The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029878	Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 chromosome, complete genome	4782665	930181	937493	4782665	integrase,protease	Dickeya_phage(16.67%)	6	931432:931446	942611:942625
AYS46822.1|930181_931300_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS46823.1|931296_933243_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931432:931446	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS46824.1|933372_933594_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS46825.1|933917_934238_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS46826.1|934268_936545_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS46827.1|937115_937493_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942611:942625	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029878	Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 chromosome, complete genome	4782665	1008436	1085748	4782665	terminase,tail,protease,integrase,transposase	Salmonella_phage(73.33%)	93	990502:990521	1061109:1061128
990502:990521	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS46877.1|1008436_1009777_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS46878.1|1009773_1010022_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS46879.1|1010062_1010308_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS46880.1|1010307_1011189_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS46881.1|1011185_1012250_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS46882.1|1012327_1013008_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS46883.1|1013004_1013790_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS46884.1|1013795_1014092_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS46885.1|1014182_1014383_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS46886.1|1014671_1015076_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS46887.1|1015407_1015782_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS46888.1|1015866_1016850_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS46889.1|1016852_1017602_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS46890.1|1017612_1017960_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYS46891.1|1017956_1018481_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS46892.1|1018480_1018954_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS46893.1|1018957_1019530_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS46894.1|1019623_1019890_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS46895.1|1019971_1020133_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS46896.1|1020565_1021063_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS46897.1|1021247_1021487_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS46898.1|1021476_1021782_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS46899.1|1021821_1022424_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS46900.1|1022632_1023244_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS46901.1|1023376_1024174_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS46902.1|1024572_1024698_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS46903.1|1024833_1025283_-	lipoprotein	NA	NA	NA	NA	NA
AYS46904.1|1025499_1025889_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS46905.1|1025875_1026157_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS46906.1|1026156_1026771_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS46907.1|1026989_1027244_+	hypothetical protein	NA	NA	NA	NA	NA
AYS46908.1|1027348_1027726_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS46909.1|1027789_1028050_+	hypothetical protein	NA	NA	NA	NA	NA
AYS46910.1|1028139_1028892_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS46911.1|1028857_1030261_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS46912.1|1030260_1031730_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS46913.1|1031821_1032352_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS46914.1|1032366_1033599_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS46915.1|1033603_1034101_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS46916.1|1034112_1035054_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS46917.1|1035095_1035464_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS46918.1|1035429_1035837_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS46919.1|1035833_1036388_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS46920.1|1036374_1036764_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS46921.1|1036738_1037302_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS46922.1|1037305_1038451_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS46923.1|1038462_1038903_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS46924.1|1038906_1039359_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS46925.1|1039536_1041489_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS46926.1|1041488_1042139_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS46927.1|1042142_1042445_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS46928.1|1042447_1043479_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS46929.1|1043475_1043811_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS46930.1|1044005_1044737_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS46931.1|1044736_1045165_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS46932.1|1045223_1045979_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS46933.1|1046066_1046204_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS46934.1|1046219_1046573_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS46935.1|1046573_1047773_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS46936.1|1047769_1048450_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS46937.1|1048449_1049961_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS46938.1|1049975_1050494_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS46939.1|1051415_1052117_-	hypothetical protein	NA	NA	NA	NA	NA
