The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029915	Salmonella enterica subsp. enterica serovar Typhi strain 343076_202113 chromosome, complete genome	4799269	930368	937680	4799269	protease,integrase	Dickeya_phage(16.67%)	6	931619:931633	942798:942812
AYS99231.1|930368_931487_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS99232.1|931483_933430_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931619:931633	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS99233.1|933559_933781_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS99234.1|934104_934425_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS99235.1|934455_936732_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS99236.1|937302_937680_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942798:942812	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029915	Salmonella enterica subsp. enterica serovar Typhi strain 343076_202113 chromosome, complete genome	4799269	1008662	1085974	4799269	terminase,tail,protease,integrase,transposase	Salmonella_phage(73.33%)	93	990728:990747	1061335:1061354
990728:990747	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS99286.1|1008662_1010003_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS99287.1|1009999_1010248_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS99288.1|1010288_1010534_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS99289.1|1010533_1011415_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS99290.1|1011411_1012476_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS99291.1|1012553_1013234_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS99292.1|1013230_1014016_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS99293.1|1014021_1014318_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS99294.1|1014408_1014609_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS99295.1|1014897_1015302_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS99296.1|1015633_1016008_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS99297.1|1016092_1017076_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS99298.1|1017078_1017828_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS99299.1|1017838_1018186_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYS99300.1|1018182_1018707_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS99301.1|1018706_1019180_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS99302.1|1019183_1019756_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS99303.1|1019849_1020116_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS99304.1|1020197_1020359_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS99305.1|1020791_1021289_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS99306.1|1021473_1021713_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS99307.1|1021702_1022008_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS99308.1|1022047_1022650_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS99309.1|1022858_1023470_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS99310.1|1023602_1024400_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS99311.1|1024798_1024924_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS99312.1|1025059_1025509_-	lipoprotein	NA	NA	NA	NA	NA
AYS99313.1|1025725_1026115_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS99314.1|1026101_1026383_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS99315.1|1026382_1026997_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS99316.1|1027215_1027470_+	hypothetical protein	NA	NA	NA	NA	NA
AYS99317.1|1027574_1027952_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS99318.1|1028015_1028276_+	hypothetical protein	NA	NA	NA	NA	NA
AYS99319.1|1028365_1029118_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS99320.1|1029083_1030487_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS99321.1|1030486_1031956_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS99322.1|1032047_1032578_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS99323.1|1032592_1033825_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS99324.1|1033829_1034327_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS99325.1|1034338_1035280_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS99326.1|1035321_1035690_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS99327.1|1035655_1036063_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS99328.1|1036059_1036614_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS99329.1|1036600_1036990_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS99330.1|1036964_1037528_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS99331.1|1037531_1038677_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS99332.1|1038688_1039129_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS99333.1|1039132_1039585_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS99334.1|1039762_1041715_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS99335.1|1041714_1042365_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS99336.1|1042368_1042671_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS99337.1|1042673_1043705_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS99338.1|1043701_1044037_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS99339.1|1044231_1044963_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS99340.1|1044962_1045391_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS99341.1|1045449_1046205_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS99342.1|1046292_1046430_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS99343.1|1046445_1046799_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS99344.1|1046799_1047999_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS99345.1|1047995_1048676_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS99346.1|1048675_1050187_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS99347.1|1050201_1050720_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS99348.1|1051641_1052343_-	hypothetical protein	NA	NA	NA	NA	NA
