The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029846	Salmonella enterica subsp. enterica serovar Typhi strain 343078_273110 chromosome, complete genome	4801146	930140	937452	4801146	protease,integrase	Dickeya_phage(16.67%)	6	931391:931405	942570:942584
AYU50056.1|930140_931259_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYU50057.1|931255_933202_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931391:931405	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYU50058.1|933331_933553_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYU50059.1|933876_934197_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYU50060.1|934227_936504_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYU50061.1|937074_937452_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942570:942584	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029846	Salmonella enterica subsp. enterica serovar Typhi strain 343078_273110 chromosome, complete genome	4801146	1008542	1085854	4801146	tail,terminase,integrase,transposase,protease	Salmonella_phage(73.33%)	93	990608:990627	1061215:1061234
990608:990627	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYU50111.1|1008542_1009883_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYU50112.1|1009879_1010128_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYU50113.1|1010168_1010414_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYU50114.1|1010413_1011295_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYU50115.1|1011291_1012356_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYU50116.1|1012433_1013114_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYU50117.1|1013110_1013896_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYU50118.1|1013901_1014198_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYU50119.1|1014288_1014489_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYU50120.1|1014777_1015182_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYU50121.1|1015513_1015888_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYU50122.1|1015972_1016956_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYU50123.1|1016958_1017708_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYU50124.1|1017718_1018066_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYU50125.1|1018062_1018587_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYU50126.1|1018586_1019060_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYU50127.1|1019063_1019636_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYU50128.1|1019729_1019996_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYU50129.1|1020077_1020239_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU50130.1|1020671_1021169_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU50131.1|1021353_1021593_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYU50132.1|1021582_1021888_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYU50133.1|1021927_1022530_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYU50134.1|1022738_1023350_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYU50135.1|1023482_1024280_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYU50136.1|1024678_1024804_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU50137.1|1024939_1025389_-	lipoprotein	NA	NA	NA	NA	NA
AYU50138.1|1025605_1025995_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYU50139.1|1025981_1026263_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYU50140.1|1026262_1026877_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYU50141.1|1027095_1027350_+	hypothetical protein	NA	NA	NA	NA	NA
AYU50142.1|1027454_1027832_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYU50143.1|1027895_1028156_+	hypothetical protein	NA	NA	NA	NA	NA
AYU50144.1|1028245_1028998_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYU50145.1|1028963_1030367_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYU50146.1|1030366_1031836_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYU50147.1|1031927_1032458_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYU50148.1|1032472_1033705_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYU50149.1|1033709_1034207_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYU50150.1|1034218_1035160_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYU50151.1|1035201_1035570_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYU50152.1|1035535_1035943_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYU50153.1|1035939_1036494_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYU50154.1|1036480_1036870_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYU50155.1|1036844_1037408_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYU50156.1|1037411_1038557_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYU50157.1|1038568_1039009_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYU50158.1|1039012_1039465_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYU50159.1|1039642_1041595_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYU50160.1|1041594_1042245_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYU50161.1|1042248_1042551_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYU50162.1|1042553_1043585_