AYS46940.1|1052429_1052708_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS46941.1|1053133_1055746_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS46942.1|1055953_1056964_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS46943.1|1057126_1057672_+	hypothetical protein	NA	NA	NA	NA	NA
AYS46944.1|1057668_1058778_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS46945.1|1058876_1060985_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS46946.1|1060997_1062905_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061109:1061128	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS46947.1|1062919_1064173_+	inner membrane protein	NA	NA	NA	NA	NA
AYS46948.1|1064177_1065818_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS46949.1|1065814_1066378_+	lipoprotein	NA	NA	NA	NA	NA
AYS46950.1|1066631_1066799_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS46951.1|1066898_1067417_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS46952.1|1067485_1069246_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS46953.1|1069431_1069884_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS46954.1|1069955_1071008_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS46955.1|1071362_1071872_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS46956.1|1072088_1072694_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS46957.1|1072680_1074834_-	inner membrane protein	NA	NA	NA	NA	NA
AYS46958.1|1074852_1075299_-	hypothetical protein	NA	NA	NA	NA	NA
AYS46959.1|1075422_1077477_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS46960.1|1077512_1077971_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS46961.1|1078065_1078728_-	hypothetical protein	NA	NA	NA	NA	NA
AYS46962.1|1078898_1079315_+	hypothetical protein	NA	NA	NA	NA	NA
AYS46963.1|1079359_1079677_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS46964.1|1079734_1080946_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS46965.1|1082077_1082536_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS46966.1|1083272_1083554_+	acylphosphatase	NA	NA	NA	NA	NA
AYS46967.1|1083550_1083880_-	sulfite reductase	NA	NA	NA	NA	NA
AYS46968.1|1083966_1084626_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS46969.1|1085289_1085748_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029878	Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 chromosome, complete genome	4782665	1528566	1602136	4782665	plate,tail,head,protease,tRNA,transposase	Burkholderia_virus(42.11%)	81	NA	NA
AYS47369.1|1528566_1529025_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS47370.1|1529527_1529809_+	stress response protein	NA	NA	NA	NA	NA
AYS47371.1|1530077_1530899_+|protease	serine protease	protease	NA	NA	NA	NA
AYS47372.1|1530933_1531263_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS47373.1|1531249_1531612_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS47374.1|1531723_1531894_-	hypothetical protein	NA	NA	NA	NA	NA
AYS47375.1|1532028_1533063_+	hypothetical protein	NA	NA	NA	NA	NA
AYS47376.1|1533237_1534626_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS47377.1|1534636_1536166_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS47378.1|1536692_1537637_+	hypothetical protein	NA	NA	NA	NA	NA
AYS47379.1|1537818_1538208_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS47380.1|1538179_1538632_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS47381.1|1538826_1539057_-	hypothetical protein	NA	NA	NA	NA	NA
AYS47382.1|1539053_1539737_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS47383.1|1539733_1539949_-	hypothetical protein	NA	NA	NA	NA	NA
AYS47384.1|1539941_1540325_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYS47385.1|1540321_1540624_-	hypothetical protein	NA	NA	NA	NA	NA
AYS47386.1|1540633_1540906_-	hypothetical protein	NA	NA	NA	NA	NA
AYS47387.1|1541194_1541725_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS47388.1|1541752_1542022_-	hypothetical protein	NA	NA	NA	NA	NA
AYS47389.1|1542024_1543191_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS47390.1|1543201_1544971_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS47391.1|1545148_1545580_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYS47392.1|1545575_1546172_+	hypothetical protein	NA	NA	NA	NA	NA
AYS47393.1|1546415_1546766_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS47394.1|1547480_1548131_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS47395.1|1548127_1548454_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYS47396.1|1548453_1548765_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS47397.1|1548764_1549310_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS47398.1|1549306_1550902_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS47399.1|1550901_1552398_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS47400.1|1552378_1553200_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS47401.1|1553202_1553661_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS47402.1|1553875_1554991_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS47403.1|1555005_1555959_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS47404.1|1555968_1556307_+	hypothetical protein	NA	NA	NA	NA	NA
AYS47405.1|1556308_1556755_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS47406.1|1556754_1557219_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS47407.1|1557215_1557470_+	hypothetical protein	NA	NA	NA	NA	NA
AYS47408.1|1557459_1558887_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS47409.1|1558886_1559408_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS47410.1|1559410_1559692_+	hypothetical protein	NA	NA	NA	NA	NA
AYS47411.1|1559789_1560125_+	hypothetical protein	NA	NA	NA	NA	NA
