The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029896	Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 chromosome, complete genome	4781801	930333	937645	4781801	integrase,protease	Dickeya_phage(16.67%)	6	931584:931598	942763:942777
AYS64018.1|930333_931452_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS64019.1|931448_933395_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931584:931598	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS64020.1|933524_933746_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS64021.1|934069_934390_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS64022.1|934420_936697_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS64023.1|937267_937645_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942763:942777	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029896	Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 chromosome, complete genome	4781801	1008588	1085900	4781801	tail,transposase,protease,integrase,terminase	Salmonella_phage(73.33%)	93	990654:990673	1061261:1061280
990654:990673	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS64073.1|1008588_1009929_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS64074.1|1009925_1010174_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS64075.1|1010214_1010460_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS64076.1|1010459_1011341_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS64077.1|1011337_1012402_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS64078.1|1012479_1013160_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS64079.1|1013156_1013942_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS64080.1|1013947_1014244_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS64081.1|1014334_1014535_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS64082.1|1014823_1015228_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS64083.1|1015559_1015934_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS64084.1|1016018_1017002_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS64085.1|1017004_1017754_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS64086.1|1017764_1018112_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYS64087.1|1018108_1018633_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS64088.1|1018632_1019106_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS64089.1|1019109_1019682_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS64090.1|1019775_1020042_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS64091.1|1020123_1020285_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS64092.1|1020717_1021215_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS64093.1|1021399_1021639_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS64094.1|1021628_1021934_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS64095.1|1021973_1022576_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS64096.1|1022784_1023396_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS64097.1|1023528_1024326_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS64098.1|1024724_1024850_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS64099.1|1024985_1025435_-	lipoprotein	NA	NA	NA	NA	NA
AYS64100.1|1025651_1026041_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS64101.1|1026027_1026309_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS64102.1|1026308_1026923_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS64103.1|1027141_1027396_+	hypothetical protein	NA	NA	NA	NA	NA
AYS64104.1|1027500_1027878_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS64105.1|1027941_1028202_+	hypothetical protein	NA	NA	NA	NA	NA
AYS64106.1|1028291_1029044_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS64107.1|1029009_1030413_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS64108.1|1030412_1031882_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS64109.1|1031973_1032504_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS64110.1|1032518_1033751_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS64111.1|1033755_1034253_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS64112.1|1034264_1035206_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS64113.1|1035247_1035616_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS64114.1|1035581_1035989_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS64115.1|1035985_1036540_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS64116.1|1036526_1036916_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS64117.1|1036890_1037454_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS64118.1|1037457_1038603_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS64119.1|1038614_1039055_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS64120.1|1039058_1039511_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS64121.1|1039688_1041641_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS64122.1|1041640_1042291_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS64123.1|1042294_1042597_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS64124.1|1042599_1043631_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS64125.1|1043627_1043963_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS64126.1|1044157_1044889_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS64127.1|1044888_1045317_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS64128.1|1045375_1046131_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS64129.1|1046218_1046356_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS64130.1|1046371_1046725_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS64131.1|1046725_1047925_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS64132.1|1047921_1048602_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS64133.1|1048601_1050113_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS64134.1|1050127_1050646_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS64135.1|1051567_1052269_-	hypothetical protein	NA	NA	NA	NA	NA
