The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029904	Salmonella enterica subsp. enterica serovar Typhi strain 311189_231186 chromosome, complete genome	4807430	930187	937499	4807430	integrase,protease	Dickeya_phage(16.67%)	6	931438:931452	942616:942630
AYS51033.1|930187_931306_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS51034.1|931302_933249_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931438:931452	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS51035.1|933378_933600_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS51036.1|933923_934244_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS51037.1|934274_936551_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS51038.1|937121_937499_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942616:942630	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029904	Salmonella enterica subsp. enterica serovar Typhi strain 311189_231186 chromosome, complete genome	4807430	1008411	1085723	4807430	integrase,terminase,transposase,protease,tail	Salmonella_phage(73.33%)	93	990477:990496	1061084:1061103
990477:990496	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS51088.1|1008411_1009752_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS51089.1|1009748_1009997_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS51090.1|1010037_1010283_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS51091.1|1010282_1011164_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS51092.1|1011160_1012225_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS51093.1|1012302_1012983_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS51094.1|1012979_1013765_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS51095.1|1013770_1014067_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS51096.1|1014157_1014358_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS51097.1|1014646_1015051_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS51098.1|1015382_1015757_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS51099.1|1015841_1016825_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS51100.1|1016827_1017577_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS51101.1|1017587_1017935_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYS51102.1|1017931_1018456_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS51103.1|1018455_1018929_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS51104.1|1018932_1019505_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS51105.1|1019598_1019865_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS51106.1|1019946_1020108_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS51107.1|1020540_1021038_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS51108.1|1021222_1021462_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS51109.1|1021451_1021757_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS51110.1|1021796_1022399_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS51111.1|1022607_1023219_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS51112.1|1023351_1024149_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS51113.1|1024547_1024673_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS51114.1|1024808_1025258_-	lipoprotein	NA	NA	NA	NA	NA
AYS51115.1|1025474_1025864_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS51116.1|1025850_1026132_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS51117.1|1026131_1026746_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS51118.1|1026964_1027219_+	hypothetical protein	NA	NA	NA	NA	NA
AYS51119.1|1027323_1027701_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS51120.1|1027764_1028025_+	hypothetical protein	NA	NA	NA	NA	NA
AYS51121.1|1028114_1028867_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS51122.1|1028832_1030236_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS51123.1|1030235_1031705_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS51124.1|1031796_1032327_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS51125.1|1032341_1033574_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS51126.1|1033578_1034076_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS51127.1|1034087_1035029_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS51128.1|1035070_1035439_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS51129.1|1035404_1035812_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS51130.1|1035808_1036363_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS51131.1|1036349_1036739_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS51132.1|1036713_1037277_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS51133.1|1037280_1038426_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS51134.1|1038437_1038878_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS51135.1|1038881_1039334_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS51136.1|1039511_1041464_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS51137.1|1041463_1042114_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS51138.1|1042117_1042420_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS51139.1|1042422_1043454_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS51140.1|1043450_1043786_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS51141.1|1043980_1044712_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS51142.1|1044711_1045140_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS51143.1|1045198_1045954_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS51144.1|1046041_1046179_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS51145.1|1046194_1046548_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS51146.1|1046548_1047748_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS51147.1|1047744_1048425_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS51148.1|1048424_1049936_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS51149.1|1049950_1050469_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS51150.1|1051390_1052092_-	hypothetical protein	NA	NA	NA	NA	NA
