The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029922	Salmonella enterica subsp. enterica serovar Typhi strain 311189_269186 chromosome, complete genome	4782083	1008493	1085805	4782083	integrase,protease,transposase,tail,terminase	Salmonella_phage(73.33%)	93	990559:990578	1061166:1061185
990559:990578	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS86341.1|1008493_1009834_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS86342.1|1009830_1010079_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS86343.1|1010119_1010365_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS86344.1|1010364_1011246_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS86345.1|1011242_1012307_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS86346.1|1012384_1013065_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS86347.1|1013061_1013847_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS86348.1|1013852_1014149_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS86349.1|1014239_1014440_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS86350.1|1014728_1015133_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS86351.1|1015464_1015839_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS86352.1|1015923_1016907_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS86353.1|1016909_1017659_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS86354.1|1017669_1018017_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYS86355.1|1018013_1018538_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS86356.1|1018537_1019011_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS86357.1|1019014_1019587_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS86358.1|1019680_1019947_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS86359.1|1020028_1020190_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS86360.1|1020622_1021120_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS86361.1|1021304_1021544_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS86362.1|1021533_1021839_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS86363.1|1021878_1022481_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS86364.1|1022689_1023301_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS86365.1|1023433_1024231_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS86366.1|1024629_1024755_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS86367.1|1024890_1025340_-	lipoprotein	NA	NA	NA	NA	NA
AYS86368.1|1025556_1025946_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS86369.1|1025932_1026214_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS86370.1|1026213_1026828_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS86371.1|1027046_1027301_+	hypothetical protein	NA	NA	NA	NA	NA
AYS86372.1|1027405_1027783_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS86373.1|1027846_1028107_+	hypothetical protein	NA	NA	NA	NA	NA
AYS86374.1|1028196_1028949_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS86375.1|1028914_1030318_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS86376.1|1030317_1031787_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS86377.1|1031878_1032409_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS86378.1|1032423_1033656_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS86379.1|1033660_1034158_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS86380.1|1034169_1035111_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS86381.1|1035152_1035521_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS86382.1|1035486_1035894_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS86383.1|1035890_1036445_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS86384.1|1036431_1036821_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS86385.1|1036795_1037359_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS86386.1|1037362_1038508_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS86387.1|1038519_1038960_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS86388.1|1038963_1039416_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS86389.1|1039593_1041546_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS86390.1|1041545_1042196_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS86391.1|1042199_1042502_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS86392.1|1042504_1043536_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS86393.1|1043532_1043868_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS86394.1|1044062_1044794_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS86395.1|1044793_1045222_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS86396.1|1045280_1046036_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS86397.1|1046123_1046261_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS86398.1|1046276_1046630_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS86399.1|1046630_1047830_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS86400.1|1047826_1048507_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS86401.1|1048506_1050018_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS86402.1|1050032_1050551_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS86403.1|1051472_1052174_-	hypothetical protein	NA	NA	NA	NA	NA
AYS86404.1|1052486_1052765_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS86405.1|1053190_1055803_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS86406.1|1056010_1057021_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS86407.1|1057183_1057729_+	hypothetical protein	NA	NA	NA	NA	NA
AYS86408.1|1057725_1058835_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS86409.1|1058933_1061042_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS86410.1|1061054_1062962_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061166:1061185	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS86411.1|1062976_1064230_+	inner membrane protein	NA	NA	NA	NA	NA
AYS86412.1|1064234_1065875_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS86413.1|1065871_1066435_+	lipoprotein	NA	NA	NA	NA	NA
AYS86414.1|1066688_1066856_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS86415.1|1066955_1067474_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS86416.1|1067542_1069303_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS86417.1|1069488_1069941_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS86418.1|1070012_1071065_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS86419.1|1071419_1071929_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS86420.1|1072145_1072751_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS86421.1|1072737_1074891_-	inner membrane protein	NA	NA	NA	NA	NA