AYS99349.1|1052655_1052934_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS99350.1|1053359_1055972_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS99351.1|1056179_1057190_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS99352.1|1057352_1057898_+	hypothetical protein	NA	NA	NA	NA	NA
AYS99353.1|1057894_1059004_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS99354.1|1059102_1061211_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS99355.1|1061223_1063131_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061335:1061354	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS99356.1|1063145_1064399_+	inner membrane protein	NA	NA	NA	NA	NA
AYS99357.1|1064403_1066044_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS99358.1|1066040_1066604_+	lipoprotein	NA	NA	NA	NA	NA
AYS99359.1|1066857_1067025_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS99360.1|1067124_1067643_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS99361.1|1067711_1069472_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS99362.1|1069657_1070110_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS99363.1|1070181_1071234_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS99364.1|1071588_1072098_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS99365.1|1072314_1072920_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS99366.1|1072906_1075060_-	inner membrane protein	NA	NA	NA	NA	NA
AYS99367.1|1075078_1075525_-	hypothetical protein	NA	NA	NA	NA	NA
AYS99368.1|1075648_1077703_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS99369.1|1077738_1078197_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS99370.1|1078291_1078954_-	hypothetical protein	NA	NA	NA	NA	NA
AYS99371.1|1079124_1079541_+	hypothetical protein	NA	NA	NA	NA	NA
AYS99372.1|1079585_1079903_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS99373.1|1079960_1081172_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS99374.1|1082303_1082762_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS99375.1|1083498_1083780_+	acylphosphatase	NA	NA	NA	NA	NA
AYS99376.1|1083776_1084106_-	sulfite reductase	NA	NA	NA	NA	NA
AYS99377.1|1084192_1084852_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS99378.1|1085515_1085974_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029915	Salmonella enterica subsp. enterica serovar Typhi strain 343076_202113 chromosome, complete genome	4799269	1528792	1602390	4799269	plate,tail,head,protease,tRNA,transposase	Burkholderia_virus(44.12%)	72	NA	NA
AYS99778.1|1528792_1529251_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS99779.1|1529753_1530035_+	stress response protein	NA	NA	NA	NA	NA
AYS99780.1|1530303_1531125_+|protease	serine protease	protease	NA	NA	NA	NA
AYS99781.1|1531159_1531489_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS99782.1|1531475_1531838_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS99783.1|1531949_1532120_-	hypothetical protein	NA	NA	NA	NA	NA
AYS99784.1|1532254_1533289_+	hypothetical protein	NA	NA	NA	NA	NA
AYS99785.1|1533463_1534852_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS99786.1|1534862_1536392_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS99787.1|1536918_1537863_+	hypothetical protein	NA	NA	NA	NA	NA
AYS99788.1|1538044_1538434_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS99789.1|1538405_1538858_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS99790.1|1539052_1539283_-	hypothetical protein	NA	NA	NA	NA	NA
AYS99791.1|1539279_1539963_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS99792.1|1540547_1540850_-	hypothetical protein	NA	NA	NA	NA	NA
AYS99793.1|1541420_1541951_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS99794.1|1542250_1543417_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS99795.1|1543427_1545197_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS99796.1|1546641_1546992_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS99797.1|1547706_1548357_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS99798.1|1548679_1548991_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS99799.1|1548990_1549536_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS99800.1|1549532_1551128_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS99801.1|1551127_1552624_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS99802.1|1552604_1553426_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS99803.1|1553428_1553887_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS99804.1|1554101_1555217_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS99805.1|1555231_1556185_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS99806.1|1556194_1556533_+	hypothetical protein	NA	NA	NA	NA	NA
AYS99807.1|1556534_1556981_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS99808.1|1556980_1557445_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS99809.1|1557685_1559113_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS99810.1|1559112_1559634_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS99811.1|1559636_1559918_+	hypothetical protein	NA	NA	NA	NA	NA
AYS99812.1|1560015_1560351_+	hypothetical protein	NA	NA	NA	NA	NA
AYS99813.1|1560526_1562992_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS99814.1|1562991_1563876_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS99815.1|1563872_1564088_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS99816.1|1564075_1565230_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS99817.1|1565226_1565754_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS99818.1|1565810_1566158_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS99819.1|1566148_1567252_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS99820.1|1567244_1567823_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS99821.1|1567825_1568851_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	52.9	1.1e-63
AYS99822.1|1569364_1569982_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS99823.1|1571492_1572065_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYS99824.1|1572345_1573728_+	amino acid permease	NA	NA	NA	NA	NA
AYS99825.1|1573789_1574125_-	hypothetical protein	NA	NA	NA	NA	NA
