460.1|3511984_3512563_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYT14461.1|3512559_3512919_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYT14462.1|3512905_3513814_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYT14463.1|3513806_3514412_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT14464.1|3514408_3515923_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYT14465.1|3515922_3516516_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYT14466.1|3516487_3516928_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYT14467.1|3517350_3517923_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT14468.1|3518065_3519238_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT14469.1|3519247_3519763_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT14470.1|3519817_3520120_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT14471.1|3520134_3520254_+	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT14472.1|3520246_3523324_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYT14473.1|3523320_3523806_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT14474.1|3523802_3524903_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT14475.1|3524993_3525212_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYT14476.1|3526793_3527252_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029900	Salmonella enterica subsp. enterica serovar Typhi strain 343076_232188 chromosome, complete genome	4800621	4460367	4534531	4800621	tail,capsid,integrase,terminase,plate,portal	Salmonella_phage(82.98%)	76	4521868:4521884	4534690:4534706
AYT15267.1|4460367_4462317_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYT15268.1|4462388_4463297_+	hypothetical protein	NA	NA	NA	NA	NA
AYT15269.1|4463370_4464270_+	hypothetical protein	NA	NA	NA	NA	NA
AYT15270.1|4464311_4464671_+	hypothetical protein	NA	NA	NA	NA	NA
AYT15271.1|4464770_4465040_-	hypothetical protein	NA	NA	NA	NA	NA
AYT15272.1|4465171_4466446_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYT15273.1|4466665_4467043_+	hypothetical protein	NA	NA	NA	NA	NA
AYT15274.1|4467129_4467348_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYT15275.1|4467415_4468516_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYT15276.1|4468512_4468998_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYT15277.1|4468997_4471778_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYT15278.1|4471770_4471890_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYT15279.1|4471904_4472207_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYT15280.1|4472261_4472777_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYT15281.1|4472786_4473959_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYT15282.1|4474493_4475216_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYT15283.1|4475413_4475821_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYT15284.1|4475827_4477447_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYT15285.1|4477443_4478049_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT15286.1|4478041_4478950_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYT15287.1|4478936_4479296_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYT15288.1|4479292_4479871_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYT15289.1|4479939_4480386_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYT15290.1|4480378_4480810_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYT15291.1|4480905_4481331_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYT15292.1|4481330_4481708_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYT15293.1|4481712_4482183_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYT15294.1|4482202_4482418_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYT15295.1|4482421_4482625_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYT15296.1|4482624_4483089_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYT15297.1|4483182_4483833_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYT15298.1|4483836_4484901_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYT15299.1|4484917_4485751_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYT15300.1|4485893_4487660_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYT15301.1|4487656_4488703_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYT15302.1|4488751_4489447_-	hypothetical protein	NA	NA	NA	NA	NA
AYT15303.1|4489466_4490531_-	hypothetical protein	NA	NA	NA	NA	NA
AYT15304.1|4490527_4491592_-	hypothetical protein	NA	NA	NA	NA	NA
AYT15305.1|4492516_4492846_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYT15306.1|4492842_4494912_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYT15307.1|4494902_4495763_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYT15308.1|4495759_4496344_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYT15309.1|4496340_4496568_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYT15310.1|4496567_4496801_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYT15311.1|4496868_4497210_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYT15312.1|4497173_4497374_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYT15313.1|4497381_4497891_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYT15314.1|4497923_4498166_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYT15315.1|4498282_4498915_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYT15316.1|4498918_4499944_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYT15317.1|4500050_4500404_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYT15318.1|4501020_4501308_+	hypothetical protein	NA	NA	NA	NA	NA
AYT15319.1|4501318_4502209_+	methyltransferase	NA	NA	NA	NA	NA
AYT15320.1|4502208_4502955_+	hypothetical protein	NA	NA	NA	NA	NA