AYS51151.1|1052404_1052683_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS51152.1|1053108_1055721_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS51153.1|1055928_1056939_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS51154.1|1057101_1057647_+	hypothetical protein	NA	NA	NA	NA	NA
AYS51155.1|1057643_1058753_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS51156.1|1058851_1060960_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS51157.1|1060972_1062880_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061084:1061103	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS51158.1|1062894_1064148_+	inner membrane protein	NA	NA	NA	NA	NA
AYS51159.1|1064152_1065793_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS51160.1|1065789_1066353_+	lipoprotein	NA	NA	NA	NA	NA
AYS51161.1|1066606_1066774_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS51162.1|1066873_1067392_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS51163.1|1067460_1069221_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS51164.1|1069406_1069859_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS51165.1|1069930_1070983_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS51166.1|1071337_1071847_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS51167.1|1072063_1072669_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS51168.1|1072655_1074809_-	inner membrane protein	NA	NA	NA	NA	NA
AYS51169.1|1074827_1075274_-	hypothetical protein	NA	NA	NA	NA	NA
AYS51170.1|1075397_1077452_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS51171.1|1077487_1077946_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS51172.1|1078040_1078703_-	hypothetical protein	NA	NA	NA	NA	NA
AYS51173.1|1078873_1079290_+	hypothetical protein	NA	NA	NA	NA	NA
AYS51174.1|1079334_1079652_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS51175.1|1079709_1080921_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS51176.1|1082052_1082511_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS51177.1|1083247_1083529_+	acylphosphatase	NA	NA	NA	NA	NA
AYS51178.1|1083525_1083855_-	sulfite reductase	NA	NA	NA	NA	NA
AYS51179.1|1083941_1084601_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS51180.1|1085264_1085723_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029904	Salmonella enterica subsp. enterica serovar Typhi strain 311189_231186 chromosome, complete genome	4807430	1528541	1602139	4807430	head,transposase,plate,protease,tail,tRNA	Burkholderia_virus(44.12%)	72	NA	NA
AYS51579.1|1528541_1529000_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS51580.1|1529502_1529784_+	stress response protein	NA	NA	NA	NA	NA
AYS51581.1|1530052_1530874_+|protease	serine protease	protease	NA	NA	NA	NA
AYS51582.1|1530908_1531238_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS51583.1|1531224_1531587_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS51584.1|1531698_1531869_-	hypothetical protein	NA	NA	NA	NA	NA
AYS51585.1|1532003_1533038_+	hypothetical protein	NA	NA	NA	NA	NA
AYS51586.1|1533212_1534601_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS51587.1|1534611_1536141_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS51588.1|1536667_1537612_+	hypothetical protein	NA	NA	NA	NA	NA
AYS51589.1|1537793_1538183_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS51590.1|1538154_1538607_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS51591.1|1538801_1539032_-	hypothetical protein	NA	NA	NA	NA	NA
AYS51592.1|1539028_1539712_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS51593.1|1540296_1540599_-	hypothetical protein	NA	NA	NA	NA	NA
AYS51594.1|1541169_1541700_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS51595.1|1541999_1543166_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS51596.1|1543176_1544946_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS51597.1|1546390_1546741_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS51598.1|1547455_1548106_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS51599.1|1548428_1548740_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS51600.1|1548739_1549285_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS51601.1|1549281_1550877_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS51602.1|1550876_1552373_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS51603.1|1552353_1553175_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS51604.1|1553177_1553636_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS51605.1|1553850_1554966_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS51606.1|1554980_1555934_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS51607.1|1555943_1556282_+	hypothetical protein	NA	NA	NA	NA	NA
AYS51608.1|1556283_1556730_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS51609.1|1556729_1557194_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS51610.1|1557434_1558862_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS51611.1|1558861_1559383_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS51612.1|1559385_1559667_+	hypothetical protein	NA	NA	NA	NA	NA
AYS51613.1|1559764_1560100_+	hypothetical protein	NA	NA	NA	NA	NA
AYS51614.1|1560275_1562741_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS51615.1|1562740_1563625_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS51616.1|1563621_1563837_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS51617.1|1563824_1564979_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS51618.1|1564975_1565503_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS51619.1|1565559_1565907_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS51620.1|1565897_1567001_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS51621.1|1566993_1567572_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS51622.1|1567574_1568600_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYS51623.1|1569113_1569731_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS51624.1|1571241_1571814_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYS51625.1|1572094_1573477_+	amino acid permease	NA	NA	NA	NA	NA