AYS99826.1|1574251_1574983_+	two-component response regulator	NA	NA	NA	NA	NA
AYS99827.1|1575463_1576615_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYS99828.1|1576767_1578474_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYS99829.1|1578581_1579886_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYS99830.1|1579961_1580891_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYS99831.1|1580887_1582291_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYS99832.1|1582458_1584105_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYS99833.1|1584304_1585480_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYS99834.1|1585582_1587091_+	hypothetical protein	NA	NA	NA	NA	NA
AYS99835.1|1587796_1588798_+	adenosine deaminase	NA	NA	NA	NA	NA
AYS99836.1|1588871_1589987_-	oxidoreductase	NA	NA	NA	NA	NA
AYS99837.1|1590089_1590245_+	hypothetical protein	NA	NA	NA	NA	NA
AYS99838.1|1590543_1590759_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYS99839.1|1590847_1591288_+	hypothetical protein	NA	NA	NA	NA	NA
AYS99840.1|1591364_1591946_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYS99841.1|1591945_1592524_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYS99842.1|1592516_1594538_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYS99843.1|1594538_1595597_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYS99844.1|1595600_1596221_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYS99845.1|1596223_1596916_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYS99846.1|1596915_1597551_+	endonuclease III	NA	NA	NA	NA	NA
AYS99847.1|1598151_1599657_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYS99848.1|1599761_1600367_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYS99849.1|1601115_1602390_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029915	Salmonella enterica subsp. enterica serovar Typhi strain 343076_202113 chromosome, complete genome	4799269	1783427	1787839	4799269		Escherichia_phage(50.0%)	6	NA	NA
AYT00034.1|1783427_1783667_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYT00035.1|1784539_1785349_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYT00036.1|1785421_1785799_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYT00037.1|1785946_1786489_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYT00038.1|1786680_1787409_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYT00039.1|1787425_1787839_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029915	Salmonella enterica subsp. enterica serovar Typhi strain 343076_202113 chromosome, complete genome	4799269	1991693	1998927	4799269		Morganella_phage(33.33%)	7	NA	NA
AYT00230.1|1991693_1993124_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYT00231.1|1993197_1993893_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYT00232.1|1993972_1994284_-	hypothetical protein	NA	NA	NA	NA	NA
AYT00233.1|1994934_1996119_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYT00234.1|1996578_1996791_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYT00235.1|1997236_1998505_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYT00236.1|1998507_1998927_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029915	Salmonella enterica subsp. enterica serovar Typhi strain 343076_202113 chromosome, complete genome	4799269	2105227	2115734	4799269		Enterobacteria_phage(37.5%)	10	NA	NA
AYT00333.1|2105227_2106541_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYT00334.1|2106567_2107647_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYT00335.1|2107651_2108425_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYT00336.1|2108440_2109415_-	reductase RfbI	NA	NA	NA	NA	NA
AYT00337.1|2109420_2109972_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYT00338.1|2109972_2110851_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYT00339.1|2110898_2111798_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYT00340.1|2111797_2112883_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYT00341.1|2113259_2114153_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYT00342.1|2114330_2115734_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029915	Salmonella enterica subsp. enterica serovar Typhi strain 343076_202113 chromosome, complete genome	4799269	2191625	2200796	4799269	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYT00401.1|2191625_2193659_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYT00402.1|2193899_2194358_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYT00403.1|2194529_2195060_+	lipoprotein	NA	NA	NA	NA	NA
AYT00404.1|2195116_2195584_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYT00405.1|2195630_2196350_-	two-component system response regulator	NA	NA	NA	NA	NA
AYT00406.1|2196346_2198032_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYT00407.1|2198254_2198986_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYT00408.1|2199045_2199153_+	hypothetical protein	NA	NA	NA	NA	NA
AYT00409.1|2199133_2199865_-	ABC transporter permease	NA	NA	NA	NA	NA
AYT00410.1|2199848_2200796_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029915	Salmonella enterica subsp. enterica serovar Typhi strain 343076_202113 chromosome, complete genome	4799269	2736232	2749624	4799269	tail	Salmonella_phage(70.0%)	11	NA	NA
AYT00839.1|2736232_2736451_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYT00840.1|2736541_2737642_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT00841.1|2737638_2738124_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT00842.1|2738120_2741198_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYT00843.1|2741190_2741310_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT00844.1|2741324_2741627_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT00845.1|2741681_2742197_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT00846.1|2742206_2743379_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT00847.1|2743521_2744094_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT00848.1|2744771_2745887_+	glycosyltransferase	NA	NA	NA	NA	NA