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYU50163.1|1043581_1043917_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYU50164.1|1044111_1044843_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU50165.1|1044842_1045271_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU50166.1|1045329_1046085_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYU50167.1|1046172_1046310_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYU50168.1|1046325_1046679_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYU50169.1|1046679_1047879_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYU50170.1|1047875_1048556_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYU50171.1|1048555_1050067_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYU50172.1|1050081_1050600_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYU50173.1|1051521_1052223_-	hypothetical protein	NA	NA	NA	NA	NA
AYU50174.1|1052535_1052814_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYU50175.1|1053239_1055852_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYU50176.1|1056059_1057070_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYU50177.1|1057232_1057778_+	hypothetical protein	NA	NA	NA	NA	NA
AYU50178.1|1057774_1058884_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYU50179.1|1058982_1061091_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYU50180.1|1061103_1063011_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061215:1061234	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYU50181.1|1063025_1064279_+	inner membrane protein	NA	NA	NA	NA	NA
AYU50182.1|1064283_1065924_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYU50183.1|1065920_1066484_+	lipoprotein	NA	NA	NA	NA	NA
AYU50184.1|1066737_1066905_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYU50185.1|1067004_1067523_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYU50186.1|1067591_1069352_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYU50187.1|1069537_1069990_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYU50188.1|1070061_1071114_-	outer membrane protein A	NA	NA	NA	NA	NA
AYU50189.1|1071468_1071978_-	cell division inhibitor	NA	NA	NA	NA	NA
AYU50190.1|1072194_1072800_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYU50191.1|1072786_1074940_-	inner membrane protein	NA	NA	NA	NA	NA
AYU50192.1|1074958_1075405_-	hypothetical protein	NA	NA	NA	NA	NA
AYU50193.1|1075528_1077583_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYU50194.1|1077618_1078077_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYU50195.1|1078171_1078834_-	hypothetical protein	NA	NA	NA	NA	NA
AYU50196.1|1079004_1079421_+	hypothetical protein	NA	NA	NA	NA	NA
AYU50197.1|1079465_1079783_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYU50198.1|1079840_1081052_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYU50199.1|1082183_1082642_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU50200.1|1083378_1083660_+	acylphosphatase	NA	NA	NA	NA	NA
AYU50201.1|1083656_1083986_-	sulfite reductase	NA	NA	NA	NA	NA
AYU50202.1|1084072_1084732_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYU50203.1|1085395_1085854_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029846	Salmonella enterica subsp. enterica serovar Typhi strain 343078_273110 chromosome, complete genome	4801146	1528672	1602270	4801146	tRNA,plate,tail,transposase,head,protease	Burkholderia_virus(44.12%)	72	NA	NA
AYU50603.1|1528672_1529131_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU50604.1|1529633_1529915_+	stress response protein	NA	NA	NA	NA	NA
AYU50605.1|1530183_1531005_+|protease	serine protease	protease	NA	NA	NA	NA
AYU50606.1|1531039_1531369_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYU50607.1|1531355_1531718_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYU50608.1|1531829_1532000_-	hypothetical protein	NA	NA	NA	NA	NA
AYU50609.1|1532134_1533169_+	hypothetical protein	NA	NA	NA	NA	NA
AYU50610.1|1533343_1534732_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYU50611.1|1534742_1536272_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYU50612.1|1536798_1537743_+	hypothetical protein	NA	NA	NA	NA	NA
AYU50613.1|1537924_1538314_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYU50614.1|1538285_1538738_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYU50615.1|1538932_1539163_-	hypothetical protein	NA	NA	NA	NA	NA
AYU50616.1|1539159_1539843_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYU50617.1|1540427_1540730_-	hypothetical protein	NA	NA	NA	NA	NA
AYU50618.1|1541300_1541831_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYU50619.1|1542130_1543297_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYU50620.1|1543307_1545077_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYU50621.1|1546521_1546872_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYU50622.1|1547586_1548237_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYU50623.1|1548559_1548871_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYU50624.1|1548870_1549416_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYU50625.1|1549412_1551008_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYU50626.1|1551007_1552504_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYU50627.1|1552484_1553306_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYU50628.1|1553308_1553767_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYU50629.1|1553981_1555097_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYU50630.1|1555111_1556065_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYU50631.1|1556074_1556413_+	hypothetical protein	NA	NA	NA	NA	NA