AYS51626.1|1573538_1573874_-	hypothetical protein	NA	NA	NA	NA	NA
AYS51627.1|1574000_1574732_+	two-component response regulator	NA	NA	NA	NA	NA
AYS51628.1|1575212_1576364_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYS51629.1|1576516_1578223_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYS51630.1|1578330_1579635_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYS51631.1|1579710_1580640_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYS51632.1|1580636_1582040_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYS51633.1|1582207_1583854_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYS51634.1|1584053_1585229_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYS51635.1|1585331_1586840_+	hypothetical protein	NA	NA	NA	NA	NA
AYS51636.1|1587545_1588547_+	adenosine deaminase	NA	NA	NA	NA	NA
AYS51637.1|1588620_1589736_-	oxidoreductase	NA	NA	NA	NA	NA
AYS51638.1|1589838_1589994_+	hypothetical protein	NA	NA	NA	NA	NA
AYS51639.1|1590292_1590508_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYS51640.1|1590596_1591037_+	hypothetical protein	NA	NA	NA	NA	NA
AYS51641.1|1591113_1591695_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYS51642.1|1591694_1592273_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYS51643.1|1592265_1594287_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYS51644.1|1594287_1595346_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYS51645.1|1595349_1595970_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYS51646.1|1595972_1596665_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYS51647.1|1596664_1597300_+	endonuclease III	NA	NA	NA	NA	NA
AYS51648.1|1597900_1599406_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYS51649.1|1599510_1600116_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYS51650.1|1600864_1602139_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029904	Salmonella enterica subsp. enterica serovar Typhi strain 311189_231186 chromosome, complete genome	4807430	1783176	1787588	4807430		Escherichia_phage(50.0%)	6	NA	NA
AYS51834.1|1783176_1783416_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYS51835.1|1784288_1785098_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS51836.1|1785170_1785548_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS51837.1|1785695_1786238_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS51838.1|1786429_1787158_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS51839.1|1787174_1787588_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029904	Salmonella enterica subsp. enterica serovar Typhi strain 311189_231186 chromosome, complete genome	4807430	1991442	1998676	4807430		Morganella_phage(33.33%)	7	NA	NA
AYS52030.1|1991442_1992873_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYS52031.1|1992946_1993642_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYS52032.1|1993721_1994033_-	hypothetical protein	NA	NA	NA	NA	NA
AYS52033.1|1994683_1995868_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYS52034.1|1996327_1996540_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYS52035.1|1996985_1998254_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYS52036.1|1998256_1998676_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029904	Salmonella enterica subsp. enterica serovar Typhi strain 311189_231186 chromosome, complete genome	4807430	2104976	2115483	4807430		Enterobacteria_phage(37.5%)	10	NA	NA
AYS52133.1|2104976_2106290_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS52134.1|2106316_2107396_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS52135.1|2107400_2108174_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS52136.1|2108189_2109164_-	reductase RfbI	NA	NA	NA	NA	NA
AYS52137.1|2109169_2109721_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS52138.1|2109721_2110600_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS52139.1|2110647_2111547_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS52140.1|2111546_2112632_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS52141.1|2113008_2113902_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS52142.1|2114079_2115483_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029904	Salmonella enterica subsp. enterica serovar Typhi strain 311189_231186 chromosome, complete genome	4807430	2191374	2200545	4807430	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS52201.1|2191374_2193408_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS52202.1|2193648_2194107_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS52203.1|2194278_2194809_+	lipoprotein	NA	NA	NA	NA	NA
AYS52204.1|2194865_2195333_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS52205.1|2195379_2196099_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS52206.1|2196095_2197781_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS52207.1|2198003_2198735_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS52208.1|2198794_2198902_+	hypothetical protein	NA	NA	NA	NA	NA
AYS52209.1|2198882_2199614_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS52210.1|2199597_2200545_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029904	Salmonella enterica subsp. enterica serovar Typhi strain 311189_231186 chromosome, complete genome	4807430	2735981	2749373	4807430	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS52639.1|2735981_2736200_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS52640.1|2736290_2737391_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS52641.1|2737387_2737873_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS52642.1|2737869_2740947_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS52643.1|2740939_2741059_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS52644.1|2741073_2741376_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS52645.1|2741430_2741946_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS52646.1|2741955_2743128_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS52647.1|2743270_2743843_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS52648.1|2744520_2745636_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS52649.1|2745716_2749373_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029904	Salmonella enterica subsp. enterica serovar Typhi strain 311189_231186 chromosome, complete genome	4807430	3066422	3110125	4807430	tRNA,transposase,bacteriocin,protease	Bacillus_virus(33.33%)	44	NA	NA
