The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029885	Salmonella enterica subsp. enterica serovar Typhi strain 311189_255186 chromosome, complete genome	4808675	930348	937660	4808675	protease,integrase	Dickeya_phage(16.67%)	6	931599:931613	942778:942792
AYS68220.1|930348_931467_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS68221.1|931463_933410_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931599:931613	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS68222.1|933539_933761_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS68223.1|934084_934405_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS68224.1|934435_936712_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS68225.1|937282_937660_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942778:942792	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029885	Salmonella enterica subsp. enterica serovar Typhi strain 311189_255186 chromosome, complete genome	4808675	1008798	1086110	4808675	tail,transposase,protease,terminase,integrase	Salmonella_phage(73.33%)	93	990864:990883	1061471:1061490
990864:990883	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS68275.1|1008798_1010139_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS68276.1|1010135_1010384_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS68277.1|1010424_1010670_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS68278.1|1010669_1011551_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS68279.1|1011547_1012612_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS68280.1|1012689_1013370_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS68281.1|1013366_1014152_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS68282.1|1014157_1014454_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS68283.1|1014544_1014745_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS68284.1|1015033_1015438_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS68285.1|1015769_1016144_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS68286.1|1016228_1017212_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS68287.1|1017214_1017964_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS68288.1|1017974_1018322_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYS68289.1|1018318_1018843_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS68290.1|1018842_1019316_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS68291.1|1019319_1019892_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS68292.1|1019985_1020252_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS68293.1|1020333_1020495_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS68294.1|1020927_1021425_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS68295.1|1021609_1021849_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS68296.1|1021838_1022144_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS68297.1|1022183_1022786_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS68298.1|1022994_1023606_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS68299.1|1023738_1024536_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS68300.1|1024934_1025060_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS68301.1|1025195_1025645_-	lipoprotein	NA	NA	NA	NA	NA
AYS68302.1|1025861_1026251_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS68303.1|1026237_1026519_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS68304.1|1026518_1027133_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS68305.1|1027351_1027606_+	hypothetical protein	NA	NA	NA	NA	NA
AYS68306.1|1027710_1028088_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS68307.1|1028151_1028412_+	hypothetical protein	NA	NA	NA	NA	NA
AYS68308.1|1028501_1029254_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS68309.1|1029219_1030623_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS68310.1|1030622_1032092_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS68311.1|1032183_1032714_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS68312.1|1032728_1033961_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS68313.1|1033965_1034463_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS68314.1|1034474_1035416_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS68315.1|1035457_1035826_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS68316.1|1035791_1036199_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS68317.1|1036195_1036750_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS68318.1|1036736_1037126_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS68319.1|1037100_1037664_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS68320.1|1037667_1038813_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS68321.1|1038824_1039265_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS68322.1|1039268_1039721_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS68323.1|1039898_1041851_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS68324.1|1041850_1042501_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS68325.1|1042504_1042807_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS68326.1|1042809_1043841_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS68327.1|1043837_1044173_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS68328.1|1044367_1045099_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS68329.1|1045098_1045527_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS68330.1|1045585_1046341_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS68331.1|1046428_1046566_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS68332.1|1046581_1046935_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS68333.1|1046935_1048135_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS68334.1|1048131_1048812_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS68335.1|1048811_1050323_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS68336.1|1050337_1050856_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS68337.1|1051777_1052479_-	hypothetical protein	NA	NA	NA	NA	NA
