The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029880	Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 chromosome, complete genome	4783762	930485	937797	4783762	protease,integrase	Dickeya_phage(16.67%)	6	931736:931750	942915:942929
AYS42381.1|930485_931604_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS42382.1|931600_933547_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931736:931750	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS42383.1|933676_933898_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS42384.1|934221_934542_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS42385.1|934572_936849_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS42386.1|937419_937797_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942915:942929	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029880	Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 chromosome, complete genome	4783762	1008935	1086247	4783762	protease,terminase,integrase,tail,transposase	Salmonella_phage(73.33%)	93	991001:991020	1061608:1061627
991001:991020	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS42436.1|1008935_1010276_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS42437.1|1010272_1010521_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS42438.1|1010561_1010807_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS42439.1|1010806_1011688_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS42440.1|1011684_1012749_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS42441.1|1012826_1013507_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS42442.1|1013503_1014289_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS42443.1|1014294_1014591_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS42444.1|1014681_1014882_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS42445.1|1015170_1015575_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS42446.1|1015906_1016281_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS42447.1|1016365_1017349_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS42448.1|1017351_1018101_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS42449.1|1018111_1018459_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYS42450.1|1018455_1018980_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS42451.1|1018979_1019453_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS42452.1|1019456_1020029_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS42453.1|1020122_1020389_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS42454.1|1020470_1020632_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS42455.1|1021064_1021562_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS42456.1|1021746_1021986_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS42457.1|1021975_1022281_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS42458.1|1022320_1022923_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS42459.1|1023131_1023743_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS42460.1|1023875_1024673_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS42461.1|1025071_1025197_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS42462.1|1025332_1025782_-	lipoprotein	NA	NA	NA	NA	NA
AYS42463.1|1025998_1026388_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS42464.1|1026374_1026656_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS42465.1|1026655_1027270_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS42466.1|1027488_1027743_+	hypothetical protein	NA	NA	NA	NA	NA
AYS42467.1|1027847_1028225_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS42468.1|1028288_1028549_+	hypothetical protein	NA	NA	NA	NA	NA
AYS42469.1|1028638_1029391_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS42470.1|1029356_1030760_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS42471.1|1030759_1032229_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS42472.1|1032320_1032851_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS42473.1|1032865_1034098_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS42474.1|1034102_1034600_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS42475.1|1034611_1035553_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS42476.1|1035594_1035963_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS42477.1|1035928_1036336_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS42478.1|1036332_1036887_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS42479.1|1036873_1037263_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS42480.1|1037237_1037801_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS42481.1|1037804_1038950_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS42482.1|1038961_1039402_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS42483.1|1039405_1039858_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS42484.1|1040035_1041988_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS42485.1|1041987_1042638_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS42486.1|1042641_1042944_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS42487.1|1042946_1043978_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS42488.1|1043974_1044310_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS42489.1|1044504_1045236_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS42490.1|1045235_1045664_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS42491.1|1045722_1046478_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS42492.1|1046565_1046703_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS42493.1|1046718_1047072_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS42494.1|1047072_1048272_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS42495.1|1048268_1048949_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS42496.1|1048948_1050460_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS42497.1|1050474_1050993_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS42498.1|1051914_1052616_-	hypothetical protein	NA	NA	NA	NA	NA