AYS52936.1|3066422_3066881_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS52937.1|3067070_3068150_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS52938.1|3068251_3069415_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS52939.1|3069436_3070483_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS52940.1|3070856_3071282_+	hypothetical protein	NA	NA	NA	NA	NA
AYS52941.1|3071307_3071886_+	hypothetical protein	NA	NA	NA	NA	NA
AYS52942.1|3071919_3072594_+	hypothetical protein	NA	NA	NA	NA	NA
AYS52943.1|3072575_3073259_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS52944.1|3073252_3073909_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS52945.1|3074013_3074472_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS52946.1|3074660_3076652_-	transketolase	NA	NA	NA	NA	NA
AYS52947.1|3076927_3077686_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS52948.1|3077786_3078707_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS52949.1|3078934_3080911_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS52950.1|3080919_3081051_-	hypothetical protein	NA	NA	NA	NA	NA
AYS52951.1|3081345_3081645_-	membrane protein	NA	NA	NA	NA	NA
AYS52952.1|3081700_3082855_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS52953.1|3083347_3084742_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS52954.1|3084820_3085318_+	hypothetical protein	NA	NA	NA	NA	NA
AYS52955.1|3085413_3086121_+	endonuclease I	NA	NA	NA	NA	NA
AYS52956.1|3086197_3086929_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS52957.1|3086948_3087896_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS52958.1|3088111_3088675_+	hypothetical protein	NA	NA	NA	NA	NA
AYS52959.1|3088674_3089091_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS52960.1|3089137_3089824_-	global regulatory protein	NA	NA	NA	NA	NA
AYS52961.1|3089953_3090934_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS52962.1|3090951_3091656_+	hypothetical protein	NA	NA	NA	NA	NA
AYS52963.1|3091674_3092241_+	hypothetical protein	NA	NA	NA	NA	NA
AYS52964.1|3092237_3092528_+	hypothetical protein	NA	NA	NA	NA	NA
AYS52965.1|3092535_3093129_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS52966.1|3093121_3094258_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS52967.1|3094348_3095356_-	hypothetical protein	NA	NA	NA	NA	NA
AYS52968.1|3095488_3096535_-	L-asparaginase	NA	NA	NA	NA	NA
AYS52969.1|3096853_3097312_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS52970.1|3097434_3098154_-	hypothetical protein	NA	NA	NA	NA	NA
AYS52971.1|3098203_3098530_-	hypothetical protein	NA	NA	NA	NA	NA
AYS52972.1|3098529_3099249_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS52973.1|3099403_3100456_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS52974.1|3100483_3100759_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS52975.1|3100871_3101957_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS52976.1|3102173_3103430_+	nucleoside permease	NA	NA	NA	NA	NA
AYS52977.1|3106040_3106748_+	hypothetical protein	NA	NA	NA	NA	NA
AYS52978.1|3109337_3109604_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS52979.1|3109846_3110125_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029904	Salmonella enterica subsp. enterica serovar Typhi strain 311189_231186 chromosome, complete genome	4807430	3445927	3526117	4807430	capsid,integrase,transposase,plate,terminase,portal,tail	Salmonella_phage(64.0%)	82	3470585:3470601	3524630:3524646
AYS53274.1|3445927_3446203_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS53275.1|3446121_3446625_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS53276.1|3446697_3447051_-	hypothetical protein	NA	NA	NA	NA	NA
AYS53277.1|3447158_3449705_-	adenylate cyclase	NA	NA	NA	NA	NA
AYS53278.1|3450081_3451023_+	porphobilinogen deaminase	NA	NA	NA	NA	NA
AYS53279.1|3451019_3451760_+	uroporphyrinogen III synthase	NA	NA	NA	NA	NA
AYS53280.1|3451781_3452951_+	uroporphyrinogen III methylase	NA	NA	NA	NA	NA
AYS53281.1|3452950_3454150_+	porphyrin biosynthetic protein	NA	NA	NA	NA	NA
AYS53282.1|3455266_3456652_-	amino acid permease	NA	NA	NA	NA	NA
AYS53283.1|3456858_3457599_-	UDP-N-acetyl-D-mannosaminuronic acid transferase	NA	NA	NA	NA	NA
AYS53284.1|3457595_3458954_-	4-alpha-l-fucosyltransferase	NA	NA	NA	NA	NA
AYS53285.1|3458950_3460030_-	4-alpha-L-fucosyltransferase	NA	NA	NA	NA	NA
AYS53286.1|3460026_3461277_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS53287.1|3461278_3462409_-	lipopolysaccharide biosynthesis protein	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
AYS53288.1|3462413_3462962_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS53289.1|3463068_3463950_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.0	1.3e-107
AYS53290.1|3463982_3465050_-	UDP-N-acetylglucosamine epimerase	NA	I7HTA3	Enterobacteria_phage	53.1	3.1e-98
AYS53291.1|3465049_3466312_-	UDP-ManNAc dehydrogenase	NA	M1H3J6	Paramecium_bursaria_Chlorella_virus	27.0	1.6e-24
AYS53292.1|3466308_3467439_-	UDP-N-acetyl-D-glucosamine 2-epimerase	NA	A0A1V0SAG5	Catovirus	27.7	1.8e-27
AYS53293.1|3467494_3468541_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS53294.1|3468552_3469656_-	undecaprenyl-phosphate alpha-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AYS53295.1|3469885_3471145_-	transcription termination factor	NA	NA	NA	NA	NA