AYS47412.1|1560300_1562766_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS47413.1|1562765_1563650_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS47414.1|1563646_1563862_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS47415.1|1563849_1565004_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS47416.1|1565000_1565528_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS47417.1|1565584_1565932_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS47418.1|1565922_1567026_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS47419.1|1567018_1567597_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS47420.1|1567599_1568625_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYS47421.1|1569138_1569756_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS47422.1|1570249_1570642_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	51.1	6.8e-19
AYS47423.1|1571238_1571811_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYS47424.1|1572091_1573474_+	amino acid permease	NA	NA	NA	NA	NA
AYS47425.1|1573535_1573871_-	hypothetical protein	NA	NA	NA	NA	NA
AYS47426.1|1573997_1574729_+	two-component response regulator	NA	NA	NA	NA	NA
AYS47427.1|1575209_1576361_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYS47428.1|1576513_1578220_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYS47429.1|1578327_1579632_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYS47430.1|1579707_1580637_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYS47431.1|1580633_1582037_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYS47432.1|1582204_1583851_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYS47433.1|1584050_1585226_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYS47434.1|1585328_1586837_+	hypothetical protein	NA	NA	NA	NA	NA
AYS47435.1|1587542_1588544_+	adenosine deaminase	NA	NA	NA	NA	NA
AYS47436.1|1588617_1589733_-	oxidoreductase	NA	NA	NA	NA	NA
AYS47437.1|1589835_1589991_+	hypothetical protein	NA	NA	NA	NA	NA
AYS47438.1|1590289_1590505_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYS47439.1|1590593_1591034_+	hypothetical protein	NA	NA	NA	NA	NA
AYS47440.1|1591110_1591692_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYS47441.1|1591691_1592270_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYS47442.1|1592262_1594284_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYS47443.1|1594284_1595343_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYS47444.1|1595346_1595967_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYS47445.1|1595969_1596662_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYS47446.1|1596661_1597297_+	endonuclease III	NA	NA	NA	NA	NA
AYS47447.1|1597897_1599403_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYS47448.1|1599507_1600113_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYS47449.1|1600861_1602136_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029878	Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 chromosome, complete genome	4782665	1783173	1787585	4782665		Escherichia_phage(50.0%)	6	NA	NA
AYS47633.1|1783173_1783413_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYS47634.1|1784285_1785095_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS47635.1|1785167_1785545_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS47636.1|1785692_1786235_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS47637.1|1786426_1787155_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS47638.1|1787171_1787585_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029878	Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 chromosome, complete genome	4782665	2104973	2115480	4782665		Enterobacteria_phage(37.5%)	10	NA	NA
AYS47931.1|2104973_2106287_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS47932.1|2106313_2107393_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS47933.1|2107397_2108171_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS47934.1|2108186_2109161_-	reductase RfbI	NA	NA	NA	NA	NA
AYS47935.1|2109166_2109718_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS47936.1|2109718_2110597_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS47937.1|2110644_2111544_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS47938.1|2111543_2112629_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS47939.1|2113005_2113899_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS47940.1|2114076_2115480_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 6
CP029878	Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 chromosome, complete genome	4782665	2192709	2201880	4782665	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS48000.1|2192709_2194743_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS48001.1|2194983_2195442_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS48002.1|2195613_2196144_+	lipoprotein	NA	NA	NA	NA	NA
AYS48003.1|2196200_2196668_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS48004.1|2196714_2197434_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS48005.1|2197430_2199116_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS48006.1|2199338_2200070_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS48007.1|2200129_2200237_+	hypothetical protein	NA	NA	NA	NA	NA
AYS48008.1|2200217_2200949_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS48009.1|2200932_2201880_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 7
CP029878	Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 chromosome, complete genome	4782665	2737204	2750596	4782665	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS48437.1|2737204_2737423_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS48438.1|2737513_2738614_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS48439.1|2738610_2739096_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS48440.1|2739092_2742170_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS48441.1|2742162_2742282_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS48442.1|2742296_2742599_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS48443.1|2742653_2743169_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS48444.1|2743178_2744351_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS48445.1|2744493_2745066_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS48446.1|2745743_2746859_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS48447.1|2746939_2750596_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 8