AYS42499.1|1052928_1053207_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS42500.1|1053632_1056245_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS42501.1|1056452_1057463_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS42502.1|1057625_1058171_+	hypothetical protein	NA	NA	NA	NA	NA
AYS42503.1|1058167_1059277_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS42504.1|1059375_1061484_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS42505.1|1061496_1063404_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061608:1061627	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS42506.1|1063418_1064672_+	inner membrane protein	NA	NA	NA	NA	NA
AYS42507.1|1064676_1066317_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS42508.1|1066313_1066877_+	lipoprotein	NA	NA	NA	NA	NA
AYS42509.1|1067130_1067298_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS42510.1|1067397_1067916_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS42511.1|1067984_1069745_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS42512.1|1069930_1070383_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS42513.1|1070454_1071507_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS42514.1|1071861_1072371_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS42515.1|1072587_1073193_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS42516.1|1073179_1075333_-	inner membrane protein	NA	NA	NA	NA	NA
AYS42517.1|1075351_1075798_-	hypothetical protein	NA	NA	NA	NA	NA
AYS42518.1|1075921_1077976_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS42519.1|1078011_1078470_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS42520.1|1078564_1079227_-	hypothetical protein	NA	NA	NA	NA	NA
AYS42521.1|1079397_1079814_+	hypothetical protein	NA	NA	NA	NA	NA
AYS42522.1|1079858_1080176_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS42523.1|1080233_1081445_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS42524.1|1082576_1083035_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS42525.1|1083771_1084053_+	acylphosphatase	NA	NA	NA	NA	NA
AYS42526.1|1084049_1084379_-	sulfite reductase	NA	NA	NA	NA	NA
AYS42527.1|1084465_1085125_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS42528.1|1085788_1086247_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029880	Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 chromosome, complete genome	4783762	1530403	1573076	4783762	head,protease,plate,tail,transposase	Burkholderia_virus(45.71%)	55	NA	NA
AYS42930.1|1530403_1530862_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS42931.1|1531364_1531646_+	stress response protein	NA	NA	NA	NA	NA
AYS42932.1|1531914_1532736_+|protease	serine protease	protease	NA	NA	NA	NA
AYS42933.1|1532770_1533100_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS42934.1|1533086_1533449_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS42935.1|1533560_1533731_-	hypothetical protein	NA	NA	NA	NA	NA
AYS42936.1|1533865_1534900_+	hypothetical protein	NA	NA	NA	NA	NA
AYS42937.1|1535074_1536463_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS42938.1|1536473_1538003_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS42939.1|1538529_1539474_+	hypothetical protein	NA	NA	NA	NA	NA
AYS42940.1|1539655_1540045_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS42941.1|1540016_1540469_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS42942.1|1540663_1540894_-	hypothetical protein	NA	NA	NA	NA	NA
AYS42943.1|1540890_1541574_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS42944.1|1541570_1541786_-	hypothetical protein	NA	NA	NA	NA	NA
AYS42945.1|1541778_1542162_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYS42946.1|1542158_1542461_-	hypothetical protein	NA	NA	NA	NA	NA
AYS42947.1|1542470_1542743_-	hypothetical protein	NA	NA	NA	NA	NA
AYS42948.1|1543031_1543562_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS42949.1|1543589_1543859_-	hypothetical protein	NA	NA	NA	NA	NA
AYS42950.1|1543861_1545028_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS42951.1|1545038_1546808_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS42952.1|1546985_1547417_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYS42953.1|1547412_1548009_+	hypothetical protein	NA	NA	NA	NA	NA
AYS42954.1|1548252_1548603_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS42955.1|1549317_1549968_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS42956.1|1549964_1550291_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYS42957.1|1550290_1550602_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS42958.1|1550601_1551147_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS42959.1|1551143_1552739_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS42960.1|1552738_1554235_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS42961.1|1554215_1555037_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS42962.1|1555039_1555498_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS42963.1|1555712_1556828_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS42964.1|1556842_1557796_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS42965.1|1557805_1558144_+	hypothetical protein	NA	NA	NA	NA	NA
AYS42966.1|1558145_1558592_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS42967.1|1558591_1559056_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS42968.1|1559052_1559307_+	hypothetical protein	NA	NA	NA	NA	NA
AYS42969.1|1559296_1560724_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS42970.1|1560723_1561245_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS42971.1|1561247_1561529_+	hypothetical protein	NA	NA	NA	NA	NA
AYS42972.1|1561626_1561962_+	hypothetical protein	NA	NA	NA	NA	NA
AYS42973.1|1562137_1564603_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS42974.1|1564602_1565487_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS42975.1|1565483_1565699_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS42976.1|1565686_1566841_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS42977.1|1566837_1567365_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS42978.1|1567421_1567769_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS42979.1|1567759_1568863_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS42980.1|1568855_1569434_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS42981.1|1569433_1570144_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	68.9	2.6e-37