AYS68338.1|1052791_1053070_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS68339.1|1053495_1056108_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS68340.1|1056315_1057326_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS68341.1|1057488_1058034_+	hypothetical protein	NA	NA	NA	NA	NA
AYS68342.1|1058030_1059140_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS68343.1|1059238_1061347_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS68344.1|1061359_1063267_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061471:1061490	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS68345.1|1063281_1064535_+	inner membrane protein	NA	NA	NA	NA	NA
AYS68346.1|1064539_1066180_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS68347.1|1066176_1066740_+	lipoprotein	NA	NA	NA	NA	NA
AYS68348.1|1066993_1067161_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS68349.1|1067260_1067779_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS68350.1|1067847_1069608_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS68351.1|1069793_1070246_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS68352.1|1070317_1071370_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS68353.1|1071724_1072234_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS68354.1|1072450_1073056_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS68355.1|1073042_1075196_-	inner membrane protein	NA	NA	NA	NA	NA
AYS68356.1|1075214_1075661_-	hypothetical protein	NA	NA	NA	NA	NA
AYS68357.1|1075784_1077839_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS68358.1|1077874_1078333_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS68359.1|1078427_1079090_-	hypothetical protein	NA	NA	NA	NA	NA
AYS68360.1|1079260_1079677_+	hypothetical protein	NA	NA	NA	NA	NA
AYS68361.1|1079721_1080039_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS68362.1|1080096_1081308_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS68363.1|1082439_1082898_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS68364.1|1083634_1083916_+	acylphosphatase	NA	NA	NA	NA	NA
AYS68365.1|1083912_1084242_-	sulfite reductase	NA	NA	NA	NA	NA
AYS68366.1|1084328_1084988_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS68367.1|1085651_1086110_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029885	Salmonella enterica subsp. enterica serovar Typhi strain 311189_255186 chromosome, complete genome	4808675	1528928	1602498	4808675	plate,head,tRNA,transposase,protease,tail	Burkholderia_virus(42.11%)	81	NA	NA
AYS68767.1|1528928_1529387_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS68768.1|1529889_1530171_+	stress response protein	NA	NA	NA	NA	NA
AYS68769.1|1530439_1531261_+|protease	serine protease	protease	NA	NA	NA	NA
AYS68770.1|1531295_1531625_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS68771.1|1531611_1531974_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS68772.1|1532085_1532256_-	hypothetical protein	NA	NA	NA	NA	NA
AYS68773.1|1532390_1533425_+	hypothetical protein	NA	NA	NA	NA	NA
AYS68774.1|1533599_1534988_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS68775.1|1534998_1536528_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS68776.1|1537054_1537999_+	hypothetical protein	NA	NA	NA	NA	NA
AYS68777.1|1538180_1538570_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS68778.1|1538541_1538994_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS68779.1|1539188_1539419_-	hypothetical protein	NA	NA	NA	NA	NA
AYS68780.1|1539415_1540099_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS68781.1|1540095_1540311_-	hypothetical protein	NA	NA	NA	NA	NA
AYS68782.1|1540303_1540687_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYS68783.1|1540683_1540986_-	hypothetical protein	NA	NA	NA	NA	NA
AYS68784.1|1540995_1541268_-	hypothetical protein	NA	NA	NA	NA	NA
AYS68785.1|1541556_1542087_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS68786.1|1542114_1542384_-	hypothetical protein	NA	NA	NA	NA	NA
AYS68787.1|1542386_1543553_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS68788.1|1543563_1545333_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS68789.1|1545510_1545942_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYS68790.1|1545937_1546534_+	hypothetical protein	NA	NA	NA	NA	NA
AYS68791.1|1546777_1547128_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS68792.1|1547842_1548493_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS68793.1|1548489_1548816_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYS68794.1|1548815_1549127_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS68795.1|1549126_1549672_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS68796.1|1549668_1551264_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS68797.1|1551263_1552760_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS68798.1|1552740_1553562_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS68799.1|1553564_1554023_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS68800.1|1554237_1555353_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS68801.1|1555367_1556321_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS68802.1|1556330_1556669_+	hypothetical protein	NA	NA	NA	NA	NA
AYS68803.1|1556670_1557117_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS68804.1|1557116_1557581_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS68805.1|1557577_1557832_+	hypothetical protein	NA	NA	NA	NA	NA
AYS68806.1|1557821_1559249_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS68807.1|1559248_1559770_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS68808.1|1559772_1560054_+	hypothetical protein	NA	NA	NA	NA	NA
AYS68809.1|1560151_1560487_+	hypothetical protein	NA	NA	NA	NA	NA