CP029878	Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 chromosome, complete genome	4782665	3067757	3111460	4782665	tRNA,transposase,bacteriocin,protease	Bacillus_virus(33.33%)	44	NA	NA
AYS48734.1|3067757_3068216_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS48735.1|3068405_3069485_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS48736.1|3069586_3070750_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS48737.1|3070771_3071818_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS48738.1|3072191_3072617_+	hypothetical protein	NA	NA	NA	NA	NA
AYS48739.1|3072642_3073221_+	hypothetical protein	NA	NA	NA	NA	NA
AYS48740.1|3073254_3073929_+	hypothetical protein	NA	NA	NA	NA	NA
AYS48741.1|3073910_3074594_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS48742.1|3074587_3075244_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS48743.1|3075348_3075807_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS48744.1|3075995_3077987_-	transketolase	NA	NA	NA	NA	NA
AYS48745.1|3078262_3079021_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS48746.1|3079121_3080042_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS48747.1|3080269_3082246_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS48748.1|3082254_3082386_-	hypothetical protein	NA	NA	NA	NA	NA
AYS48749.1|3082680_3082980_-	membrane protein	NA	NA	NA	NA	NA
AYS48750.1|3083035_3084190_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS48751.1|3084682_3086077_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS48752.1|3086155_3086653_+	hypothetical protein	NA	NA	NA	NA	NA
AYS48753.1|3086748_3087456_+	endonuclease I	NA	NA	NA	NA	NA
AYS48754.1|3087532_3088264_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS48755.1|3088283_3089231_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS48756.1|3089446_3090010_+	hypothetical protein	NA	NA	NA	NA	NA
AYS48757.1|3090009_3090426_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS48758.1|3090472_3091159_-	global regulatory protein	NA	NA	NA	NA	NA
AYS48759.1|3091288_3092269_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS48760.1|3092286_3092991_+	hypothetical protein	NA	NA	NA	NA	NA
AYS48761.1|3093009_3093576_+	hypothetical protein	NA	NA	NA	NA	NA
AYS48762.1|3093572_3093863_+	hypothetical protein	NA	NA	NA	NA	NA
AYS48763.1|3093870_3094464_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS48764.1|3094456_3095593_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS48765.1|3095683_3096691_-	hypothetical protein	NA	NA	NA	NA	NA
AYS48766.1|3096823_3097870_-	L-asparaginase	NA	NA	NA	NA	NA
AYS48767.1|3098188_3098647_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS48768.1|3098769_3099489_-	hypothetical protein	NA	NA	NA	NA	NA
AYS48769.1|3099538_3099865_-	hypothetical protein	NA	NA	NA	NA	NA
AYS48770.1|3099864_3100584_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS48771.1|3100738_3101791_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS48772.1|3101818_3102094_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS48773.1|3102206_3103292_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS48774.1|3103508_3104765_+	nucleoside permease	NA	NA	NA	NA	NA
AYS48775.1|3107375_3108083_+	hypothetical protein	NA	NA	NA	NA	NA
AYS48776.1|3110672_3110939_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS48777.1|3111181_3111460_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 9
CP029878	Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 chromosome, complete genome	4782665	3488820	3526878	4782665	terminase,plate,tail,capsid,portal,integrase,transposase	Salmonella_phage(82.05%)	46	3483784:3483798	3495950:3495964
3483784:3483798	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS49105.1|3488820_3490467_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS49106.1|3490606_3490705_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS49107.1|3490960_3491290_+	hypothetical protein	NA	NA	NA	NA	NA
AYS49108.1|3491330_3492383_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS49109.1|3492778_3493348_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS49110.1|3493473_3493695_+	hypothetical protein	NA	NA	NA	NA	NA
AYS49111.1|3493727_3494237_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS49112.1|3494411_3494636_+	hypothetical protein	NA	NA	NA	NA	NA
AYS49113.1|3494658_3495000_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS49114.1|3495067_3495301_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS49115.1|3495300_3495528_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS49116.1|3495524_3496382_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3495950:3495964	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS49117.1|3496378_3498793_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS49118.1|3498946_3499135_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS49119.1|3501102_3502017_+	hypothetical protein	NA	NA	NA	NA	NA
AYS49120.1|3502013_3502754_+	hypothetical protein	NA	NA	NA	NA	NA
AYS49121.1|3502788_3503826_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS49122.1|3503825_3505592_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS49123.1|3505734_3506568_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS49124.1|3506584_3507643_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS49125.1|3507646_3508297_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS49126.1|3508329_3508857_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS49127.1|3508856_3509060_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS49128.1|3509063_3509279_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS49129.1|3509298_3509772_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS49130.1|3509773_3510151_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS49131.1|3510147_3510576_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS49132.1|3510671_3511103_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS49133.1|3511095_3511