AYU50632.1|1556414_1556861_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYU50633.1|1556860_1557325_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYU50634.1|1557565_1558993_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYU50635.1|1558992_1559514_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYU50636.1|1559516_1559798_+	hypothetical protein	NA	NA	NA	NA	NA
AYU50637.1|1559895_1560231_+	hypothetical protein	NA	NA	NA	NA	NA
AYU50638.1|1560406_1562872_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYU50639.1|1562871_1563756_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYU50640.1|1563752_1563968_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYU50641.1|1563955_1565110_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYU50642.1|1565106_1565634_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYU50643.1|1565690_1566038_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYU50644.1|1566028_1567132_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYU50645.1|1567124_1567703_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYU50646.1|1567705_1568731_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	52.9	6.2e-64
AYU50647.1|1569244_1569862_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYU50648.1|1571372_1571945_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYU50649.1|1572225_1573608_+	amino acid permease	NA	NA	NA	NA	NA
AYU50650.1|1573669_1574005_-	hypothetical protein	NA	NA	NA	NA	NA
AYU50651.1|1574131_1574863_+	two-component response regulator	NA	NA	NA	NA	NA
AYU50652.1|1575343_1576495_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYU50653.1|1576647_1578354_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYU50654.1|1578461_1579766_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYU50655.1|1579841_1580771_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYU50656.1|1580767_1582171_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYU50657.1|1582338_1583985_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYU50658.1|1584184_1585360_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYU50659.1|1585462_1586971_+	hypothetical protein	NA	NA	NA	NA	NA
AYU50660.1|1587676_1588678_+	adenosine deaminase	NA	NA	NA	NA	NA
AYU50661.1|1588751_1589867_-	oxidoreductase	NA	NA	NA	NA	NA
AYU50662.1|1589969_1590125_+	hypothetical protein	NA	NA	NA	NA	NA
AYU50663.1|1590423_1590639_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYU50664.1|1590727_1591168_+	hypothetical protein	NA	NA	NA	NA	NA
AYU50665.1|1591244_1591826_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYU50666.1|1591825_1592404_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYU50667.1|1592396_1594418_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYU50668.1|1594418_1595477_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYU50669.1|1595480_1596101_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYU50670.1|1596103_1596796_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYU50671.1|1596795_1597431_+	endonuclease III	NA	NA	NA	NA	NA
AYU50672.1|1598031_1599537_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYU50673.1|1599641_1600247_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYU50674.1|1600995_1602270_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029846	Salmonella enterica subsp. enterica serovar Typhi strain 343078_273110 chromosome, complete genome	4801146	1783307	1787719	4801146		Escherichia_phage(50.0%)	6	NA	NA
AYU50858.1|1783307_1783547_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYU50859.1|1784419_1785229_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYU50860.1|1785301_1785679_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYU50861.1|1785826_1786369_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYU50862.1|1786560_1787289_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYU50863.1|1787305_1787719_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029846	Salmonella enterica subsp. enterica serovar Typhi strain 343078_273110 chromosome, complete genome	4801146	1991572	1998806	4801146		Morganella_phage(33.33%)	7	NA	NA
AYU51053.1|1991572_1993003_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYU51054.1|1993076_1993772_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYU51055.1|1993851_1994163_-	hypothetical protein	NA	NA	NA	NA	NA
AYU51056.1|1994813_1995998_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYU51057.1|1996457_1996670_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYU51058.1|1997115_1998384_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYU51059.1|1998386_1998806_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029846	Salmonella enterica subsp. enterica serovar Typhi strain 343078_273110 chromosome, complete genome	4801146	2105106	2115613	4801146		Enterobacteria_phage(37.5%)	10	NA	NA