AYS68810.1|1560662_1563128_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS68811.1|1563127_1564012_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS68812.1|1564008_1564224_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS68813.1|1564211_1565366_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS68814.1|1565362_1565890_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS68815.1|1565946_1566294_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS68816.1|1566284_1567388_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS68817.1|1567380_1567959_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS68818.1|1567961_1568987_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYS68819.1|1569500_1570118_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS68820.1|1570611_1571004_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	51.1	6.8e-19
AYS68821.1|1571600_1572173_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYS68822.1|1572453_1573836_+	amino acid permease	NA	NA	NA	NA	NA
AYS68823.1|1573897_1574233_-	hypothetical protein	NA	NA	NA	NA	NA
AYS68824.1|1574359_1575091_+	two-component response regulator	NA	NA	NA	NA	NA
AYS68825.1|1575571_1576723_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYS68826.1|1576875_1578582_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYS68827.1|1578689_1579994_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYS68828.1|1580069_1580999_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYS68829.1|1580995_1582399_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYS68830.1|1582566_1584213_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYS68831.1|1584412_1585588_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYS68832.1|1585690_1587199_+	hypothetical protein	NA	NA	NA	NA	NA
AYS68833.1|1587904_1588906_+	adenosine deaminase	NA	NA	NA	NA	NA
AYS68834.1|1588979_1590095_-	oxidoreductase	NA	NA	NA	NA	NA
AYS68835.1|1590197_1590353_+	hypothetical protein	NA	NA	NA	NA	NA
AYS68836.1|1590651_1590867_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYS68837.1|1590955_1591396_+	hypothetical protein	NA	NA	NA	NA	NA
AYS68838.1|1591472_1592054_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYS68839.1|1592053_1592632_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYS68840.1|1592624_1594646_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYS68841.1|1594646_1595705_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYS68842.1|1595708_1596329_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYS68843.1|1596331_1597024_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYS68844.1|1597023_1597659_+	endonuclease III	NA	NA	NA	NA	NA
AYS68845.1|1598259_1599765_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYS68846.1|1599869_1600475_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYS68847.1|1601223_1602498_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029885	Salmonella enterica subsp. enterica serovar Typhi strain 311189_255186 chromosome, complete genome	4808675	1783536	1787948	4808675		Escherichia_phage(50.0%)	6	NA	NA
AYS69031.1|1783536_1783776_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYS69032.1|1784648_1785458_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS69033.1|1785530_1785908_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS69034.1|1786055_1786598_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS69035.1|1786789_1787518_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS69036.1|1787534_1787948_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029885	Salmonella enterica subsp. enterica serovar Typhi strain 311189_255186 chromosome, complete genome	4808675	1991802	1999036	4808675		Morganella_phage(33.33%)	7	NA	NA
AYS69227.1|1991802_1993233_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYS69228.1|1993306_1994002_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYS69229.1|1994081_1994393_-	hypothetical protein	NA	NA	NA	NA	NA
AYS69230.1|1995043_1996228_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYS69231.1|1996687_1996900_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYS69232.1|1997345_1998614_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYS69233.1|1998616_1999036_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029885	Salmonella enterica subsp. enterica serovar Typhi strain 311189_255186 chromosome, complete genome	4808675	2105336	2115843	4808675		Enterobacteria_phage(37.5%)	10	NA	NA
AYS69330.1|2105336_2106650_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS69331.1|2106676_2107756_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS69332.1|2107760_2108534_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS69333.1|2108549_2109524_-	reductase RfbI	NA	NA	NA	NA	NA
AYS69334.1|2109529_2110081_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS69335.1|2110081_2110960_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS69336.1|2111007_2111907_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS69337.1|2111906_2112992_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS69338.1|2113368_2114262_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS69339.1|2114439_2115843_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029885	Salmonella enterica subsp. enterica serovar Typhi strain 311189_255186 chromosome, complete genome	4808675	2191734	2200905	4808675	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS69398.1|2191734_2193768_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS69399.1|2194008_2194467_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS69400.1|2194638_2195169_+	lipoprotein	NA	NA	NA	NA	NA
AYS69401.1|2195225_2195693_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS69402.1|2195739_2196459_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS69403.1|2196455_2198141_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS69404.1|2198363_2199095_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS69405.1|2199154_2199262_+	hypothetical protein	NA	NA	NA	NA	NA