542_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS49134.1|3511610_3512189_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS49135.1|3512185_3512545_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS49136.1|3512531_3513440_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS49137.1|3513432_3514038_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS49138.1|3514034_3515549_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYS49139.1|3515548_3516142_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS49140.1|3516113_3516554_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS49141.1|3516976_3517549_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS49142.1|3517691_3518864_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS49143.1|3518873_3519389_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS49144.1|3519443_3519746_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS49145.1|3519760_3519880_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS49146.1|3519872_3522950_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS49147.1|3522946_3523432_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS49148.1|3523428_3524529_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS49149.1|3524619_3524838_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS49150.1|3526419_3526878_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 10
CP029878	Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 chromosome, complete genome	4782665	4442411	4516575	4782665	terminase,plate,tail,capsid,portal,integrase	Salmonella_phage(82.98%)	76	4503912:4503928	4516734:4516750
AYS49922.1|4442411_4444361_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS49923.1|4444432_4445341_+	hypothetical protein	NA	NA	NA	NA	NA
AYS49924.1|4445414_4446314_+	hypothetical protein	NA	NA	NA	NA	NA
AYS49925.1|4446355_4446715_+	hypothetical protein	NA	NA	NA	NA	NA
AYS49926.1|4446814_4447084_-	hypothetical protein	NA	NA	NA	NA	NA
AYS49927.1|4447215_4448490_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS49928.1|4448709_4449087_+	hypothetical protein	NA	NA	NA	NA	NA
AYS49929.1|4449173_4449392_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS49930.1|4449459_4450560_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS49931.1|4450556_4451042_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS49932.1|4451041_4453822_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS49933.1|4453814_4453934_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS49934.1|4453948_4454251_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS49935.1|4454305_4454821_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS49936.1|4454830_4456003_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS49937.1|4456537_4457260_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS49938.1|4457457_4457865_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS49939.1|4457871_4459491_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS49940.1|4459487_4460093_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS49941.1|4460085_4460994_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	96.7	4.4e-154
AYS49942.1|4460980_4461340_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS49943.1|4461336_4461915_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS49944.1|4461983_4462430_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS49945.1|4462422_4462854_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYS49946.1|4462949_4463375_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS49947.1|4463374_4463752_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS49948.1|4463756_4464227_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS49949.1|4464246_4464462_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS49950.1|4464465_4464669_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS49951.1|4464668_4465133_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS49952.1|4465226_4465877_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS49953.1|4465880_4466945_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS49954.1|4466961_4467795_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS49955.1|4467937_4469704_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS49956.1|4469700_4470747_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS49957.1|4470795_4471491_-	hypothetical protein	NA	NA	NA	NA	NA
AYS49958.1|4471510_4472575_-	hypothetical protein	NA	NA	NA	NA	NA
AYS49959.1|4472571_4473636_-	hypothetical protein	NA	NA	NA	NA	NA
AYS49960.1|4474560_4474890_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYS49961.1|4474886_4476956_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYS49962.1|4476946_4477807_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS49963.1|4477803_4478388_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS49964.1|4478384_4478612_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS49965.1|4478611_4478845_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS49966.1|4478912_4479254_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS49967.1|4479217_4479418_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS49968.1|4479425_4479935_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS49969.1|4479967_4480210_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS49970.1|4480326_4480959_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS49971.1|4480962_4481988_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS49972.1|4482094_4482448_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS49973.1|4483064_4483352_+	hypothetical protein	NA	NA	NA	NA	NA
AYS49974.1|4483362_4484253_+	methyltransferase	NA	NA	NA	NA	NA
AYS49975.1|4484252_4484999_+	hypothetical protein	NA	NA	NA	NA	NA
