The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029917	Salmonella enterica subsp. enterica serovar Typhi strain 311189_256186 chromosome, complete genome	4800376	930553	937865	4800376	integrase,protease	Dickeya_phage(16.67%)	6	931804:931818	942983:942997
AYS72458.1|930553_931672_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS72459.1|931668_933615_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931804:931818	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS72460.1|933744_933966_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS72461.1|934289_934610_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS72462.1|934640_936917_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS72463.1|937487_937865_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942983:942997	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029917	Salmonella enterica subsp. enterica serovar Typhi strain 311189_256186 chromosome, complete genome	4800376	1008808	1086120	4800376	protease,terminase,integrase,tail,transposase	Salmonella_phage(73.33%)	93	990874:990893	1061481:1061500
990874:990893	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS72513.1|1008808_1010149_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS72514.1|1010145_1010394_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS72515.1|1010434_1010680_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS72516.1|1010679_1011561_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS72517.1|1011557_1012622_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS72518.1|1012699_1013380_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS72519.1|1013376_1014162_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS72520.1|1014167_1014464_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS72521.1|1014554_1014755_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS72522.1|1015043_1015448_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS72523.1|1015779_1016154_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS72524.1|1016238_1017222_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS72525.1|1017224_1017974_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS72526.1|1017984_1018332_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYS72527.1|1018328_1018853_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS72528.1|1018852_1019326_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS72529.1|1019329_1019902_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS72530.1|1019995_1020262_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS72531.1|1020343_1020505_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS72532.1|1020937_1021435_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS72533.1|1021619_1021859_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS72534.1|1021848_1022154_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS72535.1|1022193_1022796_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS72536.1|1023004_1023616_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS72537.1|1023748_1024546_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS72538.1|1024944_1025070_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS72539.1|1025205_1025655_-	lipoprotein	NA	NA	NA	NA	NA
AYS72540.1|1025871_1026261_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS72541.1|1026247_1026529_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS72542.1|1026528_1027143_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS72543.1|1027361_1027616_+	hypothetical protein	NA	NA	NA	NA	NA
AYS72544.1|1027720_1028098_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS72545.1|1028161_1028422_+	hypothetical protein	NA	NA	NA	NA	NA
AYS72546.1|1028511_1029264_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS72547.1|1029229_1030633_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS72548.1|1030632_1032102_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS72549.1|1032193_1032724_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS72550.1|1032738_1033971_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS72551.1|1033975_1034473_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS72552.1|1034484_1035426_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS72553.1|1035467_1035836_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS72554.1|1035801_1036209_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS72555.1|1036205_1036760_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS72556.1|1036746_1037136_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS72557.1|1037110_1037674_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS72558.1|1037677_1038823_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS72559.1|1038834_1039275_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS72560.1|1039278_1039731_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS72561.1|1039908_1041861_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS72562.1|1041860_1042511_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS72563.1|1042514_1042817_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS72564.1|1042819_1043851_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS72565.1|1043847_1044183_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS72566.1|1044377_1045109_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS72567.1|1045108_1045537_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS72568.1|1045595_1046351_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS72569.1|1046438_1046576_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS72570.1|1046591_1046945_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS72571.1|1046945_1048145_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS72572.1|1048141_1048822_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS72573.1|1048821_1050333_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS72574.1|1050347_1050866_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS72575.1|1051787_1052489_-	hypothetical protein	NA	NA	NA	NA	NA
AYS72576.1|1052801_1053080_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS72577.1|1053505_1056118_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS72578.1|1056325_1057336_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS72579.1|1057498_1058044_+	hypothetical protein	NA	NA	NA	NA	NA
AYS72580.1|1058040_1059150_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS72581.1|1059248_1061357_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS72582.1|1061369_1063277_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061481:1061500	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS72583.1|1063291_1064545_+	inner membrane protein	NA	NA	NA	NA	NA