AYT00849.1|2745967_2749624_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029915	Salmonella enterica subsp. enterica serovar Typhi strain 343076_202113 chromosome, complete genome	4799269	3066372	3110075	4799269	bacteriocin,protease,tRNA,transposase	Bacillus_virus(33.33%)	44	NA	NA
AYT01136.1|3066372_3066831_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT01137.1|3067020_3068100_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYT01138.1|3068201_3069365_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYT01139.1|3069386_3070433_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYT01140.1|3070806_3071232_+	hypothetical protein	NA	NA	NA	NA	NA
AYT01141.1|3071257_3071836_+	hypothetical protein	NA	NA	NA	NA	NA
AYT01142.1|3071869_3072544_+	hypothetical protein	NA	NA	NA	NA	NA
AYT01143.1|3072525_3073209_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYT01144.1|3073202_3073859_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYT01145.1|3073963_3074422_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT01146.1|3074610_3076602_-	transketolase	NA	NA	NA	NA	NA
AYT01147.1|3076877_3077636_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYT01148.1|3077736_3078657_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYT01149.1|3078884_3080861_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYT01150.1|3080869_3081001_-	hypothetical protein	NA	NA	NA	NA	NA
AYT01151.1|3081295_3081595_-	membrane protein	NA	NA	NA	NA	NA
AYT01152.1|3081650_3082805_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYT01153.1|3083297_3084692_+	galactose-proton symport	NA	NA	NA	NA	NA
AYT01154.1|3084770_3085268_+	hypothetical protein	NA	NA	NA	NA	NA
AYT01155.1|3085363_3086071_+	endonuclease I	NA	NA	NA	NA	NA
AYT01156.1|3086147_3086879_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYT01157.1|3086898_3087846_+	glutathione synthetase	NA	NA	NA	NA	NA
AYT01158.1|3088061_3088625_+	hypothetical protein	NA	NA	NA	NA	NA
AYT01159.1|3088624_3089041_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYT01160.1|3089087_3089774_-	global regulatory protein	NA	NA	NA	NA	NA
AYT01161.1|3089903_3090884_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYT01162.1|3090901_3091606_+	hypothetical protein	NA	NA	NA	NA	NA
AYT01163.1|3091624_3092191_+	hypothetical protein	NA	NA	NA	NA	NA
AYT01164.1|3092187_3092478_+	hypothetical protein	NA	NA	NA	NA	NA
AYT01165.1|3092485_3093079_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYT01166.1|3093071_3094208_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYT01167.1|3094298_3095306_-	hypothetical protein	NA	NA	NA	NA	NA
AYT01168.1|3095438_3096485_-	L-asparaginase	NA	NA	NA	NA	NA
AYT01169.1|3096803_3097262_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYT01170.1|3097384_3098104_-	hypothetical protein	NA	NA	NA	NA	NA
AYT01171.1|3098153_3098480_-	hypothetical protein	NA	NA	NA	NA	NA
AYT01172.1|3098479_3099199_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYT01173.1|3099353_3100406_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYT01174.1|3100433_3100709_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYT01175.1|3100821_3101907_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYT01176.1|3102123_3103380_+	nucleoside permease	NA	NA	NA	NA	NA
AYT01177.1|3105990_3106698_+	hypothetical protein	NA	NA	NA	NA	NA
AYT01178.1|3109287_3109554_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYT01179.1|3109796_3110075_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029915	Salmonella enterica subsp. enterica serovar Typhi strain 343076_202113 chromosome, complete genome	4799269	3488009	3526067	4799269	plate,terminase,portal,tail,capsid,integrase,transposase	Salmonella_phage(82.05%)	46	3482973:3482987	3495139:3495153
3482973:3482987	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYT01508.1|3488009_3489656_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYT01509.1|3489795_3489894_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYT01510.1|3490149_3490479_+	hypothetical protein	NA	NA	NA	NA	NA
AYT01511.1|3490519_3491572_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYT01512.1|3491967_3492537_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYT01513.1|3492662_3492884_+	hypothetical protein	NA	NA	NA	NA	NA
AYT01514.1|3492916_3493426_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYT01515.1|3493600_3493825_+	hypothetical protein	NA	NA	NA	NA	NA
AYT01516.1|3493847_3494189_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYT01517.1|3494256_3494490_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYT01518.1|3494489_3494717_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYT01519.1|3494713_3495571_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3495139:3495153	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYT01520.1|3495567_3497982_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYT01521.1|3498135_3498324_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYT01522.1|3500291_3501206_+	hypothetical protein	NA	NA	NA	NA	NA
AYT01523.1|3501202_3501943_+	hypothetical protein	NA	NA	NA	NA	NA
AYT01524.1|3501977_3503015_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYT01525.1|3503014_3504781_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYT01526.1|3504923_3505757_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYT01527.1|3505773_3506832_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYT01528.1|3506835_3507486_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYT01529.1|3507518_3508046_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYT01530.1|3508045_3508249_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYT01531.1|3508252_3508468_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYT01532.1|3508487_3508961_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYT01533.1|3508962_3509340_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYT01534.1|3509336_3509765_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYT01535.1|3509860_3510292_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYT01536.1|3510284_3510731_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYT01537.1|3510799_3511378_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYT01538.1|3511374_3511734_