AYS64136.1|1052581_1052860_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS64137.1|1053285_1055898_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS64138.1|1056105_1057116_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS64139.1|1057278_1057824_+	hypothetical protein	NA	NA	NA	NA	NA
AYS64140.1|1057820_1058930_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS64141.1|1059028_1061137_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS64142.1|1061149_1063057_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061261:1061280	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS64143.1|1063071_1064325_+	inner membrane protein	NA	NA	NA	NA	NA
AYS64144.1|1064329_1065970_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS64145.1|1065966_1066530_+	lipoprotein	NA	NA	NA	NA	NA
AYS64146.1|1066783_1066951_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS64147.1|1067050_1067569_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS64148.1|1067637_1069398_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS64149.1|1069583_1070036_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS64150.1|1070107_1071160_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS64151.1|1071514_1072024_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS64152.1|1072240_1072846_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS64153.1|1072832_1074986_-	inner membrane protein	NA	NA	NA	NA	NA
AYS64154.1|1075004_1075451_-	hypothetical protein	NA	NA	NA	NA	NA
AYS64155.1|1075574_1077629_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS64156.1|1077664_1078123_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS64157.1|1078217_1078880_-	hypothetical protein	NA	NA	NA	NA	NA
AYS64158.1|1079050_1079467_+	hypothetical protein	NA	NA	NA	NA	NA
AYS64159.1|1079511_1079829_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS64160.1|1079886_1081098_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS64161.1|1082229_1082688_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS64162.1|1083424_1083706_+	acylphosphatase	NA	NA	NA	NA	NA
AYS64163.1|1083702_1084032_-	sulfite reductase	NA	NA	NA	NA	NA
AYS64164.1|1084118_1084778_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS64165.1|1085441_1085900_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029896	Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 chromosome, complete genome	4781801	1528718	1602316	4781801	tail,head,transposase,tRNA,protease,plate	Burkholderia_virus(44.12%)	72	NA	NA
AYS64565.1|1528718_1529177_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS64566.1|1529679_1529961_+	stress response protein	NA	NA	NA	NA	NA
AYS64567.1|1530229_1531051_+|protease	serine protease	protease	NA	NA	NA	NA
AYS64568.1|1531085_1531415_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS64569.1|1531401_1531764_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS64570.1|1531875_1532046_-	hypothetical protein	NA	NA	NA	NA	NA
AYS64571.1|1532180_1533215_+	hypothetical protein	NA	NA	NA	NA	NA
AYS64572.1|1533389_1534778_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS64573.1|1534788_1536318_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS64574.1|1536844_1537789_+	hypothetical protein	NA	NA	NA	NA	NA
AYS64575.1|1537970_1538360_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS64576.1|1538331_1538784_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS64577.1|1538978_1539209_-	hypothetical protein	NA	NA	NA	NA	NA
AYS64578.1|1539205_1539889_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS64579.1|1540473_1540776_-	hypothetical protein	NA	NA	NA	NA	NA
AYS64580.1|1541346_1541877_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS64581.1|1542176_1543343_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS64582.1|1543353_1545123_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS64583.1|1546567_1546918_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS64584.1|1547632_1548283_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS64585.1|1548605_1548917_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS64586.1|1548916_1549462_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS64587.1|1549458_1551054_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS64588.1|1551053_1552550_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS64589.1|1552530_1553352_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS64590.1|1553354_1553813_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS64591.1|1554027_1555143_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS64592.1|1555157_1556111_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS64593.1|1556120_1556459_+	hypothetical protein	NA	NA	NA	NA	NA
AYS64594.1|1556460_1556907_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS64595.1|1556906_1557371_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS64596.1|1557611_1559039_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS64597.1|1559038_1559560_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS64598.1|1559562_1559844_+	hypothetical protein	NA	NA	NA	NA	NA
AYS64599.1|1559941_1560277_+	hypothetical protein	NA	NA	NA	NA	NA
AYS64600.1|1560452_1562918_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS64601.1|1562917_1563802_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS64602.1|1563798_1564014_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS64603.1|1564001_1565156_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS64604.1|1565152_1565680_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS64605.1|1565736_1566084_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS64606.1|1566074_1567178_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS64607.1|1567170_1567749_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS64608.1|1567751_1568777_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYS64609.1|1569290_1569908_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS64610.1|1571418_1571991_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYS64611.1|1572271_1573654_+	amino acid permease	NA	NA	NA	NA	NA