AYS86422.1|1074909_1075356_-	hypothetical protein	NA	NA	NA	NA	NA
AYS86423.1|1075479_1077534_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS86424.1|1077569_1078028_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS86425.1|1078122_1078785_-	hypothetical protein	NA	NA	NA	NA	NA
AYS86426.1|1078955_1079372_+	hypothetical protein	NA	NA	NA	NA	NA
AYS86427.1|1079416_1079734_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS86428.1|1079791_1081003_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS86429.1|1082134_1082593_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS86430.1|1083329_1083611_+	acylphosphatase	NA	NA	NA	NA	NA
AYS86431.1|1083607_1083937_-	sulfite reductase	NA	NA	NA	NA	NA
AYS86432.1|1084023_1084683_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS86433.1|1085346_1085805_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 2
CP029922	Salmonella enterica subsp. enterica serovar Typhi strain 311189_269186 chromosome, complete genome	4782083	1528623	1602221	4782083	head,tRNA,plate,protease,transposase,tail	Burkholderia_virus(44.12%)	72	NA	NA
AYS86832.1|1528623_1529082_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS86833.1|1529584_1529866_+	stress response protein	NA	NA	NA	NA	NA
AYS86834.1|1530134_1530956_+|protease	serine protease	protease	NA	NA	NA	NA
AYS86835.1|1530990_1531320_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS86836.1|1531306_1531669_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS86837.1|1531780_1531951_-	hypothetical protein	NA	NA	NA	NA	NA
AYS86838.1|1532085_1533120_+	hypothetical protein	NA	NA	NA	NA	NA
AYS86839.1|1533294_1534683_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS86840.1|1534693_1536223_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS86841.1|1536749_1537694_+	hypothetical protein	NA	NA	NA	NA	NA
AYS86842.1|1537875_1538265_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS86843.1|1538236_1538689_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS86844.1|1538883_1539114_-	hypothetical protein	NA	NA	NA	NA	NA
AYS86845.1|1539110_1539794_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS86846.1|1540378_1540681_-	hypothetical protein	NA	NA	NA	NA	NA
AYS86847.1|1541251_1541782_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS86848.1|1542081_1543248_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS86849.1|1543258_1545028_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS86850.1|1546472_1546823_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS86851.1|1547537_1548188_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS86852.1|1548510_1548822_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS86853.1|1548821_1549367_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS86854.1|1549363_1550959_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS86855.1|1550958_1552455_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS86856.1|1552435_1553257_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS86857.1|1553259_1553718_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS86858.1|1553932_1555048_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS86859.1|1555062_1556016_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS86860.1|1556025_1556364_+	hypothetical protein	NA	NA	NA	NA	NA
AYS86861.1|1556365_1556812_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS86862.1|1556811_1557276_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS86863.1|1557516_1558944_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS86864.1|1558943_1559465_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS86865.1|1559467_1559749_+	hypothetical protein	NA	NA	NA	NA	NA
AYS86866.1|1559846_1560182_+	hypothetical protein	NA	NA	NA	NA	NA
AYS86867.1|1560357_1562823_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS86868.1|1562822_1563707_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS86869.1|1563703_1563919_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS86870.1|1563906_1565061_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS86871.1|1565057_1565585_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS86872.1|1565641_1565989_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS86873.1|1565979_1567083_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS86874.1|1567075_1567654_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS86875.1|1567656_1568682_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYS86876.1|1569195_1569813_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS86877.1|1571323_1571896_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYS86878.1|1572176_1573559_+	amino acid permease	NA	NA	NA	NA	NA
AYS86879.1|1573620_1573956_-	hypothetical protein	NA	NA	NA	NA	NA
AYS86880.1|1574082_1574814_+	two-component response regulator	NA	NA	NA	NA	NA
AYS86881.1|1575294_1576446_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYS86882.1|1576598_1578305_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYS86883.1|1578412_1579717_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYS86884.1|1579792_1580722_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYS86885.1|1580718_1582122_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYS86886.1|1582289_1583936_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYS86887.1|1584135_1585311_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYS86888.1|1585413_1586922_+	hypothetical protein	NA	NA	NA	NA	NA
AYS86889.1|1587627_1588629_+	adenosine deaminase	NA	NA	NA	NA	NA
AYS86890.1|1588702_1589818_-	oxidoreductase	NA	NA	NA	NA	NA
AYS86891.1|1589920_1590076_+	hypothetical protein	NA	NA	NA	NA	NA
AYS86892.1|1590374_1590590_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYS86893.1|1590678_1591119_+	hypothetical protein	NA	NA	NA	NA	NA
AYS86894.1|1591195_1591777_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYS86895.1|1591776_1592355_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYS86896.1|1592347_1594369_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYS86897.1|1594369_1595428_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYS86898.1|1595431_1596052_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYS86899.1|1596054_1596747_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYS86900.1|1596746_1597382_+	endonuclease III	NA	NA	NA	NA	NA