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYT01539.1|3511720_3512629_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYT01540.1|3512621_3513227_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT01541.1|3513223_3514738_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYT01542.1|3514737_3515331_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYT01543.1|3515302_3515743_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYT01544.1|3516165_3516738_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYT01545.1|3516880_3518053_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYT01546.1|3518062_3518578_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYT01547.1|3518632_3518935_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYT01548.1|3518949_3519069_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYT01549.1|3519061_3522139_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYT01550.1|3522135_3522621_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYT01551.1|3522617_3523718_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYT01552.1|3523808_3524027_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYT01553.1|3525608_3526067_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029915	Salmonella enterica subsp. enterica serovar Typhi strain 343076_202113 chromosome, complete genome	4799269	4459021	4533185	4799269	plate,terminase,portal,tail,capsid,integrase	Salmonella_phage(82.98%)	76	4520522:4520538	4533344:4533360
AYT02344.1|4459021_4460971_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYT02345.1|4461042_4461951_+	hypothetical protein	NA	NA	NA	NA	NA
AYT02346.1|4462024_4462924_+	hypothetical protein	NA	NA	NA	NA	NA
AYT02347.1|4462965_4463325_+	hypothetical protein	NA	NA	NA	NA	NA
AYT02348.1|4463424_4463694_-	hypothetical protein	NA	NA	NA	NA	NA
AYT02349.1|4463825_4465100_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYT02350.1|4465319_4465697_+	hypothetical protein	NA	NA	NA	NA	NA
AYT02351.1|4465783_4466002_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYT02352.1|4466069_4467170_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYT02353.1|4467166_4467652_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYT02354.1|4467651_4470432_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYT02355.1|4470424_4470544_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYT02356.1|4470558_4470861_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYT02357.1|4470915_4471431_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYT02358.1|4471440_4472613_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYT02359.1|4473147_4473870_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYT02360.1|4474067_4474475_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYT02361.1|4474481_4476101_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYT02362.1|4476097_4476703_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYT02363.1|4476695_4477604_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYT02364.1|4477590_4477950_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYT02365.1|4477946_4478525_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYT02366.1|4478593_4479040_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYT02367.1|4479032_4479464_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYT02368.1|4479559_4479985_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYT02369.1|4479984_4480362_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYT02370.1|4480366_4480837_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYT02371.1|4480856_4481072_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYT02372.1|4481075_4481279_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYT02373.1|4481278_4481743_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYT02374.1|4481836_4482487_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYT02375.1|4482490_4483555_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYT02376.1|4483571_4484405_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYT02377.1|4484547_4486314_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYT02378.1|4486310_4487357_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYT02379.1|4487405_4488101_-	hypothetical protein	NA	NA	NA	NA	NA
AYT02380.1|4488120_4489185_-	hypothetical protein	NA	NA	NA	NA	NA
AYT02381.1|4489181_4490246_-	hypothetical protein	NA	NA	NA	NA	NA
AYT02382.1|4491170_4491500_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYT02383.1|4491496_4493566_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYT02384.1|4493556_4494417_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYT02385.1|4494413_4494998_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYT02386.1|4494994_4495222_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYT02387.1|4495221_4495455_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYT02388.1|4495522_4495864_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYT02389.1|4495827_4496028_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYT02390.1|4496035_4496545_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYT02391.1|4496577_4496820_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYT02392.1|4496936_4497569_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYT02393.1|4497572_4498598_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYT02394.1|4498704_4499058_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYT02395.1|4499674_4499962_+	hypothetical protein	NA	NA	NA	NA	NA
AYT02396.1|4499972_4500863_+	methyltransferase	NA	NA	NA	NA	NA
AYT02397.1|4500862_4501609_+	hypothetical protein	NA	NA	NA	NA	NA
AYT02398.1|4501910_4503881_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT02399.1|4503900_4505205_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT02400.1|4505227_4505923_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYT02401.1|4505948_4506743_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYT02402.1|4506752_4507820_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYT02403.1|4507864_4509601_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYT02404.1|4509600_4512096_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT02405.1|4512119_4513166_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYT02406.1|4513168_4514446_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYT02407.1|4514690_4515230_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYT02408.1|4516083_4517595_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYT02409.1|4517578_4519168_+	hypothetical protein	NA	NA	NA	NA	NA