AYS49976.1|4485300_4487271_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS49977.1|4487290_4488595_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS49978.1|4488617_4489313_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS49979.1|4489338_4490133_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS49980.1|4490142_4491210_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS49981.1|4491254_4492991_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS49982.1|4492990_4495486_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS49983.1|4495509_4496556_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS49984.1|4496558_4497836_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS49985.1|4498080_4498620_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS49986.1|4499473_4500985_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS49987.1|4500968_4502558_+	hypothetical protein	NA	NA	NA	NA	NA
AYS49988.1|4502721_4503735_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4503912:4503928	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS49989.1|4504161_4504455_+	hypothetical protein	NA	NA	NA	NA	NA
AYS49990.1|4504451_4504940_+	hypothetical protein	NA	NA	NA	NA	NA
AYS49991.1|4505119_4505572_-	hypothetical protein	NA	NA	NA	NA	NA
AYS49992.1|4510794_4511256_+	hypothetical protein	NA	NA	NA	NA	NA
AYS49993.1|4511252_4511474_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS49994.1|4512330_4513113_+	hypothetical protein	NA	NA	NA	NA	NA
AYS49995.1|4513739_4513964_-	hypothetical protein	NA	NA	NA	NA	NA
AYS49996.1|4514093_4515005_-	hypothetical protein	NA	NA	NA	NA	NA
AYS49997.1|4515315_4516575_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4516734:4516750	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 11
CP029878	Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 chromosome, complete genome	4782665	4658827	4669086	4782665	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYS50134.1|4658827_4659904_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS50135.1|4659900_4660974_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS50136.1|4660948_4662112_-	hypothetical protein	NA	NA	NA	NA	NA
AYS50137.1|4662387_4662954_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS50138.1|4662969_4663209_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS50139.1|4663212_4664073_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS50140.1|4664495_4664819_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS50141.1|4664802_4665303_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYS50142.1|4665299_4665527_+	hypothetical protein	NA	NA	NA	NA	NA
AYS50143.1|4665523_4665844_+	P4 phage protein	NA	NA	NA	NA	NA
AYS50144.1|4665858_4666533_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYS50145.1|4666529_4668191_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYS50146.1|4668927_4669086_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029877	Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence	217083	3612	57130	217083	holin,transposase	Escherichia_phage(43.75%)	56	NA	NA
AYS45803.1|3612_3888_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS45804.1|3806_4310_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	6.3e-94
AYS45805.1|4636_4861_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45806.1|5516_5777_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45807.1|5865_6357_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45808.1|6361_6670_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45809.1|6877_7258_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45810.1|7343_7592_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45811.1|7629_7851_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYS45812.1|8013_8397_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45813.1|8711_8936_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45814.1|9022_9487_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45815.1|9669_12099_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45816.1|12221_12668_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45817.1|12715_13522_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45818.1|13749_13992_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45819.1|14069_14402_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45820.1|14901_16083_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45821.1|16091_16388_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYS45822.1|16451_16919_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45823.1|17778_18555_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45824.1|18704_19481_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45825.1|19669_20011_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45826.1|20111_20375_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYS45827.1|20608_21307_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYS45828.1|21461_21758_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45829.1|21845_24230_-	periplasmic protein	NA	NA	NA	NA	NA
AYS45830.1|24480_25089_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45831.1|25201_25498_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45832.1|25502_26099_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45833.1|26490_27372_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYS45834.1|27957_28473_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45835.1|29123_31580_-	periplasmic protein	NA	NA	NA	NA	NA
AYS45836.1|32216_33971_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYS45837.1|34156_35314_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYS45838.1|35673_36498_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYS45839.1|36512_37334_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45840.1|37616_38324_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45841.1|38538_39615_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYS45842.1|40149_41025_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYS45843.1|41278_41860_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45844.1|42466_42820_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45845.1|42871_43189_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45846.1|43188_43986_+	pilus assembly protein	NA	NA	NA	NA	NA