AYT15321.1|4503256_4505227_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT15322.1|4505246_4506551_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT15323.1|4506573_4507269_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYT15324.1|4507294_4508089_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT15325.1|4508098_4509166_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT15326.1|4509210_4510947_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYT15327.1|4510946_4513442_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT15328.1|4513465_4514512_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYT15329.1|4514514_4515792_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYT15330.1|4516036_4516576_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT15331.1|4517429_4518941_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYT15332.1|4518924_4520514_+	hypothetical protein	NA	NA	NA	NA	NA
AYT15333.1|4520677_4521691_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4521868:4521884	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYT15334.1|4522117_4522411_+	hypothetical protein	NA	NA	NA	NA	NA
AYT15335.1|4522407_4522896_+	hypothetical protein	NA	NA	NA	NA	NA
AYT15336.1|4523075_4523528_-	hypothetical protein	NA	NA	NA	NA	NA
AYT15337.1|4528750_4529212_+	hypothetical protein	NA	NA	NA	NA	NA
AYT15338.1|4529208_4529430_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYT15339.1|4530286_4531069_+	hypothetical protein	NA	NA	NA	NA	NA
AYT15340.1|4531695_4531920_-	hypothetical protein	NA	NA	NA	NA	NA
AYT15341.1|4532049_4532961_-	hypothetical protein	NA	NA	NA	NA	NA
AYT15342.1|4533271_4534531_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4534690:4534706	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029900	Salmonella enterica subsp. enterica serovar Typhi strain 343076_232188 chromosome, complete genome	4800621	4676783	4687042	4800621	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYT15479.1|4676783_4677860_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYT15480.1|4677856_4678930_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYT15481.1|4678904_4680068_-	hypothetical protein	NA	NA	NA	NA	NA
AYT15482.1|4680343_4680910_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYT15483.1|4680925_4681165_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYT15484.1|4681168_4682029_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYT15485.1|4682451_4682775_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYT15486.1|4682758_4683259_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYT15487.1|4683255_4683483_+	hypothetical protein	NA	NA	NA	NA	NA
AYT15488.1|4683479_4683800_+	P4 phage protein	NA	NA	NA	NA	NA
AYT15489.1|4683814_4684489_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYT15490.1|4684485_4686147_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYT15491.1|4686883_4687042_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029901	Salmonella enterica subsp. enterica serovar Typhi strain 343076_232188 plasmid pHCM2, complete sequence	106706	446	78709	106706	tail	Salmonella_phage(94.51%)	93	NA	NA
AYT15582.1|446_1532_+	exonuclease	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
AYT15583.1|1528_1765_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AYT15584.1|1761_3678_+	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AYT15585.1|3667_4414_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
AYT15586.1|4426_4996_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
AYT15587.1|5073_7389_+	ribonucleotide-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AYT15588.1|7496_8639_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
AYT15589.1|8721_9651_+	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
AYT15590.1|9766_10882_+	putative thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
AYT15591.1|10883_11297_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AYT15592.1|11293_11770_+	hypothetical protein	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AYT15593.1|11769_12414_+	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AYT15594.1|12477_12897_+	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
AYT15595.1|12906_13464_+	hypothetical protein	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AYT15596.1|13508_14435_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.1e-107
AYT15597.1|14620_15214_+	hypothetical protein	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
AYT15598.1|15416_15647_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AYT15599.1|16232_16841_+	putative ribonuclease H	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AYT15600.1|16983_17478_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
AYT15601.1|17487_17676_+	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AYT15602.1|17784_18627_+	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AYT15603.1|18735_19308_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AYT15604.1|19431_21135_+	putative DNA modification methylase	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
AYT15605.1|21193_21883_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
AYT15606.1|21879_22053_+	hypothetical protein	NA	J9Q801	Salmonella_phage	98.2	9.5e-26
AYT15607.1|22163_22535_+	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
AYT15608.1|22626_23268_+	hypothetical protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
AYT15609.1|23264_23807_+	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
AYT15610.1|23818_24127_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
AYT15611.1|24123_24411_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
AYT15612.1|24471_24675_-	hypothetical protein	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
AYT15613.1|24848_25130_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
AYT15614.1|25214_25532_+	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
AYT15615.1|25541_26732_+	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
AYT15616.1|28168_28414_-	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
AYT15617.1|28556_28772_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
AYT15618.1|28782_29001_+	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AYT15619.1|29095_29410_+	hypothetical protein	NA	NA	NA	NA	NA
AYT15620.1|29486_29798_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
AYT15621.1|29926_30319_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
AYT15622.1|30439_30727_+	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
AYT15623.1|30932_31415_+	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
AYT15624.1|32046_32274_-	hypothetical protein	NA	NA	NA	NA	NA