AYT02410.1|4519331_4520345_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4520522:4520538	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYT02411.1|4520771_4521065_+	hypothetical protein	NA	NA	NA	NA	NA
AYT02412.1|4521061_4521550_+	hypothetical protein	NA	NA	NA	NA	NA
AYT02413.1|4521729_4522182_-	hypothetical protein	NA	NA	NA	NA	NA
AYT02414.1|4527404_4527866_+	hypothetical protein	NA	NA	NA	NA	NA
AYT02415.1|4527862_4528084_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYT02416.1|4528940_4529723_+	hypothetical protein	NA	NA	NA	NA	NA
AYT02417.1|4530349_4530574_-	hypothetical protein	NA	NA	NA	NA	NA
AYT02418.1|4530703_4531615_-	hypothetical protein	NA	NA	NA	NA	NA
AYT02419.1|4531925_4533185_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4533344:4533360	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029915	Salmonella enterica subsp. enterica serovar Typhi strain 343076_202113 chromosome, complete genome	4799269	4675437	4685696	4799269	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYT02556.1|4675437_4676514_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYT02557.1|4676510_4677584_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYT02558.1|4677558_4678722_-	hypothetical protein	NA	NA	NA	NA	NA
AYT02559.1|4678997_4679564_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYT02560.1|4679579_4679819_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYT02561.1|4679822_4680683_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYT02562.1|4681105_4681429_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYT02563.1|4681412_4681913_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYT02564.1|4681909_4682137_+	hypothetical protein	NA	NA	NA	NA	NA
AYT02565.1|4682133_4682454_+	P4 phage protein	NA	NA	NA	NA	NA
AYT02566.1|4682468_4683143_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYT02567.1|4683139_4684801_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYT02568.1|4685537_4685696_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029916	Salmonella enterica subsp. enterica serovar Typhi strain 343076_202113 plasmid pHCM2, complete sequence	106706	16	55439	106706		Salmonella_phage(96.92%)	68	NA	NA
AYT02659.1|16_994_+	hypothetical protein	NA	J9Q7I4	Salmonella_phage	99.4	1.5e-179
AYT02660.1|996_1275_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AYT02661.1|1334_1757_+	putative lipoprotein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
AYT02662.1|1761_2289_+	putative transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
AYT02663.1|2923_3574_+	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
AYT02664.1|3658_3886_+	hypothetical protein	NA	NA	NA	NA	NA
AYT02665.1|4517_5000_-	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
AYT02666.1|5205_5493_-	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
AYT02667.1|5613_6006_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
AYT02668.1|6134_6446_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
AYT02669.1|6522_6837_-	hypothetical protein	NA	NA	NA	NA	NA
AYT02670.1|6931_7150_-	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AYT02671.1|7160_7376_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
AYT02672.1|7518_7764_+	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
AYT02673.1|9200_10391_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
AYT02674.1|10400_10718_-	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
AYT02675.1|10802_11084_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
AYT02676.1|11257_11461_+	hypothetical protein	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
AYT02677.1|11521_11809_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
AYT02678.1|11805_12114_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
AYT02679.1|12125_12668_-	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
AYT02680.1|12664_13306_-	hypothetical protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
AYT02681.1|13397_13769_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
AYT02682.1|13879_14053_-	hypothetical protein	NA	J9Q801	Salmonella_phage	98.2	9.5e-26
AYT02683.1|14049_14739_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
AYT02684.1|14797_16501_-	putative DNA modification methylase	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
AYT02685.1|16624_17197_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AYT02686.1|17305_18148_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AYT02687.1|18256_18445_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AYT02688.1|18454_18949_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
AYT02689.1|19091_19700_-	putative ribonuclease H	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AYT02690.1|20285_20516_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AYT02691.1|20718_21312_-	hypothetical protein	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
AYT02692.1|21497_22424_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.1e-107
AYT02693.1|22468_23026_-	hypothetical protein	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AYT02694.1|23035_23455_-	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
AYT02695.1|23518_24163_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AYT02696.1|24162_24639_-	hypothetical protein	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AYT02697.1|24635_25049_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AYT02698.1|25050_26166_-	putative thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
AYT02699.1|26281_27211_-	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
AYT02700.1|27293_28436_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