AYS64612.1|1573715_1574051_-	hypothetical protein	NA	NA	NA	NA	NA
AYS64613.1|1574177_1574909_+	two-component response regulator	NA	NA	NA	NA	NA
AYS64614.1|1575389_1576541_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYS64615.1|1576693_1578400_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYS64616.1|1578507_1579812_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYS64617.1|1579887_1580817_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYS64618.1|1580813_1582217_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYS64619.1|1582384_1584031_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYS64620.1|1584230_1585406_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYS64621.1|1585508_1587017_+	hypothetical protein	NA	NA	NA	NA	NA
AYS64622.1|1587722_1588724_+	adenosine deaminase	NA	NA	NA	NA	NA
AYS64623.1|1588797_1589913_-	oxidoreductase	NA	NA	NA	NA	NA
AYS64624.1|1590015_1590171_+	hypothetical protein	NA	NA	NA	NA	NA
AYS64625.1|1590469_1590685_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYS64626.1|1590773_1591214_+	hypothetical protein	NA	NA	NA	NA	NA
AYS64627.1|1591290_1591872_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYS64628.1|1591871_1592450_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYS64629.1|1592442_1594464_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYS64630.1|1594464_1595523_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYS64631.1|1595526_1596147_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYS64632.1|1596149_1596842_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYS64633.1|1596841_1597477_+	endonuclease III	NA	NA	NA	NA	NA
AYS64634.1|1598077_1599583_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYS64635.1|1599687_1600293_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYS64636.1|1601041_1602316_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029896	Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 chromosome, complete genome	4781801	1783353	1787765	4781801		Escherichia_phage(50.0%)	6	NA	NA
AYS64820.1|1783353_1783593_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYS64821.1|1784465_1785275_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS64822.1|1785347_1785725_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS64823.1|1785872_1786415_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS64824.1|1786606_1787335_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS64825.1|1787351_1787765_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029896	Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 chromosome, complete genome	4781801	1991618	1998852	4781801		Morganella_phage(33.33%)	7	NA	NA
AYS65015.1|1991618_1993049_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYS65016.1|1993122_1993818_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYS65017.1|1993897_1994209_-	hypothetical protein	NA	NA	NA	NA	NA
AYS65018.1|1994859_1996044_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYS65019.1|1996503_1996716_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYS65020.1|1997161_1998430_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYS65021.1|1998432_1998852_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029896	Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 chromosome, complete genome	4781801	2105153	2115660	4781801		Enterobacteria_phage(37.5%)	10	NA	NA
AYS65118.1|2105153_2106467_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS65119.1|2106493_2107573_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS65120.1|2107577_2108351_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS65121.1|2108366_2109341_-	reductase RfbI	NA	NA	NA	NA	NA
AYS65122.1|2109346_2109898_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS65123.1|2109898_2110777_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS65124.1|2110824_2111724_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS65125.1|2111723_2112809_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS65126.1|2113185_2114079_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS65127.1|2114256_2115660_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029896	Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 chromosome, complete genome	4781801	2191551	2200722	4781801	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS65186.1|2191551_2193585_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS65187.1|2193825_2194284_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS65188.1|2194455_2194986_+	lipoprotein	NA	NA	NA	NA	NA
AYS65189.1|2195042_2195510_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS65190.1|2195556_2196276_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS65191.1|2196272_2197958_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS65192.1|2198180_2198912_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS65193.1|2198971_2199079_+	hypothetical protein	NA	NA	NA	NA	NA
AYS65194.1|2199059_2199791_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS65195.1|2199774_2200722_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029896	Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 chromosome, complete genome	4781801	2736263	2749655	4781801	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS65624.1|2736263_2736482_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS65625.1|2736572_2737673_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS65626.1|2737669_2738155_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS65627.1|2738151_2741229_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS65628.1|2741221_2741341_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS65629.1|2741355_2741658_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS65630.1|2741712_2742228_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS65631.1|2742237_2743410_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS65632.1|2743552_2744125_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS65633.1|2744802_2745918_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS65634.1|2745998_2749655_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029896	Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 chromosome, complete genome	4781801	3066816	3110519	4781801	transposase,tRNA,protease,bacteriocin	Bacillus_virus(33.33%)	44	NA	NA