AYS42982.1|1570403_1571021_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS42983.1|1571514_1571907_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	51.1	6.8e-19
AYS42984.1|1572503_1573076_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
>prophage 4
CP029880	Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 chromosome, complete genome	4783762	1784438	1788850	4783762		Escherichia_phage(50.0%)	6	NA	NA
AYS43194.1|1784438_1784678_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYS43195.1|1785550_1786360_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS43196.1|1786432_1786810_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS43197.1|1786957_1787500_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS43198.1|1787691_1788420_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS43199.1|1788436_1788850_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029880	Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 chromosome, complete genome	4783762	2106238	2116745	4783762		Enterobacteria_phage(37.5%)	10	NA	NA
AYS43492.1|2106238_2107552_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS43493.1|2107578_2108658_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS43494.1|2108662_2109436_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS43495.1|2109451_2110426_-	reductase RfbI	NA	NA	NA	NA	NA
AYS43496.1|2110431_2110983_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS43497.1|2110983_2111862_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS43498.1|2111909_2112809_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS43499.1|2112808_2113894_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS43500.1|2114270_2115164_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS43501.1|2115341_2116745_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 6
CP029880	Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 chromosome, complete genome	4783762	2193974	2203145	4783762	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS43561.1|2193974_2196008_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS43562.1|2196248_2196707_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS43563.1|2196878_2197409_+	lipoprotein	NA	NA	NA	NA	NA
AYS43564.1|2197465_2197933_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS43565.1|2197979_2198699_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS43566.1|2198695_2200381_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS43567.1|2200603_2201335_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS43568.1|2201394_2201502_+	hypothetical protein	NA	NA	NA	NA	NA
AYS43569.1|2201482_2202214_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS43570.1|2202197_2203145_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 7
CP029880	Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 chromosome, complete genome	4783762	2738590	2751982	4783762	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS43999.1|2738590_2738809_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS44000.1|2738899_2740000_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS44001.1|2739996_2740482_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS44002.1|2740478_2743556_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS44003.1|2743548_2743668_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS44004.1|2743682_2743985_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS44005.1|2744039_2744555_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS44006.1|2744564_2745737_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS44007.1|2745879_2746452_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS44008.1|2747129_2748245_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS44009.1|2748325_2751982_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 8
CP029880	Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 chromosome, complete genome	4783762	3069143	3112845	4783762	protease,tRNA,transposase,bacteriocin	Bacillus_virus(33.33%)	44	NA	NA
AYS44297.1|3069143_3069602_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS44298.1|3069791_3070871_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS44299.1|3070972_3072136_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS44300.1|3072157_3073204_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS44301.1|3073577_3074003_+	hypothetical protein	NA	NA	NA	NA	NA
AYS44302.1|3074028_3074607_+	hypothetical protein	NA	NA	NA	NA	NA
AYS44303.1|3074640_3075315_+	hypothetical protein	NA	NA	NA	NA	NA
AYS44304.1|3075296_3075980_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS44305.1|3075973_3076630_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS44306.1|3076734_3077193_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS44307.1|3077381_3079373_-	transketolase	NA	NA	NA	NA	NA
AYS44308.1|3079648_3080407_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS44309.1|3080507_3081428_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS44310.1|3081655_3083632_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS44311.1|3083640_3083772_-	hypothetical protein	NA	NA	NA	NA	NA
AYS44312.1|3084066_3084366_-	membrane protein	NA	NA	NA	NA	NA
AYS44313.1|3084421_3085576_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS44314.1|3086068_3087463_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS44315.1|3087541_3088039_+	hypothetical protein	NA	NA	NA	NA	NA
AYS44316.1|3088134_3088842_+	endonuclease I	NA	NA	NA	NA	NA
AYS44317.1|3088918_3089650_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS44318.1|3089669_3090617_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS44319.1|3090832_3091396_+	hypothetical protein	NA	NA	NA	NA	NA
AYS44320.1|3091395_3091812_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS44321.1|3091858_3092545_-	global regulatory protein	NA	NA	NA	NA	NA
AYS44322.1|3092674_3093655_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS44323.1|3093672_3094377_+	hypothetical protein	NA	NA	NA	NA	NA
AYS44324.1|3094395_3094962_+	hypothetical protein	NA	NA	NA	NA	NA