AYS72584.1|1064549_1066190_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS72585.1|1066186_1066750_+	lipoprotein	NA	NA	NA	NA	NA
AYS72586.1|1067003_1067171_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS72587.1|1067270_1067789_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS72588.1|1067857_1069618_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS72589.1|1069803_1070256_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS72590.1|1070327_1071380_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS72591.1|1071734_1072244_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS72592.1|1072460_1073066_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS72593.1|1073052_1075206_-	inner membrane protein	NA	NA	NA	NA	NA
AYS72594.1|1075224_1075671_-	hypothetical protein	NA	NA	NA	NA	NA
AYS72595.1|1075794_1077849_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS72596.1|1077884_1078343_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS72597.1|1078437_1079100_-	hypothetical protein	NA	NA	NA	NA	NA
AYS72598.1|1079270_1079687_+	hypothetical protein	NA	NA	NA	NA	NA
AYS72599.1|1079731_1080049_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS72600.1|1080106_1081318_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS72601.1|1082449_1082908_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS72602.1|1083644_1083926_+	acylphosphatase	NA	NA	NA	NA	NA
AYS72603.1|1083922_1084252_-	sulfite reductase	NA	NA	NA	NA	NA
AYS72604.1|1084338_1084998_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS72605.1|1085661_1086120_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029917	Salmonella enterica subsp. enterica serovar Typhi strain 311189_256186 chromosome, complete genome	4800376	1528938	1602536	4800376	protease,tRNA,head,tail,transposase,plate	Burkholderia_virus(44.12%)	72	NA	NA
AYS73005.1|1528938_1529397_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS73006.1|1529899_1530181_+	stress response protein	NA	NA	NA	NA	NA
AYS73007.1|1530449_1531271_+|protease	serine protease	protease	NA	NA	NA	NA
AYS73008.1|1531305_1531635_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS73009.1|1531621_1531984_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS73010.1|1532095_1532266_-	hypothetical protein	NA	NA	NA	NA	NA
AYS73011.1|1532400_1533435_+	hypothetical protein	NA	NA	NA	NA	NA
AYS73012.1|1533609_1534998_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS73013.1|1535008_1536538_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS73014.1|1537064_1538009_+	hypothetical protein	NA	NA	NA	NA	NA
AYS73015.1|1538190_1538580_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS73016.1|1538551_1539004_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS73017.1|1539198_1539429_-	hypothetical protein	NA	NA	NA	NA	NA
AYS73018.1|1539425_1540109_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS73019.1|1540693_1540996_-	hypothetical protein	NA	NA	NA	NA	NA
AYS73020.1|1541566_1542097_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS73021.1|1542396_1543563_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS73022.1|1543573_1545343_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS73023.1|1546787_1547138_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS73024.1|1547852_1548503_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS73025.1|1548825_1549137_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS73026.1|1549136_1549682_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS73027.1|1549678_1551274_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS73028.1|1551273_1552770_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS73029.1|1552750_1553572_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS73030.1|1553574_1554033_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS73031.1|1554247_1555363_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS73032.1|1555377_1556331_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS73033.1|1556340_1556679_+	hypothetical protein	NA	NA	NA	NA	NA
AYS73034.1|1556680_1557127_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS73035.1|1557126_1557591_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS73036.1|1557831_1559259_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS73037.1|1559258_1559780_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS73038.1|1559782_1560064_+	hypothetical protein	NA	NA	NA	NA	NA
AYS73039.1|1560161_1560497_+	hypothetical protein	NA	NA	NA	NA	NA
AYS73040.1|1560672_1563138_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS73041.1|1563137_1564022_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS73042.1|1564018_1564234_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS73043.1|1564221_1565376_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS73044.1|1565372_1565900_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS73045.1|1565956_1566304_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS73046.1|1566294_1567398_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS73047.1|1567390_1567969_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS73048.1|1567971_1568997_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYS73049.1|1569510_1570128_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS73050.1|1571638_1572211_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYS73051.1|1572491_1573874_+	amino acid permease	NA	NA	NA	NA	NA
AYS73052.1|1573935_1574271_-	hypothetical protein	NA	NA	NA	NA	NA
AYS73053.1|1574397_1575129_+	two-component response regulator	NA	NA	NA	NA	NA
AYS73054.1|1575609_1576761_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYS73055.1|1576913_1578620_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYS73056.1|1578727_1580032_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYS73057.1|1580107_1581037_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYS73058.1|1581033_1582437_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYS73059.1|1582604_1584251_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYS73060.1|1584450_1585626_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYS73061.1|1585728_1587237_+	hypothetical protein	NA	NA	NA	NA	NA
AYS73062.1|1587942_1588944_+	adenosine deaminase	NA	NA	NA	NA	NA
AYS73063.1|1589017_1590133_-	oxidoreductase	NA	NA	NA	NA	NA
AYS73064.1|1590235_1590391_+	hypothetical protein	NA	NA	NA	NA	NA
AYS73065.1|1590689_1590905_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYS73066.1|1590993_1591434_+	hypothetical protein	NA	NA	NA	NA	NA