AYS65921.1|3066816_3067275_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS65922.1|3067464_3068544_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS65923.1|3068645_3069809_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS65924.1|3069830_3070877_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS65925.1|3071250_3071676_+	hypothetical protein	NA	NA	NA	NA	NA
AYS65926.1|3071701_3072280_+	hypothetical protein	NA	NA	NA	NA	NA
AYS65927.1|3072313_3072988_+	hypothetical protein	NA	NA	NA	NA	NA
AYS65928.1|3072969_3073653_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS65929.1|3073646_3074303_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS65930.1|3074407_3074866_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS65931.1|3075054_3077046_-	transketolase	NA	NA	NA	NA	NA
AYS65932.1|3077321_3078080_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS65933.1|3078180_3079101_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS65934.1|3079328_3081305_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS65935.1|3081313_3081445_-	hypothetical protein	NA	NA	NA	NA	NA
AYS65936.1|3081739_3082039_-	membrane protein	NA	NA	NA	NA	NA
AYS65937.1|3082094_3083249_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS65938.1|3083741_3085136_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS65939.1|3085214_3085712_+	hypothetical protein	NA	NA	NA	NA	NA
AYS65940.1|3085807_3086515_+	endonuclease I	NA	NA	NA	NA	NA
AYS65941.1|3086591_3087323_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS65942.1|3087342_3088290_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS65943.1|3088505_3089069_+	hypothetical protein	NA	NA	NA	NA	NA
AYS65944.1|3089068_3089485_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS65945.1|3089531_3090218_-	global regulatory protein	NA	NA	NA	NA	NA
AYS65946.1|3090347_3091328_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS65947.1|3091345_3092050_+	hypothetical protein	NA	NA	NA	NA	NA
AYS65948.1|3092068_3092635_+	hypothetical protein	NA	NA	NA	NA	NA
AYS65949.1|3092631_3092922_+	hypothetical protein	NA	NA	NA	NA	NA
AYS65950.1|3092929_3093523_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS65951.1|3093515_3094652_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS65952.1|3094742_3095750_-	hypothetical protein	NA	NA	NA	NA	NA
AYS65953.1|3095882_3096929_-	L-asparaginase	NA	NA	NA	NA	NA
AYS65954.1|3097247_3097706_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS65955.1|3097828_3098548_-	hypothetical protein	NA	NA	NA	NA	NA
AYS65956.1|3098597_3098924_-	hypothetical protein	NA	NA	NA	NA	NA
AYS65957.1|3098923_3099643_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS65958.1|3099797_3100850_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS65959.1|3100877_3101153_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS65960.1|3101265_3102351_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS65961.1|3102567_3103824_+	nucleoside permease	NA	NA	NA	NA	NA
AYS65962.1|3106434_3107142_+	hypothetical protein	NA	NA	NA	NA	NA
AYS65963.1|3109731_3109998_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS65964.1|3110240_3110519_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029896	Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 chromosome, complete genome	4781801	3487702	3525760	4781801	portal,tail,transposase,integrase,plate,capsid,terminase	Salmonella_phage(82.05%)	46	3482666:3482680	3494832:3494846
3482666:3482680	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS66292.1|3487702_3489349_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS66293.1|3489488_3489587_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS66294.1|3489842_3490172_+	hypothetical protein	NA	NA	NA	NA	NA
AYS66295.1|3490212_3491265_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS66296.1|3491660_3492230_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS66297.1|3492355_3492577_+	hypothetical protein	NA	NA	NA	NA	NA
AYS66298.1|3492609_3493119_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS66299.1|3493293_3493518_+	hypothetical protein	NA	NA	NA	NA	NA
AYS66300.1|3493540_3493882_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS66301.1|3493949_3494183_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS66302.1|3494182_3494410_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS66303.1|3494406_3495264_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3494832:3494846	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS66304.1|3495260_3497675_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS66305.1|3497828_3498017_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS66306.1|3499984_3500899_+	hypothetical protein	NA	NA	NA	NA	NA
AYS66307.1|3500895_3501636_+	hypothetical protein	NA	NA	NA	NA	NA
AYS66308.1|3501670_3502708_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS66309.1|3502707_3504474_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS66310.1|3504616_3505450_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS66311.1|3505466_3506525_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS66312.1|3506528_3507179_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS66313.1|3507211_3507739_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS66314.1|3507738_3507942_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS66315.1|3507945_3508161_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS66316.1|3508180_3508654_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS66317.1|3508655_3509033_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS66318.1|3509029_3509458_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS66319.1|3509553_3509985_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS66320.1|3509977_3510424_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS66321.1|3510492_3511071_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS66322.1|3511067_3511427_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS66323.1|3511413_3512322_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS66324.1|3512314_3512920_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS66325.1|3512916_3514431_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.0	3.4e-199