AYS45847.1|43988_45221_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45848.1|45222_45663_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45849.1|45640_47011_+	TrhB	NA	NA	NA	NA	NA
AYS45850.1|47019_47532_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45851.1|47532_48390_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYS45852.1|48399_49350_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45853.1|49358_52040_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45854.1|52673_52949_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYS45855.1|53077_55081_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYS45856.1|55143_56439_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45857.1|56432_56936_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS45858.1|56854_57130_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 2
CP029877	Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence	217083	82223	134584	217083	transposase,integrase	Escherichia_phage(50.0%)	63	107127:107141	131627:131641
AYS45878.1|82223_82727_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS45879.1|82645_82921_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS45880.1|82962_84819_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYS45881.1|85216_86092_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45882.1|86150_86528_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45883.1|86588_87575_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45884.1|87634_88687_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45885.1|88725_88995_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45886.1|89065_90193_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45887.1|90270_92283_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45888.1|92354_92576_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45889.1|92690_93923_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYS45890.1|94197_94722_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45891.1|94712_95678_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45892.1|95748_96684_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45893.1|96761_97682_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45894.1|97754_98690_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45895.1|98866_99823_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45896.1|100235_100505_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45897.1|100559_101150_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45898.1|101157_101415_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45899.1|101488_102025_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45900.1|102041_102497_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45901.1|102480_102708_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45902.1|102756_103011_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45903.1|103078_104038_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45904.1|104048_104957_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45905.1|105261_106443_-	recombinase	NA	NA	NA	NA	NA
AYS45906.1|106657_106870_+	regulatory protein	NA	NA	NA	NA	NA
107127:107141	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYS45907.1|107176_107452_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	7.7e-46
107127:107141	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYS45908.1|107370_107874_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS45909.1|107980_108415_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYS45910.1|108432_108837_+	MerT	NA	NA	NA	NA	NA
AYS45911.1|108850_109126_+	mercuric transport protein	NA	NA	NA	NA	NA
AYS45912.1|109161_109584_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYS45913.1|109635_111330_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYS45914.1|111347_111710_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYS45915.1|111706_111943_+	mercury resistance protein	NA	NA	NA	NA	NA
AYS45916.1|111939_112647_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45917.1|112685_113990_+|integrase	integrase	integrase	NA	NA	NA	NA
AYS45918.1|114018_114741_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS45919.1|115496_116348_+	replication protein	NA	NA	NA	NA	NA
AYS45920.1|116655_117471_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYS45921.1|117531_118335_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS45922.1|118334_119171_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS45923.1|119231_119954_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS45924.1|120533_121394_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
120988:121002	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYS45925.1|121576_121843_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
120988:121002	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYS45926.1|121875_122598_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS45927.1|122831_123758_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYS45928.1|123664_124045_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYS45929.1|124241_124841_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYS45930.1|124872_125886_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYS45931.1|125875_126439_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYS45932.1|126564_127125_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYS45933.1|127127_130094_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYS45934.1|130160_130538_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45935.1|130738_131398_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYS45936.1|131676_131952_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS45937.1|131870_132374_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS45938.1|132955_133711_+	replication protein	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
AYS45939.1|133886_134162_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS45940.1|134080_134584_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	92.8	1.4e-88