3470585:3470601	attL	CAGCATGGTTTTACCCG	NA	NA	NA	NA
AYS53296.1|3471563_3471893_-	thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
AYS53297.1|3472036_3473302_+	ATP-dependent RNA helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.7	3.7e-42
AYS53298.1|3473420_3474902_+	guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase	NA	NA	NA	NA	NA
AYS53299.1|3474941_3476966_-	ATP-dependent DNA helicase	NA	A7KV33	Bacillus_phage	37.2	2.1e-111
AYS53300.1|3477793_3478537_-	uridine phosphorylase	NA	NA	NA	NA	NA
AYS53301.1|3479459_3479741_+	peptidyl-prolyl cis-trans isomerase C	NA	NA	NA	NA	NA
AYS53302.1|3479832_3481308_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AYS53303.1|3481472_3482360_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYS53304.1|3482362_3482704_-	hypothetical protein	NA	A0A2D1GR59	Pseudomonas_phage	38.5	1.7e-05
AYS53305.1|3482700_3483063_-	hypothetical protein	NA	NA	NA	NA	NA
AYS53306.1|3483298_3484843_-	threonine deaminase	NA	NA	NA	NA	NA
AYS53307.1|3484845_3486696_-	dihydroxyacid dehydratase	NA	NA	NA	NA	NA
AYS53308.1|3486852_3487782_-	branched-chain amino-acid aminotransferase	NA	NA	NA	NA	NA
AYS53309.1|3487799_3488060_-	acetohydroxy acid synthase II small subunit	NA	NA	NA	NA	NA
AYS53310.1|3488059_3489706_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS53311.1|3489845_3489944_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS53312.1|3490199_3490529_+	hypothetical protein	NA	NA	NA	NA	NA
AYS53313.1|3490569_3491622_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS53314.1|3492017_3492587_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS53315.1|3492712_3492934_+	hypothetical protein	NA	NA	NA	NA	NA
AYS53316.1|3492966_3493476_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS53317.1|3493650_3493875_+	hypothetical protein	NA	NA	NA	NA	NA
AYS53318.1|3493897_3494239_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS53319.1|3494306_3494540_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS53320.1|3494539_3494767_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS53321.1|3494763_3495621_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
AYS53322.1|3495617_3498032_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS53323.1|3498185_3498374_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS53324.1|3500341_3501256_+	hypothetical protein	NA	NA	NA	NA	NA
AYS53325.1|3501252_3501993_+	hypothetical protein	NA	NA	NA	NA	NA
AYS53326.1|3502027_3503065_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS53327.1|3503064_3504831_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS53328.1|3504973_3505807_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS53329.1|3505823_3506882_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS53330.1|3506885_3507536_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS53331.1|3507568_3508096_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS53332.1|3508095_3508299_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS53333.1|3508302_3508518_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS53334.1|3508537_3509011_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS53335.1|3509012_3509390_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS53336.1|3509386_3509815_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS53337.1|3509910_3510342_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS53338.1|3510334_3510781_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS53339.1|3510849_3511428_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS53340.1|3511424_3511784_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS53341.1|3511770_3512679_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS53342.1|3512671_3513277_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS53343.1|3513273_3514788_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYS53344.1|3514787_3515381_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS53345.1|3515352_3515793_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS53346.1|3516215_3516788_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS53347.1|3516930_3518103_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS53348.1|3518112_3518628_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS53349.1|3518682_3518985_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS53350.1|3518999_3519119_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS53351.1|3519111_3522189_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS53352.1|3522185_3522671_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS53353.1|3522667_3523768_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS53354.1|3523858_3524077_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS53355.1|3525658_3526117_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
3524630:3524646	attR	CGGGTAAAACCATGCTG	NA	NA	NA	NA
>prophage 11
CP029904	Salmonella enterica subsp. enterica serovar Typhi strain 311189_231186 chromosome, complete genome	4807430	3792868	3810277	4807430	transposase,integrase	Escherichia_phage(30.0%)	17	3790574:3790633	3815074:3815510
3790574:3790633	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
AYS53574.1|3792868_3795835_-|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYS53575.1|3795837_3796398_-	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYS53576.1|3796523_3797087_-	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYS53577.1|3797076_3798090_-|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYS53578.1|3798121_3798721_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	31.4	3.1e-15
AYS53579.1|3798917_3799298_+	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYS53580.1|3799204_3800131_+	sulfonamide-resistant dihydropteroate synthase sul1	NA	NA	NA	NA	NA
AYS53581.1|3800364_3801087_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS53582.1|3801119_3801386_+	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