AYU51156.1|2105106_2106420_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYU51157.1|2106446_2107526_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYU51158.1|2107530_2108304_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYU51159.1|2108319_2109294_-	reductase RfbI	NA	NA	NA	NA	NA
AYU51160.1|2109299_2109851_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYU51161.1|2109851_2110730_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYU51162.1|2110777_2111677_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYU51163.1|2111676_2112762_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYU51164.1|2113138_2114032_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYU51165.1|2114209_2115613_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029846	Salmonella enterica subsp. enterica serovar Typhi strain 343078_273110 chromosome, complete genome	4801146	2191504	2200675	4801146	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYU51224.1|2191504_2193538_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYU51225.1|2193778_2194237_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYU51226.1|2194408_2194939_+	lipoprotein	NA	NA	NA	NA	NA
AYU51227.1|2194995_2195463_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYU51228.1|2195509_2196229_-	two-component system response regulator	NA	NA	NA	NA	NA
AYU51229.1|2196225_2197911_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYU51230.1|2198133_2198865_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYU51231.1|2198924_2199032_+	hypothetical protein	NA	NA	NA	NA	NA
AYU51232.1|2199012_2199744_-	ABC transporter permease	NA	NA	NA	NA	NA
AYU51233.1|2199727_2200675_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029846	Salmonella enterica subsp. enterica serovar Typhi strain 343078_273110 chromosome, complete genome	4801146	2736120	2749512	4801146	tail	Salmonella_phage(70.0%)	11	NA	NA
AYU51662.1|2736120_2736339_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYU51663.1|2736429_2737530_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYU51664.1|2737526_2738012_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYU51665.1|2738008_2741086_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYU51666.1|2741078_2741198_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYU51667.1|2741212_2741515_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYU51668.1|2741569_2742085_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYU51669.1|2742094_2743267_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYU51670.1|2743409_2743982_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYU51671.1|2744659_2745775_+	glycosyltransferase	NA	NA	NA	NA	NA
AYU51672.1|2745855_2749512_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029846	Salmonella enterica subsp. enterica serovar Typhi strain 343078_273110 chromosome, complete genome	4801146	3066467	3110170	4801146	tRNA,protease,transposase,bacteriocin	Bacillus_virus(33.33%)	44	NA	NA
AYU51959.1|3066467_3066926_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU51960.1|3067115_3068195_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYU51961.1|3068296_3069460_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYU51962.1|3069481_3070528_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYU51963.1|3070901_3071327_+	hypothetical protein	NA	NA	NA	NA	NA
AYU51964.1|3071352_3071931_+	hypothetical protein	NA	NA	NA	NA	NA
AYU51965.1|3071964_3072639_+	hypothetical protein	NA	NA	NA	NA	NA
AYU51966.1|3072620_3073304_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYU51967.1|3073297_3073954_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYU51968.1|3074058_3074517_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU51969.1|3074705_3076697_-	transketolase	NA	NA	NA	NA	NA
AYU51970.1|3076972_3077731_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYU51971.1|3077831_3078752_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYU51972.1|3078979_3080956_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYU51973.1|3080964_3081096_-	hypothetical protein	NA	NA	NA	NA	NA
AYU51974.1|3081390_3081690_-	membrane protein	NA	NA	NA	NA	NA
AYU51975.1|3081745_3082900_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYU51976.1|3083392_3084787_+	galactose-proton symport	NA	NA	NA	NA	NA
AYU51977.1|3084865_3085363_+	hypothetical protein	NA	NA	NA	NA	NA
AYU51978.1|3085458_3086166_+	endonuclease I	NA	NA	NA	NA	NA
AYU51979.1|3086242_3086974_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYU51980.1|3086993_3087941_+	glutathione synthetase	NA	NA	NA	NA	NA
AYU51981.1|3088156_3088720_+	hypothetical protein	NA	NA	NA	NA	NA
AYU51982.1|3088719_3089136_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYU51983.1|3089182_3089869_-	global regulatory protein	NA	NA	NA	NA	NA
AYU51984.1|3089998_3090979_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYU51985.1|3090996_3091701_+	hypothetical protein	NA	NA	NA	NA	NA
AYU51986.1|3091719_3092286_+	hypothetical protein	NA	NA	NA	NA	NA
AYU51987.1|3092282_3092573_+	hypothetical protein	NA	NA	NA	NA	NA
AYU51988.1|3092580_3093174_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYU51989.1|3093166_3094303_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYU51990.1|3094393_3095401_-	hypothetical protein	NA	NA	NA	NA	NA