AYS86901.1|1597982_1599488_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYS86902.1|1599592_1600198_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYS86903.1|1600946_1602221_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 3
CP029922	Salmonella enterica subsp. enterica serovar Typhi strain 311189_269186 chromosome, complete genome	4782083	1783258	1787670	4782083		Escherichia_phage(50.0%)	6	NA	NA
AYS87087.1|1783258_1783498_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYS87088.1|1784370_1785180_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS87089.1|1785252_1785630_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS87090.1|1785777_1786320_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS87091.1|1786511_1787240_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS87092.1|1787256_1787670_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 4
CP029922	Salmonella enterica subsp. enterica serovar Typhi strain 311189_269186 chromosome, complete genome	4782083	1991523	1998757	4782083		Morganella_phage(33.33%)	7	NA	NA
AYS87282.1|1991523_1992954_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYS87283.1|1993027_1993723_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYS87284.1|1993802_1994114_-	hypothetical protein	NA	NA	NA	NA	NA
AYS87285.1|1994764_1995949_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYS87286.1|1996408_1996621_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYS87287.1|1997066_1998335_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYS87288.1|1998337_1998757_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 5
CP029922	Salmonella enterica subsp. enterica serovar Typhi strain 311189_269186 chromosome, complete genome	4782083	2105057	2115564	4782083		Enterobacteria_phage(37.5%)	10	NA	NA
AYS87385.1|2105057_2106371_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS87386.1|2106397_2107477_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS87387.1|2107481_2108255_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS87388.1|2108270_2109245_-	reductase RfbI	NA	NA	NA	NA	NA
AYS87389.1|2109250_2109802_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS87390.1|2109802_2110681_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS87391.1|2110728_2111628_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS87392.1|2111627_2112713_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS87393.1|2113089_2113983_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS87394.1|2114160_2115564_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 6
CP029922	Salmonella enterica subsp. enterica serovar Typhi strain 311189_269186 chromosome, complete genome	4782083	2191455	2200626	4782083	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS87453.1|2191455_2193489_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS87454.1|2193729_2194188_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS87455.1|2194359_2194890_+	lipoprotein	NA	NA	NA	NA	NA
AYS87456.1|2194946_2195414_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS87457.1|2195460_2196180_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS87458.1|2196176_2197862_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS87459.1|2198084_2198816_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS87460.1|2198875_2198983_+	hypothetical protein	NA	NA	NA	NA	NA
AYS87461.1|2198963_2199695_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS87462.1|2199678_2200626_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 7
CP029922	Salmonella enterica subsp. enterica serovar Typhi strain 311189_269186 chromosome, complete genome	4782083	2736142	2749534	4782083	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS87891.1|2736142_2736361_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS87892.1|2736451_2737552_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS87893.1|2737548_2738034_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS87894.1|2738030_2741108_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS87895.1|2741100_2741220_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS87896.1|2741234_2741537_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS87897.1|2741591_2742107_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS87898.1|2742116_2743289_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS87899.1|2743431_2744004_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS87900.1|2744681_2745797_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS87901.1|2745877_2749534_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 8
CP029922	Salmonella enterica subsp. enterica serovar Typhi strain 311189_269186 chromosome, complete genome	4782083	3066695	3110398	4782083	bacteriocin,transposase,tRNA,protease	Bacillus_virus(33.33%)	44	NA	NA
AYS88188.1|3066695_3067154_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS88189.1|3067343_3068423_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS88190.1|3068524_3069688_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS88191.1|3069709_3070756_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS88192.1|3071129_3071555_+	hypothetical protein	NA	NA	NA	NA	NA
AYS88193.1|3071580_3072159_+	hypothetical protein	NA	NA	NA	NA	NA
AYS88194.1|3072192_3072867_+	hypothetical protein	NA	NA	NA	NA	NA
AYS88195.1|3072848_3073532_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS88196.1|3073525_3074182_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS88197.1|3074286_3074745_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS88198.1|3074933_3076925_-	transketolase	NA	NA	NA	NA	NA
AYS88199.1|3077200_3077959_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS88200.1|3078059_3078980_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS88201.1|3079207_3081184_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS88202.1|3081192_3081324_-	hypothetical protein	NA	NA	NA	NA	NA
AYS88203.1|3081618_3081918_-	membrane protein	NA	NA	NA	NA	NA
AYS88204.1|3081973_3083128_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS88205.1|3083620_3085015_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS88206.1|3085093_3085591_+	hypothetical protein	NA	NA	NA	NA	NA
AYS88207.1|3085686_3086394_+	endonuclease I	NA	NA	NA	NA	NA
AYS88208.1|3086470_3087202_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS88209.1|3087221_3088169_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS88210.1|3088384_3088948_+	hypothetical protein	NA	NA	NA	NA	NA