AYS53583.1|3801568_3802429_+	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AYS53584.1|3803014_3803731_+|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	100.0	2.4e-139
AYS53585.1|3803791_3804628_-	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS53586.1|3804627_3805431_-	streptomycin phosphotransferase	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
AYS53587.1|3805491_3806307_-	dihydropteroate synthase	NA	NA	NA	NA	NA
AYS53588.1|3806614_3807466_-	replication protein	NA	NA	NA	NA	NA
AYS53589.1|3808221_3808938_-|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	100.0	2.4e-139
AYS53590.1|3808972_3810277_-|integrase	integrase	integrase	NA	NA	NA	NA
3815074:3815510	attR	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGG	NA	NA	NA	NA
>prophage 12
CP029904	Salmonella enterica subsp. enterica serovar Typhi strain 311189_231186 chromosome, complete genome	4807430	4467089	4541346	4807430	capsid,integrase,plate,terminase,portal,tail	Salmonella_phage(82.61%)	75	4528590:4528606	4541505:4541521
AYS54156.1|4467089_4469039_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS54157.1|4469110_4470019_+	hypothetical protein	NA	NA	NA	NA	NA
AYS54158.1|4470092_4470992_+	hypothetical protein	NA	NA	NA	NA	NA
AYS54159.1|4471033_4471393_+	hypothetical protein	NA	NA	NA	NA	NA
AYS54160.1|4471492_4471762_-	hypothetical protein	NA	NA	NA	NA	NA
AYS54161.1|4471893_4473168_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS54162.1|4473387_4473765_+	hypothetical protein	NA	NA	NA	NA	NA
AYS54163.1|4473851_4474070_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS54164.1|4474137_4475238_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS54165.1|4475234_4475720_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS54166.1|4475719_4478500_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS54167.1|4478492_4478612_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS54168.1|4478626_4478929_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS54169.1|4478983_4479499_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS54170.1|4479508_4480681_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS54171.1|4481215_4481938_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS54172.1|4482135_4482543_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS54173.1|4482549_4484169_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS54174.1|4484165_4484771_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS54175.1|4484763_4485672_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYS54176.1|4485658_4486018_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS54177.1|4486014_4486593_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS54178.1|4486661_4487108_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS54179.1|4487100_4487532_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYS54180.1|4487627_4488053_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS54181.1|4488052_4488430_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS54182.1|4488434_4488905_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS54183.1|4488924_4489140_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS54184.1|4489143_4489347_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS54185.1|4489346_4489811_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS54186.1|4489904_4490555_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS54187.1|4490558_4491623_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS54188.1|4491639_4492473_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS54189.1|4492615_4494382_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS54190.1|4494378_4495425_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS54191.1|4495473_4496169_-	hypothetical protein	NA	NA	NA	NA	NA
AYS54192.1|4496188_4497253_-	hypothetical protein	NA	NA	NA	NA	NA
AYS54193.1|4497249_4498314_-	hypothetical protein	NA	NA	NA	NA	NA
AYS54194.1|4499564_4501634_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYS54195.1|4501624_4502485_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS54196.1|4502481_4503066_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS54197.1|4503062_4503290_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS54198.1|4503289_4503523_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS54199.1|4503590_4503932_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS54200.1|4503895_4504096_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS54201.1|4504103_4504613_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS54202.1|4504645_4504888_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS54203.1|4505004_4505637_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS54204.1|4505640_4506666_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS54205.1|4506772_4507126_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS54206.1|4507742_4508030_+	hypothetical protein	NA	NA	NA	NA	NA
AYS54207.1|4508040_4508931_+	methyltransferase	NA	NA	NA	NA	NA
AYS54208.1|4508930_4509677_+	hypothetical protein	NA	NA	NA	NA	NA
AYS54209.1|4509978_4511949_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS54210.1|4511968_4513273_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS54211.1|4513295_4513991_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS54212.1|4514016_4514811_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS54213.1|4514820_4515888_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS54214.1|4515932_4517669_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS54215.1|4517668_4520164_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS54216.1|4520187_4521234_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS54217.1|4521236_4522514_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS54218.1|4522758_4523298_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS54219.1|4524151_4525663_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS54220.1|4525646_4527236_+	hypothetical protein	NA	NA	NA	NA	NA