AYS44325.1|3094958_3095249_+	hypothetical protein	NA	NA	NA	NA	NA
AYS44326.1|3095256_3095850_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS44327.1|3095842_3096979_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS44328.1|3097069_3098077_-	hypothetical protein	NA	NA	NA	NA	NA
AYS44329.1|3098209_3099256_-	L-asparaginase	NA	NA	NA	NA	NA
AYS44330.1|3099574_3100033_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS44331.1|3100154_3100874_-	hypothetical protein	NA	NA	NA	NA	NA
AYS44332.1|3100923_3101250_-	hypothetical protein	NA	NA	NA	NA	NA
AYS44333.1|3101249_3101969_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS44334.1|3102123_3103176_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS44335.1|3103203_3103479_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS44336.1|3103591_3104677_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS44337.1|3104893_3106150_+	nucleoside permease	NA	NA	NA	NA	NA
AYS44338.1|3108760_3109468_+	hypothetical protein	NA	NA	NA	NA	NA
AYS44339.1|3112057_3112324_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS44340.1|3112566_3112845_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 9
CP029880	Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 chromosome, complete genome	4783762	3489832	3527890	4783762	portal,capsid,plate,terminase,integrase,tail,transposase	Salmonella_phage(82.05%)	46	3484796:3484810	3496962:3496976
3484796:3484810	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS44668.1|3489832_3491479_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS44669.1|3491618_3491717_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS44670.1|3491972_3492302_+	hypothetical protein	NA	NA	NA	NA	NA
AYS44671.1|3492342_3493395_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS44672.1|3493790_3494360_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS44673.1|3494485_3494707_+	hypothetical protein	NA	NA	NA	NA	NA
AYS44674.1|3494739_3495249_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS44675.1|3495423_3495648_+	hypothetical protein	NA	NA	NA	NA	NA
AYS44676.1|3495670_3496012_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS44677.1|3496079_3496313_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS44678.1|3496312_3496540_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS44679.1|3496536_3497394_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3496962:3496976	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS44680.1|3497390_3499805_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS44681.1|3499958_3500147_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS44682.1|3502114_3503029_+	hypothetical protein	NA	NA	NA	NA	NA
AYS44683.1|3503025_3503766_+	hypothetical protein	NA	NA	NA	NA	NA
AYS44684.1|3503800_3504838_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS44685.1|3504837_3506604_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS44686.1|3506746_3507580_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS44687.1|3507596_3508655_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS44688.1|3508658_3509309_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS44689.1|3509341_3509869_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS44690.1|3509868_3510072_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS44691.1|3510075_3510291_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS44692.1|3510310_3510784_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS44693.1|3510785_3511163_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS44694.1|3511159_3511588_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS44695.1|3511683_3512115_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS44696.1|3512107_3512554_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS44697.1|3512622_3513201_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS44698.1|3513197_3513557_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS44699.1|3513543_3514452_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS44700.1|3514444_3515050_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS44701.1|3515046_3516561_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYS44702.1|3516560_3517154_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS44703.1|3517125_3517566_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS44704.1|3517988_3518561_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS44705.1|3518703_3519876_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS44706.1|3519885_3520401_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS44707.1|3520455_3520758_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS44708.1|3520772_3520892_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS44709.1|3520884_3523962_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS44710.1|3523958_3524444_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS44711.1|3524440_3525541_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS44712.1|3525631_3525850_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS44713.1|3527431_3527890_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 10
CP029880	Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 chromosome, complete genome	4783762	4443415	4517672	4783762	portal,capsid,plate,terminase,integrase,tail	Salmonella_phage(82.98%)	76	4504916:4504932	4517831:4517847