AYS73067.1|1591510_1592092_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYS73068.1|1592091_1592670_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYS73069.1|1592662_1594684_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYS73070.1|1594684_1595743_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYS73071.1|1595746_1596367_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYS73072.1|1596369_1597062_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYS73073.1|1597061_1597697_+	endonuclease III	NA	NA	NA	NA	NA
AYS73074.1|1598297_1599803_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYS73075.1|1599907_1600513_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYS73076.1|1601261_1602536_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029917	Salmonella enterica subsp. enterica serovar Typhi strain 311189_256186 chromosome, complete genome	4800376	1783573	1787985	4800376		Escherichia_phage(50.0%)	6	NA	NA
AYS73260.1|1783573_1783813_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYS73261.1|1784685_1785495_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS73262.1|1785567_1785945_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS73263.1|1786092_1786635_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS73264.1|1786826_1787555_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS73265.1|1787571_1787985_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029917	Salmonella enterica subsp. enterica serovar Typhi strain 311189_256186 chromosome, complete genome	4800376	1991845	1999079	4800376		Morganella_phage(33.33%)	7	NA	NA
AYS73455.1|1991845_1993276_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYS73456.1|1993349_1994045_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYS73457.1|1994124_1994436_-	hypothetical protein	NA	NA	NA	NA	NA
AYS73458.1|1995086_1996271_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYS73459.1|1996730_1996943_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYS73460.1|1997388_1998657_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYS73461.1|1998659_1999079_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029917	Salmonella enterica subsp. enterica serovar Typhi strain 311189_256186 chromosome, complete genome	4800376	2105379	2115886	4800376		Enterobacteria_phage(37.5%)	10	NA	NA
AYS73558.1|2105379_2106693_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS73559.1|2106719_2107799_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS73560.1|2107803_2108577_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS73561.1|2108592_2109567_-	reductase RfbI	NA	NA	NA	NA	NA
AYS73562.1|2109572_2110124_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS73563.1|2110124_2111003_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS73564.1|2111050_2111950_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS73565.1|2111949_2113035_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS73566.1|2113411_2114305_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS73567.1|2114482_2115886_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029917	Salmonella enterica subsp. enterica serovar Typhi strain 311189_256186 chromosome, complete genome	4800376	2191777	2200948	4800376	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS73626.1|2191777_2193811_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS73627.1|2194051_2194510_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS73628.1|2194681_2195212_+	lipoprotein	NA	NA	NA	NA	NA
AYS73629.1|2195268_2195736_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS73630.1|2195782_2196502_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS73631.1|2196498_2198184_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS73632.1|2198406_2199138_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS73633.1|2199197_2199305_+	hypothetical protein	NA	NA	NA	NA	NA
AYS73634.1|2199285_2200017_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS73635.1|2200000_2200948_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029917	Salmonella enterica subsp. enterica serovar Typhi strain 311189_256186 chromosome, complete genome	4800376	2736384	2749776	4800376	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS74064.1|2736384_2736603_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS74065.1|2736693_2737794_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS74066.1|2737790_2738276_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS74067.1|2738272_2741350_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS74068.1|2741342_2741462_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS74069.1|2741476_2741779_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS74070.1|2741833_2742349_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS74071.1|2742358_2743531_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS74072.1|2743673_2744246_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS74073.1|2744923_2746039_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS74074.1|2746119_2749776_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029917	Salmonella enterica subsp. enterica serovar Typhi strain 311189_256186 chromosome, complete genome	4800376	3066937	3110640	4800376	tRNA,transposase,bacteriocin,protease	Bacillus_virus(33.33%)	44	NA	NA
AYS74361.1|3066937_3067396_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS74362.1|3067585_3068665_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS74363.1|3068766_3069930_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS74364.1|3069951_3070998_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS74365.1|3071371_3071797_+	hypothetical protein	NA	NA	NA	NA	NA
AYS74366.1|3071822_3072401_+	hypothetical protein	NA	NA	NA	NA	NA
AYS74367.1|3072434_3073109_+	hypothetical protein	NA	NA	NA	NA	NA
AYS74368.1|3073090_3073774_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS74369.1|3073767_3074424_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS74370.1|3074528_3074987_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS74371.1|3075175_3077167_-	transketolase	NA	NA	NA	NA	NA
AYS74372.1|3077442_3078201_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS74373.1|3078301_3079222_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS74374.1|3079449_3081426_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS74375.1|3081434_3081566_-	hypothetical protein	NA	NA	NA	NA	NA
AYS74376.1|3081860_3082160_-	membrane protein	NA	NA	NA	NA	NA