AYU51991.1|3095533_3096580_-	L-asparaginase	NA	NA	NA	NA	NA
AYU51992.1|3096898_3097357_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU51993.1|3097479_3098199_-	hypothetical protein	NA	NA	NA	NA	NA
AYU51994.1|3098248_3098575_-	hypothetical protein	NA	NA	NA	NA	NA
AYU51995.1|3098574_3099294_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYU51996.1|3099448_3100501_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYU51997.1|3100528_3100804_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYU51998.1|3100916_3102002_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYU51999.1|3102218_3103475_+	nucleoside permease	NA	NA	NA	NA	NA
AYU52000.1|3106085_3106793_+	hypothetical protein	NA	NA	NA	NA	NA
AYU52001.1|3109382_3109649_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYU52002.1|3109891_3110170_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029846	Salmonella enterica subsp. enterica serovar Typhi strain 343078_273110 chromosome, complete genome	4801146	3439332	3463400	4801146	integrase,transposase	Salmonella_phage(27.27%)	29	3446079:3446138	3464928:3465695
AYU52288.1|3439332_3440235_-|integrase	integrase/recombinase	integrase	A0A142F1N9	Bacillus_phage	30.6	1.6e-26
AYU52289.1|3440231_3440939_-	hypothetical protein	NA	NA	NA	NA	NA
AYU52290.1|3440935_3441760_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
AYU52291.1|3441796_3442000_-	lipoprotein	NA	NA	NA	NA	NA
AYU52292.1|3442185_3444195_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	97.0	2.3e-118
AYU52293.1|3444209_3444563_+	hypothetical protein	NA	NA	NA	NA	NA
AYU52294.1|3444632_3444953_+	CyaY protein	NA	NA	NA	NA	NA
AYU52295.1|3445024_3445387_-	hypothetical protein	NA	NA	NA	NA	NA
AYU52296.1|3445398_3445941_-	hypothetical protein	NA	NA	NA	NA	NA
3446079:3446138	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
AYU52297.1|3446937_3447372_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYU52298.1|3447389_3447794_+	MerT	NA	NA	NA	NA	NA
AYU52299.1|3447807_3448083_+	mercuric transport protein	NA	NA	NA	NA	NA
AYU52300.1|3448118_3448541_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYU52301.1|3448592_3450287_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYU52302.1|3450304_3450667_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYU52303.1|3450663_3450900_+	mercury resistance protein	NA	NA	NA	NA	NA
AYU52304.1|3450896_3451604_+	hypothetical protein	NA	NA	NA	NA	NA
AYU52305.1|3451642_3452947_+|integrase	integrase	integrase	NA	NA	NA	NA
AYU52306.1|3452975_3453698_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYU52307.1|3453839_3454700_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AYU52308.1|3454882_3455149_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
AYU52309.1|3455181_3455904_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYU52310.1|3456137_3457064_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	NA	NA	NA	NA
AYU52311.1|3456970_3457351_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYU52312.1|3457547_3458147_-	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	31.4	3.1e-15
AYU52313.1|3458178_3459192_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYU52314.1|3459181_3459745_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYU52315.1|3459870_3460431_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYU52316.1|3460433_3463400_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
3464928:3465695	attR	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACCGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTCCGCCATTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGATACGTCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGGCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACTATGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCGCTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACC	NA	NA	NA	NA
>prophage 11
CP029846	Salmonella enterica subsp. enterica serovar Typhi strain 343078_273110 chromosome, complete genome	4801146	3507114	3598882	4801146	tRNA,plate,portal,tail,terminase,integrase,transposase,capsid	Salmonella_phage(66.67%)	83	3495976:3495991	3574987:3575002
3495976:3495991	attL	CGGTGACGAATTCGAC	NA	NA	NA	NA
AYU52353.1|3507114_3508761_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYU52354.1|3508900_3508999_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYU52355.1|3509254_3509584_+	hypothetical protein	NA	NA	NA	NA	NA
AYU52356.1|3509624_3510677_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYU52357.1|3511072_3511642_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYU52358.1|3511767_3511989_+	hypothetical protein	NA	NA	NA	NA	NA
AYU52359.1|3512021_3512531_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYU52360.1|3512705_3512930_+	hypothetical protein	NA	NA	NA	NA	NA
AYU52361.1|3512952_3513294_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYU52362.1|3513361_3513595_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYU52363.1|3513594_3513822_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYU52364.1|3513818_3514676_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