AYS45484.1|4443415_4445365_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS45485.1|4445436_4446345_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45486.1|4446418_4447318_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45487.1|4447359_4447719_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45488.1|4447818_4448088_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45489.1|4448219_4449494_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS45490.1|4449713_4450091_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45491.1|4450177_4450396_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS45492.1|4450463_4451564_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS45493.1|4451560_4452046_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS45494.1|4452045_4454826_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS45495.1|4454818_4454938_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS45496.1|4454952_4455255_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS45497.1|4455309_4455825_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS45498.1|4455834_4457007_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS45499.1|4457541_4458264_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS45500.1|4458461_4458869_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS45501.1|4458875_4460495_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS45502.1|4460491_4461097_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS45503.1|4461089_4461998_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYS45504.1|4461984_4462344_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS45505.1|4462340_4462919_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS45506.1|4462987_4463434_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS45507.1|4463426_4463858_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYS45508.1|4463953_4464379_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS45509.1|4464378_4464756_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS45510.1|4464760_4465231_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS45511.1|4465250_4465466_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS45512.1|4465469_4465673_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS45513.1|4465672_4466137_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS45514.1|4466230_4466881_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS45515.1|4466884_4467949_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS45516.1|4467965_4468799_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS45517.1|4468941_4470708_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS45518.1|4470704_4471751_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS45519.1|4471799_4472495_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45520.1|4472514_4473579_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45521.1|4473575_4474640_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45522.1|4475564_4475894_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYS45523.1|4475890_4477960_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYS45524.1|4477950_4478811_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS45525.1|4478807_4479392_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS45526.1|4479388_4479616_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS45527.1|4479615_4479849_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS45528.1|4479916_4480258_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS45529.1|4480221_4480422_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS45530.1|4480429_4480939_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS45531.1|4480971_4481214_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS45532.1|4481330_4481963_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS45533.1|4481966_4482992_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS45534.1|4483098_4483452_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS45535.1|4484068_4484356_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45536.1|4484366_4485257_+	methyltransferase	NA	NA	NA	NA	NA
AYS45537.1|4485256_4486003_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45538.1|4486304_4488275_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS45539.1|4488294_4489599_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS45540.1|4489621_4490317_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS45541.1|4490342_4491137_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS45542.1|4491146_4492214_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS45543.1|4492258_4493995_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS45544.1|4493994_4496490_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS45545.1|4496513_4497560_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS45546.1|4497562_4498840_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS45547.1|4499084_4499624_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS45548.1|4500477_4501989_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS45549.1|4501972_4503562_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45550.1|4503725_4504739_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4504916:4504932	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS45551.1|4505165_4505459_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45552.1|4505455_4505944_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45553.1|4506123_4506576_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45554.1|4511798_4512260_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45555.1|4512256_4512478_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS45556.1|4513334_4514117_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45557.1|4514743_4514968_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45558.1|4515097_4516102_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYS45559.1|4516412_4517672_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4517831:4517847	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 11
CP029880	Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 chromosome, complete genome	4783762	4659924	4670183	4783762	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYS45696.1|4659924_4661001_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS45697.1|4660997_4662071_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS45698.1|4662045_4663209_-	hypothetical protein	NA	NA	NA	NA	NA
AYS45699.1|4663484_4664051_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS45700.1|4664066_4664306_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS45701.1|4664309_4665170_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS45702.1|4665592_4665916_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS45703.1|4665899_4666400_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYS45704.1|4666396_4666624_+	hypothetical protein	NA	NA	NA	NA	NA
AYS45705.1|4666620_4666941_+	P4 phage protein	NA	NA	NA	NA	NA