AYT02701.1|28543_30859_-	ribonucleotide-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AYT02702.1|30936_31506_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
AYT02703.1|31518_32265_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
AYT02704.1|32254_34171_-	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AYT02705.1|34167_34404_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AYT02706.1|34400_35486_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
AYT02707.1|35912_36218_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.0	2.0e-50
AYT02708.1|36249_36744_-	hypothetical protein	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
AYT02709.1|36819_37464_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
AYT02710.1|38208_39264_+	putative replication protein A	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
AYT02711.1|39792_39996_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
AYT02712.1|39995_40301_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
AYT02713.1|40341_40617_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
AYT02714.1|40685_41096_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
AYT02715.1|41079_41451_-	hypothetical protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
AYT02716.1|41613_42456_-	putative lipoprotein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
AYT02717.1|42751_43828_-	putative recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AYT02718.1|43830_44097_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYT02719.1|44096_45041_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
AYT02720.1|45101_46130_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
AYT02721.1|46249_46681_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
AYT02722.1|46926_47517_+	hypothetical protein	NA	NA	NA	NA	NA
AYT02723.1|47610_48054_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.0e-71
AYT02724.1|48050_51569_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
AYT02725.1|51749_52985_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
AYT02726.1|53081_55439_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	90.7	0.0e+00
>prophage 2
CP029916	Salmonella enterica subsp. enterica serovar Typhi strain 343076_202113 plasmid pHCM2, complete sequence	106706	63929	106058	106706	tail	Salmonella_phage(93.33%)	45	NA	NA
AYT02739.1|63929_64235_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
AYT02740.1|64231_64384_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
AYT02741.1|64383_64590_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
AYT02742.1|64755_66078_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
AYT02743.1|66112_66370_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
AYT02744.1|66670_67465_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
AYT02745.1|67648_68701_+	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
AYT02746.1|68702_69914_-	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
AYT02747.1|69976_71317_-	putative DNA helicase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
AYT02748.1|71377_72103_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
AYT02749.1|72380_73436_+	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
AYT02750.1|73505_74261_-	hypothetical protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
AYT02751.1|74309_74669_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AYT02752.1|74668_75334_-	hypothetical protein	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
AYT02753.1|75664_76216_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
AYT02754.1|76266_76611_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.6	5.9e-27
AYT02755.1|76679_77399_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	1.5e-125
AYT02756.1|77385_77709_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
AYT02757.1|77823_80376_-	hypothetical protein	NA	A0A0A0YQM3	Citrobacter_virus	52.5	1.4e-152
AYT02758.1|80458_84847_-|tail	putative phage tail protein	tail	J9Q713	Salmonella_phage	86.7	0.0e+00
AYT02759.1|84861_85449_-|tail	putative phage tail protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
AYT02760.1|85436_86234_-	hypothetical protein	NA	J9Q7R4	Salmonella_phage	95.8	1.2e-155
AYT02761.1|86226_86958_-|tail	putative phage tail protein	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
AYT02762.1|87014_87350_-	hypothetical protein	NA	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AYT02763.1|87391_91975_-	hypothetical protein	NA	J9Q712	Salmonella_phage	92.9	0.0e+00
AYT02764.1|91982_92252_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AYT02765.1|92332_92650_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYT02766.1|92709_93456_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
AYT02767.1|93530_93914_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AYT02768.1|93915_94389_-	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AYT02769.1|94379_94724_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AYT02770.1|94821_95655_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
AYT02771.1|95654_96089_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
AYT02772.1|96132_97056_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
AYT02773.1|97130_98006_-	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
AYT02774.1|98032_98929_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
AYT02775.1|98951_100526_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
AYT02776.1|100559_101816_-	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
AYT02777.1|101818_102460_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.5	1.8e-109
AYT02778.1|102655_102922_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AYT02779.1|102931_103831_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
AYT02780.1|103827_104082_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AYT02781.1|104074_104713_-	putative ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	99.1	5.5e-111
AYT02782.1|104709_105378_-	hypothetical protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
AYT02783.1|105377_106058_-	hypothetical protein	NA	J9Q756	Salmonella_phage	99.6	7.4e-122