AYS88211.1|3088947_3089364_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS88212.1|3089410_3090097_-	global regulatory protein	NA	NA	NA	NA	NA
AYS88213.1|3090226_3091207_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS88214.1|3091224_3091929_+	hypothetical protein	NA	NA	NA	NA	NA
AYS88215.1|3091947_3092514_+	hypothetical protein	NA	NA	NA	NA	NA
AYS88216.1|3092510_3092801_+	hypothetical protein	NA	NA	NA	NA	NA
AYS88217.1|3092808_3093402_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS88218.1|3093394_3094531_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS88219.1|3094621_3095629_-	hypothetical protein	NA	NA	NA	NA	NA
AYS88220.1|3095761_3096808_-	L-asparaginase	NA	NA	NA	NA	NA
AYS88221.1|3097126_3097585_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS88222.1|3097707_3098427_-	hypothetical protein	NA	NA	NA	NA	NA
AYS88223.1|3098476_3098803_-	hypothetical protein	NA	NA	NA	NA	NA
AYS88224.1|3098802_3099522_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS88225.1|3099676_3100729_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS88226.1|3100756_3101032_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS88227.1|3101144_3102230_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS88228.1|3102446_3103703_+	nucleoside permease	NA	NA	NA	NA	NA
AYS88229.1|3106313_3107021_+	hypothetical protein	NA	NA	NA	NA	NA
AYS88230.1|3109610_3109877_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS88231.1|3110119_3110398_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 9
CP029922	Salmonella enterica subsp. enterica serovar Typhi strain 311189_269186 chromosome, complete genome	4782083	3488249	3526307	4782083	portal,integrase,plate,capsid,transposase,tail,terminase	Salmonella_phage(82.05%)	46	3483213:3483227	3495379:3495393
3483213:3483227	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS88560.1|3488249_3489896_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS88561.1|3490035_3490134_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS88562.1|3490389_3490719_+	hypothetical protein	NA	NA	NA	NA	NA
AYS88563.1|3490759_3491812_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS88564.1|3492207_3492777_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS88565.1|3492902_3493124_+	hypothetical protein	NA	NA	NA	NA	NA
AYS88566.1|3493156_3493666_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS88567.1|3493840_3494065_+	hypothetical protein	NA	NA	NA	NA	NA
AYS88568.1|3494087_3494429_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS88569.1|3494496_3494730_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS88570.1|3494729_3494957_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS88571.1|3494953_3495811_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3495379:3495393	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS88572.1|3495807_3498222_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS88573.1|3498375_3498564_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS88574.1|3500531_3501446_+	hypothetical protein	NA	NA	NA	NA	NA
AYS88575.1|3501442_3502183_+	hypothetical protein	NA	NA	NA	NA	NA
AYS88576.1|3502217_3503255_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS88577.1|3503254_3505021_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS88578.1|3505163_3505997_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS88579.1|3506013_3507072_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS88580.1|3507075_3507726_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS88581.1|3507758_3508286_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS88582.1|3508285_3508489_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS88583.1|3508492_3508708_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS88584.1|3508727_3509201_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS88585.1|3509202_3509580_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS88586.1|3509576_3510005_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS88587.1|3510100_3510532_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS88588.1|3510524_3510971_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS88589.1|3511039_3511618_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS88590.1|3511614_3511974_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS88591.1|3511960_3512869_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS88592.1|3512861_3513467_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS88593.1|3513463_3514978_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.0	4.4e-199
AYS88594.1|3514977_3515571_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS88595.1|3515542_3515983_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS88596.1|3516405_3516978_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS88597.1|3517120_3518293_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS88598.1|3518302_3518818_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS88599.1|3518872_3519175_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS88600.1|3519189_3519309_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS88601.1|3519301_3522379_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS88602.1|3522375_3522861_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS88603.1|3522857_3523958_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS88604.1|3524048_3524267_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS88605.1|3525848_3526307_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 10
CP029922	Salmonella enterica subsp. enterica serovar Typhi strain 311189_269186 chromosome, complete genome	4782083	4441841	4516005	4782083	portal,integrase,plate,capsid,tail,terminase	Salmonella_phage(82.98%)	76	4503342:4503358	4516164:4516180
AYS89376.1|4441841_4443791_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS89377.1|4443862_4444771_+	hypothetical protein	NA	NA	NA	NA	NA
AYS89378.1|4444844_4445744_+	hypothetical protein	NA	NA	NA	NA	NA
AYS89379.1|4445785_4446145_+	hypothetical protein	NA	NA	NA	NA	NA
AYS89380.1|4446244_4446514_-	hypothetical protein	NA	NA	NA	NA	NA
AYS89381.1|4446645_4447920_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS89382.1|4448139_4448517_+	hypothetical protein	NA	NA	NA	NA	NA