AYS45706.1|4666955_4667630_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYS45707.1|4667626_4669288_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYS45708.1|4670024_4670183_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029879	Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence	214596	3612	57130	214596	transposase,holin	Escherichia_phage(43.75%)	56	NA	NA
AYS41368.1|3612_3888_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS41369.1|3806_4310_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	6.3e-94
AYS41370.1|4636_4861_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41371.1|5516_5777_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41372.1|5865_6357_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41373.1|6361_6670_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41374.1|6877_7258_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41375.1|7343_7592_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41376.1|7629_7851_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYS41377.1|8013_8397_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41378.1|8711_8936_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41379.1|9022_9487_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41380.1|9669_12099_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41381.1|12221_12668_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41382.1|12715_13522_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41383.1|13749_13992_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41384.1|14069_14402_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41385.1|14901_16083_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41386.1|16091_16388_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYS41387.1|16451_16919_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41388.1|17778_18555_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41389.1|18704_19481_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41390.1|19669_20011_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41391.1|20111_20375_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYS41392.1|20608_21307_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYS41393.1|21461_21758_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41394.1|21845_24230_-	periplasmic protein	NA	NA	NA	NA	NA
AYS41395.1|24480_25089_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41396.1|25201_25498_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41397.1|25502_26099_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41398.1|26490_27372_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYS41399.1|27957_28473_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41400.1|29123_31580_-	periplasmic protein	NA	NA	NA	NA	NA
AYS41401.1|32216_33971_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYS41402.1|34156_35314_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYS41403.1|35673_36498_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYS41404.1|36512_37334_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41405.1|37616_38324_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41406.1|38538_39615_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYS41407.1|40149_41025_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYS41408.1|41278_41860_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41409.1|42466_42820_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41410.1|42871_43189_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41411.1|43188_43986_+	pilus assembly protein	NA	NA	NA	NA	NA
AYS41412.1|43988_45221_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41413.1|45222_45663_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41414.1|45640_47011_+	TrhB	NA	NA	NA	NA	NA
AYS41415.1|47019_47532_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41416.1|47532_48390_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYS41417.1|48399_49350_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41418.1|49358_52040_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41419.1|52673_52949_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYS41420.1|53077_55081_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYS41421.1|55143_56439_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41422.1|56432_56936_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS41423.1|56854_57130_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 2
CP029879	Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence	214596	81906	173269	214596	transposase,integrase	Escherichia_phage(32.14%)	100	107680:107709	129814:129843
AYS41443.1|81906_82410_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS41444.1|82328_82604_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS41445.1|82645_84502_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYS41446.1|84899_85775_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41447.1|85833_86211_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41448.1|86271_87258_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41449.1|87317_88370_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41450.1|88408_88678_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41451.1|88748_89876_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41452.1|89953_91966_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41453.1|92037_92259_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41454.1|92373_93606_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYS41455.1|93880_94405_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41456.1|94395_95361_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41457.1|95431_96367_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41458.1|96444_97365_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41459.1|97437_98373_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41460.1|98549_99506_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41461.1|99918_100188_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41462.1|100242_100833_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41463.1|100840_101098_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41464.1|101171_101708_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41465.1|101724_102180_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41466.1|102163_102391_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41467.1|102439_102694_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41468.1|102761_103721_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41469.1|103731_104640_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41470.1|104944_106126_-	recombinase	NA	NA	NA	NA	NA