AYS69406.1|2199242_2199974_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS69407.1|2199957_2200905_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029885	Salmonella enterica subsp. enterica serovar Typhi strain 311189_255186 chromosome, complete genome	4808675	2736579	2749971	4808675	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS69836.1|2736579_2736798_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS69837.1|2736888_2737989_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS69838.1|2737985_2738471_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS69839.1|2738467_2741545_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS69840.1|2741537_2741657_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS69841.1|2741671_2741974_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS69842.1|2742028_2742544_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS69843.1|2742553_2743726_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS69844.1|2743868_2744441_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS69845.1|2745118_2746234_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS69846.1|2746314_2749971_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029885	Salmonella enterica subsp. enterica serovar Typhi strain 311189_255186 chromosome, complete genome	4808675	3067126	3110829	4808675	protease,bacteriocin,tRNA,transposase	Bacillus_virus(33.33%)	44	NA	NA
AYS70133.1|3067126_3067585_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS70134.1|3067774_3068854_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS70135.1|3068955_3070119_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS70136.1|3070140_3071187_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS70137.1|3071560_3071986_+	hypothetical protein	NA	NA	NA	NA	NA
AYS70138.1|3072011_3072590_+	hypothetical protein	NA	NA	NA	NA	NA
AYS70139.1|3072623_3073298_+	hypothetical protein	NA	NA	NA	NA	NA
AYS70140.1|3073279_3073963_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS70141.1|3073956_3074613_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS70142.1|3074717_3075176_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS70143.1|3075364_3077356_-	transketolase	NA	NA	NA	NA	NA
AYS70144.1|3077631_3078390_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS70145.1|3078490_3079411_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS70146.1|3079638_3081615_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS70147.1|3081623_3081755_-	hypothetical protein	NA	NA	NA	NA	NA
AYS70148.1|3082049_3082349_-	membrane protein	NA	NA	NA	NA	NA
AYS70149.1|3082404_3083559_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS70150.1|3084051_3085446_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS70151.1|3085524_3086022_+	hypothetical protein	NA	NA	NA	NA	NA
AYS70152.1|3086117_3086825_+	endonuclease I	NA	NA	NA	NA	NA
AYS70153.1|3086901_3087633_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS70154.1|3087652_3088600_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS70155.1|3088815_3089379_+	hypothetical protein	NA	NA	NA	NA	NA
AYS70156.1|3089378_3089795_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS70157.1|3089841_3090528_-	global regulatory protein	NA	NA	NA	NA	NA
AYS70158.1|3090657_3091638_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS70159.1|3091655_3092360_+	hypothetical protein	NA	NA	NA	NA	NA
AYS70160.1|3092378_3092945_+	hypothetical protein	NA	NA	NA	NA	NA
AYS70161.1|3092941_3093232_+	hypothetical protein	NA	NA	NA	NA	NA
AYS70162.1|3093239_3093833_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS70163.1|3093825_3094962_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS70164.1|3095052_3096060_-	hypothetical protein	NA	NA	NA	NA	NA
AYS70165.1|3096192_3097239_-	L-asparaginase	NA	NA	NA	NA	NA
AYS70166.1|3097557_3098016_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS70167.1|3098138_3098858_-	hypothetical protein	NA	NA	NA	NA	NA
AYS70168.1|3098907_3099234_-	hypothetical protein	NA	NA	NA	NA	NA
AYS70169.1|3099233_3099953_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS70170.1|3100107_3101160_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS70171.1|3101187_3101463_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS70172.1|3101575_3102661_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS70173.1|3102877_3104134_+	nucleoside permease	NA	NA	NA	NA	NA
AYS70174.1|3106744_3107452_+	hypothetical protein	NA	NA	NA	NA	NA
AYS70175.1|3110041_3110308_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS70176.1|3110550_3110829_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029885	Salmonella enterica subsp. enterica serovar Typhi strain 311189_255186 chromosome, complete genome	4808675	3489305	3527363	4808675	plate,capsid,tail,portal,transposase,terminase,integrase	Salmonella_phage(82.05%)	46	3484269:3484283	3496435:3496449
3484269:3484283	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS70505.1|3489305_3490952_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS70506.1|3491091_3491190_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS70507.1|3491445_3491775_+	hypothetical protein	NA	NA	NA	NA	NA
AYS70508.1|3491815_3492868_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS70509.1|3493263_3493833_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS70510.1|3493958_3494180_+	hypothetical protein	NA	NA	NA	NA	NA
AYS70511.1|3494212_3494722_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS70512.1|3494896_3495121_+	hypothetical protein	NA	NA	NA	NA	NA
AYS70513.1|3495143_3495485_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS70514.1|3495552_3495786_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS70515.1|3495785_3496013_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS70516.1|3496009_3496867_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3496435:3496449	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS70517.1|3496863_3499278_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS70518.1|3499431_3499620_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS70519.1|3501587_3502502_+	hypothetical protein	NA	NA	NA	NA	NA