AYS66326.1|3514430_3515024_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS66327.1|3514995_3515436_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS66328.1|3515858_3516431_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS66329.1|3516573_3517746_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS66330.1|3517755_3518271_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS66331.1|3518325_3518628_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS66332.1|3518642_3518762_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS66333.1|3518754_3521832_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS66334.1|3521828_3522314_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS66335.1|3522310_3523411_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS66336.1|3523501_3523720_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS66337.1|3525301_3525760_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029896	Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 chromosome, complete genome	4781801	4441455	4515712	4781801	portal,tail,integrase,plate,capsid,terminase	Salmonella_phage(82.98%)	76	4502956:4502972	4515871:4515887
AYS67108.1|4441455_4443405_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS67109.1|4443476_4444385_+	hypothetical protein	NA	NA	NA	NA	NA
AYS67110.1|4444458_4445358_+	hypothetical protein	NA	NA	NA	NA	NA
AYS67111.1|4445399_4445759_+	hypothetical protein	NA	NA	NA	NA	NA
AYS67112.1|4445858_4446128_-	hypothetical protein	NA	NA	NA	NA	NA
AYS67113.1|4446259_4447534_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS67114.1|4447753_4448131_+	hypothetical protein	NA	NA	NA	NA	NA
AYS67115.1|4448217_4448436_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS67116.1|4448503_4449604_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS67117.1|4449600_4450086_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS67118.1|4450085_4452866_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS67119.1|4452858_4452978_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS67120.1|4452992_4453295_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS67121.1|4453349_4453865_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS67122.1|4453874_4455047_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS67123.1|4455581_4456304_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS67124.1|4456501_4456909_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS67125.1|4456915_4458535_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS67126.1|4458531_4459137_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS67127.1|4459129_4460038_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYS67128.1|4460024_4460384_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS67129.1|4460380_4460959_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS67130.1|4461027_4461474_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS67131.1|4461466_4461898_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYS67132.1|4461993_4462419_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS67133.1|4462418_4462796_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS67134.1|4462800_4463271_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS67135.1|4463290_4463506_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS67136.1|4463509_4463713_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS67137.1|4463712_4464177_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS67138.1|4464270_4464921_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS67139.1|4464924_4465989_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS67140.1|4466005_4466839_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS67141.1|4466981_4468748_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS67142.1|4468744_4469791_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS67143.1|4469839_4470535_-	hypothetical protein	NA	NA	NA	NA	NA
AYS67144.1|4470554_4471619_-	hypothetical protein	NA	NA	NA	NA	NA
AYS67145.1|4471615_4472680_-	hypothetical protein	NA	NA	NA	NA	NA
AYS67146.1|4473604_4473934_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYS67147.1|4473930_4476000_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYS67148.1|4475990_4476851_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS67149.1|4476847_4477432_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS67150.1|4477428_4477656_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS67151.1|4477655_4477889_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS67152.1|4477956_4478298_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS67153.1|4478261_4478462_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS67154.1|4478469_4478979_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS67155.1|4479011_4479254_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS67156.1|4479370_4480003_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS67157.1|4480006_4481032_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS67158.1|4481138_4481492_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS67159.1|4482108_4482396_+	hypothetical protein	NA	NA	NA	NA	NA
AYS67160.1|4482406_4483297_+	methyltransferase	NA	NA	NA	NA	NA
AYS67161.1|4483296_4484043_+	hypothetical protein	NA	NA	NA	NA	NA