AYS54221.1|4527399_4528413_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4528590:4528606	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS54222.1|4528839_4529133_+	hypothetical protein	NA	NA	NA	NA	NA
AYS54223.1|4529129_4529618_+	hypothetical protein	NA	NA	NA	NA	NA
AYS54224.1|4529797_4530250_-	hypothetical protein	NA	NA	NA	NA	NA
AYS54225.1|4535472_4535934_+	hypothetical protein	NA	NA	NA	NA	NA
AYS54226.1|4535930_4536152_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS54227.1|4537008_4537791_+	hypothetical protein	NA	NA	NA	NA	NA
AYS54228.1|4538417_4538642_-	hypothetical protein	NA	NA	NA	NA	NA
AYS54229.1|4538771_4539776_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYS54230.1|4540086_4541346_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4541505:4541521	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 13
CP029904	Salmonella enterica subsp. enterica serovar Typhi strain 311189_231186 chromosome, complete genome	4807430	4683598	4693857	4807430	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYS54367.1|4683598_4684675_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS54368.1|4684671_4685745_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS54369.1|4685719_4686883_-	hypothetical protein	NA	NA	NA	NA	NA
AYS54370.1|4687158_4687725_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS54371.1|4687740_4687980_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS54372.1|4687983_4688844_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS54373.1|4689266_4689590_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS54374.1|4689573_4690074_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYS54375.1|4690070_4690298_+	hypothetical protein	NA	NA	NA	NA	NA
AYS54376.1|4690294_4690615_+	P4 phage protein	NA	NA	NA	NA	NA
AYS54377.1|4690629_4691304_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYS54378.1|4691300_4692962_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYS54379.1|4693698_4693857_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029905	Salmonella enterica subsp. enterica serovar Typhi strain 311189_231186 plasmid pHCM2, complete sequence	106706	35	76536	106706	tail	Salmonella_phage(94.32%)	91	NA	NA
AYS54470.1|35_1505_+	exonuclease	NA	J9Q741	Salmonella_phage	98.2	4.2e-255
AYS54471.1|1494_2241_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
AYS54472.1|2253_2823_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
AYS54473.1|2900_5216_+	ribonucleotide-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AYS54474.1|5323_6466_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
AYS54475.1|6548_7478_+	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
AYS54476.1|7593_8709_+	putative thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
AYS54477.1|8710_9124_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AYS54478.1|9120_9597_+	hypothetical protein	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AYS54479.1|9596_10241_+	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AYS54480.1|10304_10724_+	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
AYS54481.1|10733_11291_+	hypothetical protein	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AYS54482.1|11335_12262_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.1e-107
AYS54483.1|12447_13041_+	hypothetical protein	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
AYS54484.1|13243_13474_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AYS54485.1|14059_14668_+	putative ribonuclease H	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AYS54486.1|14810_15305_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
AYS54487.1|15314_15503_+	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AYS54488.1|15611_16454_+	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AYS54489.1|16562_17135_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AYS54490.1|17258_18962_+	putative DNA modification methylase	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
AYS54491.1|19020_19710_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
AYS54492.1|19706_19880_+	hypothetical protein	NA	J9Q801	Salmonella_phage	98.2	9.5e-26
AYS54493.1|19990_20362_+	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
AYS54494.1|20453_21095_+	hypothetical protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
AYS54495.1|21091_21634_+	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
AYS54496.1|21645_21954_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
AYS54497.1|21950_22238_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
AYS54498.1|22298_22502_-	hypothetical protein	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
AYS54499.1|22675_22957_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
AYS54500.1|23041_23359_+	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
AYS54501.1|23368_24559_+	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
AYS54502.1|25995_26241_-	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
AYS54503.1|26383_26599_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
AYS54504.1|26609_26828_+	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AYS54505.1|26922_27237_+	hypothetical protein	NA	NA	NA	NA	NA
AYS54506.1|27313_27625_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
AYS54507.1|27753_28146_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
AYS54508.1|28266_28554_+	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
AYS54509.1|28759_29242_+	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
AYS54510.1|29873_30101_-	hypothetical protein	NA	NA	NA	NA	NA
AYS54511.1|30185_30836_-	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
AYS54512.1|31158_31467_-	periplasmic protein	NA	NA	NA	NA	NA
AYS54513.1|31470_31998_-	putative transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
AYS54514.1|32002_32425_-	putative lipoprotein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