AYS70520.1|3502498_3503239_+	hypothetical protein	NA	NA	NA	NA	NA
AYS70521.1|3503273_3504311_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS70522.1|3504310_3506077_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS70523.1|3506219_3507053_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS70524.1|3507069_3508128_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS70525.1|3508131_3508782_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS70526.1|3508814_3509342_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS70527.1|3509341_3509545_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS70528.1|3509548_3509764_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS70529.1|3509783_3510257_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS70530.1|3510258_3510636_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS70531.1|3510632_3511061_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS70532.1|3511156_3511588_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS70533.1|3511580_3512027_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS70534.1|3512095_3512674_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS70535.1|3512670_3513030_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS70536.1|3513016_3513925_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS70537.1|3513917_3514523_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS70538.1|3514519_3516034_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.0	4.4e-199
AYS70539.1|3516033_3516627_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS70540.1|3516598_3517039_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS70541.1|3517461_3518034_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS70542.1|3518176_3519349_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS70543.1|3519358_3519874_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS70544.1|3519928_3520231_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS70545.1|3520245_3520365_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS70546.1|3520357_3523435_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS70547.1|3523431_3523917_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS70548.1|3523913_3525014_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS70549.1|3525104_3525323_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS70550.1|3526904_3527363_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029885	Salmonella enterica subsp. enterica serovar Typhi strain 311189_255186 chromosome, complete genome	4808675	3794114	3811523	4808675	integrase,transposase	Escherichia_phage(30.0%)	17	3791820:3791879	3816320:3817087
3791820:3791879	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
AYS70769.1|3794114_3797081_-|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYS70770.1|3797083_3797644_-	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYS70771.1|3797769_3798333_-	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYS70772.1|3798322_3799336_-|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYS70773.1|3799367_3799967_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	31.4	3.1e-15
AYS70774.1|3800163_3800544_+	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYS70775.1|3800450_3801377_+	sulfonamide-resistant dihydropteroate synthase sul1	NA	NA	NA	NA	NA
AYS70776.1|3801610_3802333_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS70777.1|3802365_3802632_+	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
AYS70778.1|3802814_3803675_+	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AYS70779.1|3804254_3804977_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS70780.1|3805037_3805874_-	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS70781.1|3805873_3806677_-	streptomycin phosphotransferase	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
AYS70782.1|3806737_3807553_-	dihydropteroate synthase	NA	NA	NA	NA	NA
AYS70783.1|3807860_3808712_-	replication protein	NA	NA	NA	NA	NA
AYS70784.1|3809467_3810190_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS70785.1|3810218_3811523_-|integrase	integrase	integrase	NA	NA	NA	NA
3816320:3817087	attR	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAATGGCGGAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAGCAGAGATAGCGCTGATGTCCGGCGGTGCTTTTGCCGTTACGCACCACCCCGTCAGTAGCTGAACAGGAGGGACAGCTGATAGAAACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACC	NA	NA	NA	NA
>prophage 12
CP029885	Salmonella enterica subsp. enterica serovar Typhi strain 311189_255186 chromosome, complete genome	4808675	4468334	4542591	4808675	plate,capsid,portal,tail,integrase,terminase	Salmonella_phage(82.61%)	75	4529835:4529851	4542750:4542766
AYS71348.1|4468334_4470284_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS71349.1|4470355_4471264_+	hypothetical protein	NA	NA	NA	NA	NA
AYS71350.1|4471337_4472237_+	hypothetical protein	NA	NA	NA	NA	NA
AYS71351.1|4472278_4472638_+	hypothetical protein	NA	NA	NA	NA	NA
AYS71352.1|4472737_4473007_-	hypothetical protein	NA	NA	NA	NA	NA
AYS71353.1|4473138_4474413_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS71354.1|4474632_4475010_+	hypothetical protein	NA	NA	NA	NA	NA