AYT15625.1|32358_33009_-	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
AYT15626.1|33643_34171_-	putative transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
AYT15627.1|34175_34598_-	putative lipoprotein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
AYT15628.1|34657_34936_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AYT15629.1|34938_36498_-	putative helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
AYT15630.1|36580_37261_+	hypothetical protein	NA	J9Q756	Salmonella_phage	99.6	7.4e-122
AYT15631.1|37260_37929_+	hypothetical protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
AYT15632.1|37925_38564_+	putative ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	99.1	5.5e-111
AYT15633.1|38556_38811_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AYT15634.1|38807_39707_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
AYT15635.1|39716_39983_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AYT15636.1|40178_40820_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.5	1.8e-109
AYT15637.1|40822_42079_+	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
AYT15638.1|42112_43687_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
AYT15639.1|43709_44606_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
AYT15640.1|44632_45508_+	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
AYT15641.1|45582_46506_+	hypothetical protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
AYT15642.1|46549_46984_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
AYT15643.1|46983_47817_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
AYT15644.1|47914_48259_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AYT15645.1|48249_48723_+	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AYT15646.1|48724_49108_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AYT15647.1|49182_49929_+	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
AYT15648.1|49988_50306_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYT15649.1|50386_50656_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AYT15650.1|50663_55247_+	hypothetical protein	NA	J9Q712	Salmonella_phage	92.9	0.0e+00
AYT15651.1|55288_55624_+	hypothetical protein	NA	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AYT15652.1|55680_56412_+|tail	putative phage tail protein	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
AYT15653.1|56404_57202_+	hypothetical protein	NA	J9Q7R4	Salmonella_phage	95.8	1.2e-155
AYT15654.1|57189_57777_+|tail	putative phage tail protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
AYT15655.1|57791_62180_+|tail	putative phage tail protein	tail	J9Q713	Salmonella_phage	86.7	0.0e+00
AYT15656.1|62262_64815_+	hypothetical protein	NA	A0A0A0YQM3	Citrobacter_virus	52.5	1.4e-152
AYT15657.1|64929_65253_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
AYT15658.1|65239_65959_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	1.5e-125
AYT15659.1|66027_66372_+	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.6	5.9e-27
AYT15660.1|66422_66974_-	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
AYT15661.1|67304_67970_+	hypothetical protein	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
AYT15662.1|67969_68329_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AYT15663.1|68377_69133_+	hypothetical protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
AYT15664.1|69202_70258_-	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
AYT15665.1|70535_71261_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
AYT15666.1|71321_72662_+	putative DNA helicase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
AYT15667.1|72724_73936_+	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
AYT15668.1|73937_74990_-	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
AYT15669.1|75173_75968_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
AYT15670.1|76268_76526_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
AYT15671.1|76560_77883_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
AYT15672.1|78048_78255_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
AYT15673.1|78254_78407_+	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
AYT15674.1|78403_78709_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
>prophage 2
CP029901	Salmonella enterica subsp. enterica serovar Typhi strain 343076_232188 plasmid pHCM2, complete sequence	106706	87199	106672	106706		Salmonella_phage(100.0%)	20	NA	NA
AYT15687.1|87199_89557_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	90.7	0.0e+00
AYT15688.1|89653_90889_+	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
AYT15689.1|91069_94588_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
AYT15690.1|94584_95028_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.0e-71
AYT15691.1|95121_95712_-	hypothetical protein	NA	NA	NA	NA	NA
AYT15692.1|95957_96389_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
AYT15693.1|96508_97537_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
AYT15694.1|97597_98542_+	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
AYT15695.1|98541_98808_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYT15696.1|98810_99887_+	putative recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AYT15697.1|100182_101025_+	putative lipoprotein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
AYT15698.1|101187_101559_+	hypothetical protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
AYT15699.1|101542_101953_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
AYT15700.1|102021_102297_+	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
AYT15701.1|102337_102643_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
AYT15702.1|102642_102846_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
AYT15703.1|103374_104430_-	putative replication protein A	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
AYT15704.1|105174_105819_+	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
AYT15705.1|105894_106389_+	hypothetical protein	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
AYT15706.1|106420_106672_-	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.6	1.1e-38