AYS89383.1|4448603_4448822_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS89384.1|4448889_4449990_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS89385.1|4449986_4450472_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS89386.1|4450471_4453252_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS89387.1|4453244_4453364_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS89388.1|4453378_4453681_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS89389.1|4453735_4454251_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS89390.1|4454260_4455433_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS89391.1|4455967_4456690_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS89392.1|4456887_4457295_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS89393.1|4457301_4458921_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS89394.1|4458917_4459523_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS89395.1|4459515_4460424_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYS89396.1|4460410_4460770_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS89397.1|4460766_4461345_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS89398.1|4461413_4461860_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS89399.1|4461852_4462284_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYS89400.1|4462379_4462805_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS89401.1|4462804_4463182_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS89402.1|4463186_4463657_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS89403.1|4463676_4463892_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS89404.1|4463895_4464099_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS89405.1|4464098_4464563_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS89406.1|4464656_4465307_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS89407.1|4465310_4466375_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS89408.1|4466391_4467225_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS89409.1|4467367_4469134_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS89410.1|4469130_4470177_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS89411.1|4470225_4470921_-	hypothetical protein	NA	NA	NA	NA	NA
AYS89412.1|4470940_4472005_-	hypothetical protein	NA	NA	NA	NA	NA
AYS89413.1|4472001_4473066_-	hypothetical protein	NA	NA	NA	NA	NA
AYS89414.1|4473990_4474320_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYS89415.1|4474316_4476386_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYS89416.1|4476376_4477237_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS89417.1|4477233_4477818_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS89418.1|4477814_4478042_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS89419.1|4478041_4478275_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS89420.1|4478342_4478684_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS89421.1|4478647_4478848_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS89422.1|4478855_4479365_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS89423.1|4479397_4479640_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS89424.1|4479756_4480389_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS89425.1|4480392_4481418_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS89426.1|4481524_4481878_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS89427.1|4482494_4482782_+	hypothetical protein	NA	NA	NA	NA	NA
AYS89428.1|4482792_4483683_+	methyltransferase	NA	NA	NA	NA	NA
AYS89429.1|4483682_4484429_+	hypothetical protein	NA	NA	NA	NA	NA
AYS89430.1|4484730_4486701_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS89431.1|4486720_4488025_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS89432.1|4488047_4488743_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS89433.1|4488768_4489563_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS89434.1|4489572_4490640_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS89435.1|4490684_4492421_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS89436.1|4492420_4494916_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS89437.1|4494939_4495986_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS89438.1|4495988_4497266_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS89439.1|4497510_4498050_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS89440.1|4498903_4500415_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS89441.1|4500398_4501988_+	hypothetical protein	NA	NA	NA	NA	NA
AYS89442.1|4502151_4503165_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4503342:4503358	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS89443.1|4503591_4503885_+	hypothetical protein	NA	NA	NA	NA	NA
AYS89444.1|4503881_4504370_+	hypothetical protein	NA	NA	NA	NA	NA
AYS89445.1|4504549_4505002_-	hypothetical protein	NA	NA	NA	NA	NA
AYS89446.1|4510224_4510686_+	hypothetical protein	NA	NA	NA	NA	NA
AYS89447.1|4510682_4510904_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS89448.1|4511760_4512543_+	hypothetical protein	NA	NA	NA	NA	NA
AYS89449.1|4513169_4513394_-	hypothetical protein	NA	NA	NA	NA	NA
AYS89450.1|4513523_4514435_-	hypothetical protein	NA	NA	NA	NA	NA
AYS89451.1|4514745_4516005_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4516164:4516180	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 11
CP029922	Salmonella enterica subsp. enterica serovar Typhi strain 311189_269186 chromosome, complete genome	4782083	4658257	4668516	4782083	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYS89588.1|4658257_4659334_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS89589.1|4659330_4660404_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS89590.1|4660378_4661542_-	hypothetical protein	NA	NA	NA	NA	NA
AYS89591.1|4661817_4662384_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS89592.1|4662399_4662639_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS89593.1|4662642_4663503_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS89594.1|4663925_4664249_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS89595.1|4664232_4664733_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYS89596.1|4664729_4664957_+	hypothetical protein	NA	NA	NA	NA	NA
AYS89597.1|4664953_4665274_+	P4 phage protein	NA	NA	NA	NA	NA
AYS89598.1|4665288_4665963_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYS89599.1|4665959_4667621_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYS89600.1|4668357_4668516_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