AYS67162.1|4484344_4486315_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS67163.1|4486334_4487639_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS67164.1|4487661_4488357_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS67165.1|4488382_4489177_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS67166.1|4489186_4490254_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS67167.1|4490298_4492035_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS67168.1|4492034_4494530_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS67169.1|4494553_4495600_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS67170.1|4495602_4496880_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS67171.1|4497124_4497664_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS67172.1|4498517_4500029_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS67173.1|4500012_4501602_+	hypothetical protein	NA	NA	NA	NA	NA
AYS67174.1|4501765_4502779_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4502956:4502972	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS67175.1|4503205_4503499_+	hypothetical protein	NA	NA	NA	NA	NA
AYS67176.1|4503495_4503984_+	hypothetical protein	NA	NA	NA	NA	NA
AYS67177.1|4504163_4504616_-	hypothetical protein	NA	NA	NA	NA	NA
AYS67178.1|4509838_4510300_+	hypothetical protein	NA	NA	NA	NA	NA
AYS67179.1|4510296_4510518_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS67180.1|4511374_4512157_+	hypothetical protein	NA	NA	NA	NA	NA
AYS67181.1|4512783_4513008_-	hypothetical protein	NA	NA	NA	NA	NA
AYS67182.1|4513137_4514142_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYS67183.1|4514452_4515712_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4515871:4515887	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029896	Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 chromosome, complete genome	4781801	4657964	4668222	4781801		Enterobacteria_phage(77.78%)	14	NA	NA
AYS67320.1|4657964_4659041_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS67321.1|4659037_4660111_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS67322.1|4660085_4661249_-	hypothetical protein	NA	NA	NA	NA	NA
AYS67323.1|4661524_4662091_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS67324.1|4662106_4662346_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS67325.1|4662349_4662829_-	hypothetical protein	NA	NA	NA	NA	NA
AYS67326.1|4662825_4663092_-	hypothetical protein	NA	NA	NA	NA	NA
AYS67327.1|4663631_4663955_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS67328.1|4663938_4664439_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYS67329.1|4664435_4664663_+	hypothetical protein	NA	NA	NA	NA	NA
AYS67330.1|4664659_4664980_+	P4 phage protein	NA	NA	NA	NA	NA
AYS67331.1|4664994_4665669_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYS67332.1|4665665_4667327_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYS67333.1|4668063_4668222_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029895	Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence	217284	3612	57130	217284	holin,transposase	Escherichia_phage(43.75%)	56	NA	NA
AYS63001.1|3612_3888_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS63002.1|3806_4310_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	6.3e-94
AYS63003.1|4636_4861_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63004.1|5516_5777_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63005.1|5865_6357_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63006.1|6361_6670_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63007.1|6877_7258_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63008.1|7343_7592_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63009.1|7629_7851_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYS63010.1|8013_8397_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63011.1|8711_8936_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63012.1|9022_9487_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63013.1|9669_12099_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63014.1|12221_12668_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63015.1|12715_13522_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63016.1|13749_13992_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63017.1|14069_14402_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63018.1|14901_16083_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63019.1|16091_16388_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYS63020.1|16451_16919_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63021.1|17778_18555_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63022.1|18704_19481_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63023.1|19669_20011_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63024.1|20111_20375_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYS63025.1|20608_21307_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYS63026.1|21461_21758_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63027.1|21845_24230_-	periplasmic protein	NA	NA	NA	NA	NA
AYS63028.1|24480_25089_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63029.1|25201_25498_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63030.1|25502_26099_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63031.1|26490_27372_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYS63032.1|27957_28473_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63033.1|29123_31580_-	periplasmic protein	NA	NA	NA	NA	NA
AYS63034.1|32216_33971_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYS63035.1|34156_35314_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYS63036.1|35673_36498_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYS63037.1|36512_37334_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63038.1|37616_38324_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63039.1|38538_39615_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYS63040.1|40149_41025_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYS63041.1|41278_41860_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63042.1|42466_42820_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63043.1|42871_43189_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63044.1|43188_43986_+	pilus assembly protein	NA	NA	NA	NA	NA