AYS74377.1|3082215_3083370_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS74378.1|3083862_3085257_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS74379.1|3085335_3085833_+	hypothetical protein	NA	NA	NA	NA	NA
AYS74380.1|3085928_3086636_+	endonuclease I	NA	NA	NA	NA	NA
AYS74381.1|3086712_3087444_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS74382.1|3087463_3088411_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS74383.1|3088626_3089190_+	hypothetical protein	NA	NA	NA	NA	NA
AYS74384.1|3089189_3089606_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS74385.1|3089652_3090339_-	global regulatory protein	NA	NA	NA	NA	NA
AYS74386.1|3090468_3091449_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS74387.1|3091466_3092171_+	hypothetical protein	NA	NA	NA	NA	NA
AYS74388.1|3092189_3092756_+	hypothetical protein	NA	NA	NA	NA	NA
AYS74389.1|3092752_3093043_+	hypothetical protein	NA	NA	NA	NA	NA
AYS74390.1|3093050_3093644_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS74391.1|3093636_3094773_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS74392.1|3094863_3095871_-	hypothetical protein	NA	NA	NA	NA	NA
AYS74393.1|3096003_3097050_-	L-asparaginase	NA	NA	NA	NA	NA
AYS74394.1|3097368_3097827_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS74395.1|3097949_3098669_-	hypothetical protein	NA	NA	NA	NA	NA
AYS74396.1|3098718_3099045_-	hypothetical protein	NA	NA	NA	NA	NA
AYS74397.1|3099044_3099764_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS74398.1|3099918_3100971_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS74399.1|3100998_3101274_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS74400.1|3101386_3102472_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS74401.1|3102688_3103945_+	nucleoside permease	NA	NA	NA	NA	NA
AYS74402.1|3106555_3107263_+	hypothetical protein	NA	NA	NA	NA	NA
AYS74403.1|3109852_3110119_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS74404.1|3110361_3110640_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029917	Salmonella enterica subsp. enterica serovar Typhi strain 311189_256186 chromosome, complete genome	4800376	3488955	3527013	4800376	terminase,integrase,tail,capsid,portal,transposase,plate	Salmonella_phage(82.05%)	46	3483919:3483933	3496085:3496099
3483919:3483933	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS74733.1|3488955_3490602_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS74734.1|3490741_3490840_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS74735.1|3491095_3491425_+	hypothetical protein	NA	NA	NA	NA	NA
AYS74736.1|3491465_3492518_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS74737.1|3492913_3493483_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS74738.1|3493608_3493830_+	hypothetical protein	NA	NA	NA	NA	NA
AYS74739.1|3493862_3494372_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS74740.1|3494546_3494771_+	hypothetical protein	NA	NA	NA	NA	NA
AYS74741.1|3494793_3495135_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS74742.1|3495202_3495436_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS74743.1|3495435_3495663_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS74744.1|3495659_3496517_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3496085:3496099	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS74745.1|3496513_3498928_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS74746.1|3499081_3499270_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS74747.1|3501237_3502152_+	hypothetical protein	NA	NA	NA	NA	NA
AYS74748.1|3502148_3502889_+	hypothetical protein	NA	NA	NA	NA	NA
AYS74749.1|3502923_3503961_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS74750.1|3503960_3505727_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS74751.1|3505869_3506703_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS74752.1|3506719_3507778_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS74753.1|3507781_3508432_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS74754.1|3508464_3508992_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS74755.1|3508991_3509195_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS74756.1|3509198_3509414_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS74757.1|3509433_3509907_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS74758.1|3509908_3510286_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS74759.1|3510282_3510711_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS74760.1|3510806_3511238_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS74761.1|3511230_3511677_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS74762.1|3511745_3512324_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS74763.1|3512320_3512680_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS74764.1|3512666_3513575_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS74765.1|3513567_3514173_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS74766.1|3514169_3515684_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYS74767.1|3515683_3516277_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS74768.1|3516248_3516689_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS74769.1|3517111_3517684_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS74770.1|3517826_3518999_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS74771.1|3519008_3519524_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS74772.1|3519578_3519881_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS74773.1|3519895_3520015_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS74774.1|3520007_3523085_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS74775.1|3523081_3523567_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS74776.1|3523563_3524664_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS74777.1|3524754_3524973_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS74778.1|3526554_3527013_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029917	Salmonella enterica subsp. enterica serovar Typhi strain 311189_256186 chromosome, complete genome	4800376	4460128	4534292	4800376	terminase,integrase,tail,capsid,portal,plate	Salmonella_phage(82.98%)	76	4521629:4521645	4534451:4534467
AYS75569.1|4460128_4462078_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS75570.1|4462149_4463058_+	hypothetical protein	NA	NA	NA	NA	NA
AYS75571.1|4463131_4464031_+	hypothetical protein	NA	NA	NA	NA	NA
AYS75572.1|4464072_4464432_+	hypothetical protein	NA	NA	NA	NA	NA
AYS75573.1|4464531_4464801_-	hypothetical protein	NA	NA	NA	NA	NA
AYS75574.1|4464932_4466207_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS75575.1|4466426_4466804_+	hypothetical protein	NA	NA	NA	NA	NA