AYS41471.1|106340_106553_+	regulatory protein	NA	NA	NA	NA	NA
AYS41472.1|107094_107598_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
107680:107709	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
AYS41473.1|107704_108139_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYS41474.1|108156_108561_+	MerT	NA	NA	NA	NA	NA
AYS41475.1|108574_108850_+	mercuric transport protein	NA	NA	NA	NA	NA
AYS41476.1|108885_109308_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYS41477.1|109359_111054_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYS41478.1|111071_111434_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYS41479.1|111430_111667_+	mercury resistance protein	NA	NA	NA	NA	NA
AYS41480.1|111663_112371_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41481.1|112409_113714_+|integrase	integrase	integrase	NA	NA	NA	NA
AYS41482.1|113742_114465_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS41483.1|115220_116072_+	replication protein	NA	NA	NA	NA	NA
AYS41484.1|116379_117195_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYS41485.1|117255_118059_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS41486.1|118058_118895_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS41487.1|118955_119678_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS41488.1|120257_121118_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AYS41489.1|121300_121567_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
AYS41490.1|121599_122322_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS41491.1|122555_123482_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYS41492.1|123388_123769_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYS41493.1|123965_124565_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYS41494.1|124596_125610_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYS41495.1|125599_126163_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYS41496.1|126288_126849_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYS41497.1|126851_129818_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYS41498.1|129884_130262_+	hypothetical protein	NA	NA	NA	NA	NA
129814:129843	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
AYS41499.1|130462_131122_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYS41500.1|131400_131676_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS41501.1|131594_132098_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	92.8	1.4e-88
AYS41502.1|132506_133580_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41503.1|133836_134343_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41504.1|134346_134607_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41505.1|134992_135385_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41506.1|135363_135783_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41507.1|136611_138411_+	allophanate hydrolase	NA	NA	NA	NA	NA
AYS41508.1|138403_142018_+	urea carboxylase	NA	NA	NA	NA	NA
AYS41509.1|142027_142729_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYS41510.1|142794_144066_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYS41511.1|144159_145734_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYS41512.1|145730_146810_+	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
AYS41513.1|146802_147594_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	2.3e-18
AYS41514.1|147596_148295_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	4.4e-13
AYS41515.1|148807_149362_+	hypothetical protein	NA	G0X580	Salmonella_phage	37.9	9.3e-14
AYS41516.1|149467_149887_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41517.1|150188_150644_+	hypothetical protein	NA	A0A1S6KZY3	Salmonella_phage	34.3	4.9e-05
AYS41518.1|151410_151815_-	DNA-binding protein	NA	NA	NA	NA	NA
AYS41519.1|152076_152349_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41520.1|152345_153014_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41521.1|153521_153977_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41522.1|153983_154334_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41523.1|154336_155557_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41524.1|155611_155851_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41525.1|155828_157148_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41526.1|157471_158899_-	DNA cytosine methylase	NA	E5E3X6	Burkholderia_phage	55.6	2.8e-102
AYS41527.1|159121_159637_+	nuclease	NA	V5UN65	Mycobacterium_phage	28.3	1.2e-07
AYS41528.1|159633_160566_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41529.1|160747_161956_+|transposase	IS4 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	8.8e-235
AYS41530.1|161965_162091_-	transcriptional regulator	NA	NA	NA	NA	NA
AYS41531.1|162165_162270_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41532.1|162321_163527_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41533.1|163970_164291_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41534.1|164280_164670_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41535.1|164677_165364_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41536.1|165341_165968_-	tetracycline repressor protein TetR	NA	NA	NA	NA	NA
AYS41537.1|165998_167252_+	Tetracycline resistance protein, class E	NA	NA	NA	NA	NA
AYS41538.1|167364_167958_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41539.1|168045_168462_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41540.1|168471_169680_-	hypothetical protein	NA	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AYS41541.1|170764_171811_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41542.1|171862_173269_-|transposase	transposase	transposase	NA	NA	NA	NA