AYS54515.1|32484_32763_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AYS54516.1|32765_34325_-	putative helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
AYS54517.1|34407_35088_+	hypothetical protein	NA	J9Q756	Salmonella_phage	99.6	7.4e-122
AYS54518.1|35087_35756_+	hypothetical protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
AYS54519.1|35752_36391_+	putative ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	99.1	5.5e-111
AYS54520.1|36383_36638_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AYS54521.1|36634_37534_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
AYS54522.1|37543_37810_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AYS54523.1|38005_38647_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.5	1.8e-109
AYS54524.1|38649_39906_+	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
AYS54525.1|39939_41514_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
AYS54526.1|41536_42433_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
AYS54527.1|42459_43335_+	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
AYS54528.1|43409_44333_+	hypothetical protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
AYS54529.1|44376_44811_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
AYS54530.1|44810_45644_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
AYS54531.1|45741_46086_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AYS54532.1|46076_46550_+	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AYS54533.1|46551_46935_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AYS54534.1|47009_47756_+	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
AYS54535.1|47815_48133_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYS54536.1|48490_53074_+	hypothetical protein	NA	J9Q712	Salmonella_phage	92.9	0.0e+00
AYS54537.1|53115_53451_+	hypothetical protein	NA	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AYS54538.1|53507_54239_+|tail	putative phage tail protein	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
AYS54539.1|54231_55029_+	hypothetical protein	NA	J9Q7R4	Salmonella_phage	95.8	1.2e-155
AYS54540.1|55016_55604_+|tail	putative phage tail protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
AYS54541.1|55618_60007_+|tail	putative phage tail protein	tail	J9Q713	Salmonella_phage	86.7	0.0e+00
AYS54542.1|60089_62642_+	hypothetical protein	NA	A0A0A0YQM3	Citrobacter_virus	52.5	1.4e-152
AYS54543.1|62756_63080_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
AYS54544.1|63066_63786_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	1.5e-125
AYS54545.1|63854_64199_+	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.6	5.9e-27
AYS54546.1|64249_64801_-	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
AYS54547.1|65131_65797_+	hypothetical protein	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
AYS54548.1|65796_66156_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AYS54549.1|66204_66960_+	hypothetical protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
AYS54550.1|67029_68085_-	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
AYS54551.1|68362_69088_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
AYS54552.1|69148_70489_+	putative DNA helicase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
AYS54553.1|70551_71763_+	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
AYS54554.1|71764_72817_-	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
AYS54555.1|73000_73795_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
AYS54556.1|74095_74353_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
AYS54557.1|74387_75710_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
AYS54558.1|75875_76082_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
AYS54559.1|76081_76234_+	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
AYS54560.1|76230_76536_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
>prophage 2
CP029905	Salmonella enterica subsp. enterica serovar Typhi strain 311189_231186 plasmid pHCM2, complete sequence	106706	85026	106298	106706		Salmonella_phage(100.0%)	22	NA	NA
AYS54573.1|85026_87384_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	90.7	0.0e+00
AYS54574.1|87480_88716_+	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
AYS54575.1|88896_92415_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
AYS54576.1|92411_92855_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.0e-71
AYS54577.1|92948_93539_-	hypothetical protein	NA	NA	NA	NA	NA
AYS54578.1|93784_94216_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
AYS54579.1|94335_95364_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
AYS54580.1|95424_96369_+	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
AYS54581.1|96368_96635_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYS54582.1|96637_97714_+	putative recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AYS54583.1|98009_98852_+	putative lipoprotein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
AYS54584.1|99014_99386_+	hypothetical protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
AYS54585.1|99369_99780_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
AYS54586.1|99848_100124_+	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
AYS54587.1|100164_100470_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
AYS54588.1|100469_100673_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
AYS54589.1|101201_102257_-	putative replication protein A	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
AYS54590.1|103001_103646_+	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
AYS54591.1|103721_104216_+	hypothetical protein	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
AYS54592.1|104247_104553_-	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.0	2.0e-50
AYS54593.1|104979_106065_+	exonuclease	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
AYS54594.1|106061_106298_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