AYS71355.1|4475096_4475315_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS71356.1|4475382_4476483_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS71357.1|4476479_4476965_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS71358.1|4476964_4479745_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS71359.1|4479737_4479857_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS71360.1|4479871_4480174_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS71361.1|4480228_4480744_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS71362.1|4480753_4481926_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS71363.1|4482460_4483183_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS71364.1|4483380_4483788_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS71365.1|4483794_4485414_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS71366.1|4485410_4486016_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS71367.1|4486008_4486917_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYS71368.1|4486903_4487263_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS71369.1|4487259_4487838_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS71370.1|4487906_4488353_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS71371.1|4488345_4488777_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYS71372.1|4488872_4489298_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS71373.1|4489297_4489675_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS71374.1|4489679_4490150_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS71375.1|4490169_4490385_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS71376.1|4490388_4490592_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS71377.1|4490591_4491056_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS71378.1|4491149_4491800_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS71379.1|4491803_4492868_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS71380.1|4492884_4493718_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS71381.1|4493860_4495627_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS71382.1|4495623_4496670_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS71383.1|4496718_4497414_-	hypothetical protein	NA	NA	NA	NA	NA
AYS71384.1|4497433_4498498_-	hypothetical protein	NA	NA	NA	NA	NA
AYS71385.1|4498494_4499559_-	hypothetical protein	NA	NA	NA	NA	NA
AYS71386.1|4500809_4502879_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYS71387.1|4502869_4503730_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS71388.1|4503726_4504311_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS71389.1|4504307_4504535_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS71390.1|4504534_4504768_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS71391.1|4504835_4505177_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS71392.1|4505140_4505341_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS71393.1|4505348_4505858_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS71394.1|4505890_4506133_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS71395.1|4506249_4506882_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS71396.1|4506885_4507911_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS71397.1|4508017_4508371_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS71398.1|4508987_4509275_+	hypothetical protein	NA	NA	NA	NA	NA
AYS71399.1|4509285_4510176_+	methyltransferase	NA	NA	NA	NA	NA
AYS71400.1|4510175_4510922_+	hypothetical protein	NA	NA	NA	NA	NA
AYS71401.1|4511223_4513194_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS71402.1|4513213_4514518_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS71403.1|4514540_4515236_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS71404.1|4515261_4516056_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS71405.1|4516065_4517133_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS71406.1|4517177_4518914_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS71407.1|4518913_4521409_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS71408.1|4521432_4522479_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS71409.1|4522481_4523759_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS71410.1|4524003_4524543_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS71411.1|4525396_4526908_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS71412.1|4526891_4528481_+	hypothetical protein	NA	NA	NA	NA	NA
AYS71413.1|4528644_4529658_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4529835:4529851	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS71414.1|4530084_4530378_+	hypothetical protein	NA	NA	NA	NA	NA
AYS71415.1|4530374_4530863_+	hypothetical protein	NA	NA	NA	NA	NA
AYS71416.1|4531042_4531495_-	hypothetical protein	NA	NA	NA	NA	NA
AYS71417.1|4536717_4537179_+	hypothetical protein	NA	NA	NA	NA	NA
AYS71418.1|4537175_4537397_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS71419.1|4538253_4539036_+	hypothetical protein	NA	NA	NA	NA	NA
AYS71420.1|4539662_4539887_-	hypothetical protein	NA	NA	NA	NA	NA
AYS71421.1|4540016_4541021_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYS71422.1|4541331_4542591_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4542750:4542766	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 13
CP029885	Salmonella enterica subsp. enterica serovar Typhi strain 311189_255186 chromosome, complete genome	4808675	4684843	4695102	4808675	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYS71559.1|4684843_4685920_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS71560.1|4685916_4686990_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS71561.1|4686964_4688128_-	hypothetical protein	NA	NA	NA	NA	NA
AYS71562.1|4688403_4688970_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS71563.1|4688985_4689225_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS71564.1|4689228_4690089_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS71565.1|4690511_4690835_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS71566.1|4690818_4691319_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYS71567.1|4691315_4691543_+	hypothetical protein	NA	NA	NA	NA	NA
AYS71568.1|4691539_4691860_+	P4 phage protein	NA	NA	NA	NA	NA
AYS71569.1|4691874_4692549_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYS71570.1|4692545_4694207_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYS71571.1|4694943_4695102_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