AYS75576.1|4466890_4467109_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS75577.1|4467176_4468277_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS75578.1|4468273_4468759_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS75579.1|4468758_4471539_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS75580.1|4471531_4471651_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS75581.1|4471665_4471968_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS75582.1|4472022_4472538_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS75583.1|4472547_4473720_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS75584.1|4474254_4474977_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS75585.1|4475174_4475582_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS75586.1|4475588_4477208_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS75587.1|4477204_4477810_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS75588.1|4477802_4478711_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYS75589.1|4478697_4479057_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS75590.1|4479053_4479632_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS75591.1|4479700_4480147_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS75592.1|4480139_4480571_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYS75593.1|4480666_4481092_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS75594.1|4481091_4481469_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS75595.1|4481473_4481944_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS75596.1|4481963_4482179_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS75597.1|4482182_4482386_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS75598.1|4482385_4482850_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS75599.1|4482943_4483594_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS75600.1|4483597_4484662_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS75601.1|4484678_4485512_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS75602.1|4485654_4487421_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS75603.1|4487417_4488464_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS75604.1|4488512_4489208_-	hypothetical protein	NA	NA	NA	NA	NA
AYS75605.1|4489227_4490292_-	hypothetical protein	NA	NA	NA	NA	NA
AYS75606.1|4490288_4491353_-	hypothetical protein	NA	NA	NA	NA	NA
AYS75607.1|4492277_4492607_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYS75608.1|4492603_4494673_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYS75609.1|4494663_4495524_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS75610.1|4495520_4496105_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS75611.1|4496101_4496329_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS75612.1|4496328_4496562_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS75613.1|4496629_4496971_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS75614.1|4496934_4497135_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS75615.1|4497142_4497652_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS75616.1|4497684_4497927_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS75617.1|4498043_4498676_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS75618.1|4498679_4499705_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS75619.1|4499811_4500165_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS75620.1|4500781_4501069_+	hypothetical protein	NA	NA	NA	NA	NA
AYS75621.1|4501079_4501970_+	methyltransferase	NA	NA	NA	NA	NA
AYS75622.1|4501969_4502716_+	hypothetical protein	NA	NA	NA	NA	NA
AYS75623.1|4503017_4504988_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS75624.1|4505007_4506312_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS75625.1|4506334_4507030_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS75626.1|4507055_4507850_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS75627.1|4507859_4508927_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS75628.1|4508971_4510708_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS75629.1|4510707_4513203_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS75630.1|4513226_4514273_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS75631.1|4514275_4515553_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS75632.1|4515797_4516337_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS75633.1|4517190_4518702_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS75634.1|4518685_4520275_+	hypothetical protein	NA	NA	NA	NA	NA
AYS75635.1|4520438_4521452_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4521629:4521645	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS75636.1|4521878_4522172_+	hypothetical protein	NA	NA	NA	NA	NA
AYS75637.1|4522168_4522657_+	hypothetical protein	NA	NA	NA	NA	NA
AYS75638.1|4522836_4523289_-	hypothetical protein	NA	NA	NA	NA	NA
AYS75639.1|4528511_4528973_+	hypothetical protein	NA	NA	NA	NA	NA
AYS75640.1|4528969_4529191_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS75641.1|4530047_4530830_+	hypothetical protein	NA	NA	NA	NA	NA
AYS75642.1|4531456_4531681_-	hypothetical protein	NA	NA	NA	NA	NA
AYS75643.1|4531810_4532722_-	hypothetical protein	NA	NA	NA	NA	NA
AYS75644.1|4533032_4534292_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4534451:4534467	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029917	Salmonella enterica subsp. enterica serovar Typhi strain 311189_256186 chromosome, complete genome	4800376	4676544	4686803	4800376	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYS75781.1|4676544_4677621_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS75782.1|4677617_4678691_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS75783.1|4678665_4679829_-	hypothetical protein	NA	NA	NA	NA	NA
AYS75784.1|4680104_4680671_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS75785.1|4680686_4680926_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS75786.1|4680929_4681790_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS75787.1|4682212_4682536_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS75788.1|4682519_4683020_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYS75789.1|4683016_4683244_+	hypothetical protein	NA	NA	NA	NA	NA
AYS75790.1|4683240_4683561_+	P4 phage protein	NA	NA	NA	NA	NA
AYS75791.1|4683575_4684250_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYS75792.1|4684246_4685908_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYS75793.1|4686644_4686803_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