AYS63045.1|43988_45221_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63046.1|45222_45663_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63047.1|45640_47011_+	TrhB	NA	NA	NA	NA	NA
AYS63048.1|47019_47532_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63049.1|47532_48390_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYS63050.1|48399_49350_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63051.1|49358_52040_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63052.1|52673_52949_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYS63053.1|53077_55081_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYS63054.1|55143_56439_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63055.1|56432_56936_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	6.3e-94
AYS63056.1|56854_57130_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 2
CP029895	Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence	217284	82223	134786	217284	transposase,integrase	Escherichia_phage(50.0%)	63	107127:107141	131627:131641
AYS63076.1|82223_82727_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.4	9.7e-95
AYS63077.1|82645_82921_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS63078.1|82962_84819_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYS63079.1|85216_86092_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63080.1|86150_86528_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63081.1|86588_87575_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63082.1|87634_88687_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63083.1|88725_88995_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63084.1|89065_90193_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63085.1|90270_92283_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63086.1|92354_92576_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63087.1|92690_93923_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYS63088.1|94197_94722_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63089.1|94712_95678_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63090.1|95748_96684_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63091.1|96761_97682_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63092.1|97754_98690_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63093.1|98866_99823_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63094.1|100235_100505_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63095.1|100559_101150_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63096.1|101157_101415_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63097.1|101488_102025_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63098.1|102041_102497_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63099.1|102480_102708_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63100.1|102756_103011_-	hypothetical protein	NA	NA	NA	NA	NA
AYS63101.1|103078_104038_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63102.1|104048_104957_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63103.1|105261_106443_-	recombinase	NA	NA	NA	NA	NA
AYS63104.1|106657_106870_+	regulatory protein	NA	NA	NA	NA	NA
107127:107141	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYS63105.1|107176_107452_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	7.7e-46
107127:107141	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYS63106.1|107370_107874_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS63107.1|107980_108415_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYS63108.1|108432_108837_+	MerT	NA	NA	NA	NA	NA
AYS63109.1|108850_109126_+	mercuric transport protein	NA	NA	NA	NA	NA
AYS63110.1|109161_109584_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYS63111.1|109635_111330_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYS63112.1|111347_111710_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYS63113.1|111706_111943_+	mercury resistance protein	NA	NA	NA	NA	NA
AYS63114.1|111939_112647_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63115.1|112685_113990_+|integrase	integrase	integrase	NA	NA	NA	NA
AYS63116.1|114018_114741_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS63117.1|115496_116348_+	replication protein	NA	NA	NA	NA	NA
AYS63118.1|116655_117471_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYS63119.1|117531_118335_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS63120.1|118334_119171_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS63121.1|119231_119954_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS63122.1|120533_121394_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
120988:121002	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYS63123.1|121576_121843_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
120988:121002	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYS63124.1|121875_122598_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS63125.1|122831_123758_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYS63126.1|123664_124045_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYS63127.1|124241_124841_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYS63128.1|124872_125886_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYS63129.1|125875_126439_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYS63130.1|126564_127125_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYS63131.1|127127_130094_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYS63132.1|130160_130538_+	hypothetical protein	NA	NA	NA	NA	NA
AYS63133.1|130738_131398_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYS63134.1|131676_131952_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS63135.1|131870_132374_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.4	1.3e-94
AYS63136.1|132955_133711_+	replication protein	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
AYS63137.1|134088_134364_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS63138.1|134282_134786_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	95.2	1.5e-90