AYU52365.1|3514672_3517087_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYU52366.1|3517240_3517429_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYU52367.1|3519396_3520311_+	hypothetical protein	NA	NA	NA	NA	NA
AYU52368.1|3520307_3521048_+	hypothetical protein	NA	NA	NA	NA	NA
AYU52369.1|3521082_3522120_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYU52370.1|3522119_3523886_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYU52371.1|3524028_3524862_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.3	3.4e-121
AYU52372.1|3524878_3525937_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYU52373.1|3525940_3526591_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYU52374.1|3526623_3527151_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYU52375.1|3527150_3527354_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYU52376.1|3527357_3527573_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYU52377.1|3527592_3528066_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYU52378.1|3528067_3528445_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYU52379.1|3528441_3528870_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYU52380.1|3528965_3529397_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYU52381.1|3529389_3529836_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYU52382.1|3529904_3530483_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYU52383.1|3530479_3530839_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYU52384.1|3530825_3531734_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYU52385.1|3531726_3532332_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYU52386.1|3532328_3533843_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYU52387.1|3533842_3534436_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYU52388.1|3534407_3534848_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYU52389.1|3535270_3535843_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYU52390.1|3535985_3537158_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYU52391.1|3537167_3537683_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYU52392.1|3537737_3538040_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYU52393.1|3538054_3538174_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYU52394.1|3538166_3541244_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYU52395.1|3541240_3541726_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYU52396.1|3541722_3542823_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYU52397.1|3542913_3543132_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYU52398.1|3544713_3545172_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU52399.1|3545279_3545618_-	hypothetical protein	NA	NA	NA	NA	NA
AYU52400.1|3545736_3546573_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYU52401.1|3552795_3554385_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	8.4e-68
AYU52402.1|3554400_3555690_+	phosphoribosylglycineamide synthetase	NA	NA	NA	NA	NA
AYU52403.1|3555686_3557012_-	transcriptional regulator	NA	NA	NA	NA	NA
AYU52404.1|3557017_3558415_-	two-component system sensor protein	NA	NA	NA	NA	NA
AYU52405.1|3558668_3559124_+	zinc resistance protein	NA	NA	NA	NA	NA
AYU52406.1|3559165_3559858_-	hypothetical protein	NA	NA	NA	NA	NA
AYU52407.1|3559869_3560142_-	histone like DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
AYU52408.1|3560328_3560919_-	hypothetical protein	NA	NA	NA	NA	NA
AYU52409.1|3560960_3561632_-	endonuclease	NA	A0A1V0SJW5	Klosneuvirus	28.7	2.1e-20
AYU52410.1|3561641_3562706_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
AYU52411.1|3562746_3563520_-	NADH pyrophosphatase	NA	NA	NA	NA	NA
AYU52412.1|3563612_3564101_+	regulatory protein	NA	NA	NA	NA	NA
AYU52413.1|3564464_3566360_+	thiamine biosynthesis protein ThiC	NA	NA	NA	NA	NA
AYU52414.1|3566359_3566995_+	thiamine-phosphate pyrophosphorylase	NA	NA	NA	NA	NA
AYU52415.1|3566987_3567746_+	thiamine biosynthesis protein ThiF	NA	A0A1V0SAV8	Catovirus	28.5	7.0e-12
AYU52416.1|3567753_3567927_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AYU52417.1|3567928_3568699_+	thiamine biosynthesis protein ThiG	NA	NA	NA	NA	NA
AYU52418.1|3568695_3569829_+	thiamine biosynthesis protein ThiH	NA	NA	NA	NA	NA
AYU52419.1|3569909_3570167_-	hypothetical protein	NA	NA	NA	NA	NA
AYU52420.1|3570928_3571207_-	hypothetical protein	NA	NA	NA	NA	NA
AYU52421.1|3571293_3575517_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.1	5.0e-67
3574987:3575002	attR	GTCGAATTCGTCACCG	NA	NA	NA	NA
AYU52422.1|3575593_3579622_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
AYU52423.1|3579939_3580305_-	50S ribosomal subunit protein L7/L12	NA	NA	NA	NA	NA
AYU52424.1|3580371_3580869_-	50S ribosomal subunit protein L10	NA	NA	NA	NA	NA
AYU52425.1|3581284_3581989_-	50S ribosomal subunit protein L1	NA	NA	NA	NA	NA
AYU52426.1|3581992_3582421_-	50S ribosomal subunit protein L11	NA	NA	NA	NA	NA
AYU52427.1|3582578_3583124_-	transcription antitermination protein	NA	NA	NA	NA	NA
AYU52428.1|3583125_3583509_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
AYU52429.1|3583738_3584923_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
AYU52430.1|3585881_3586832_+	pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.5	7.9e-29
AYU52431.1|3586866_3587829_-	bifunctional biotin operon repressor/biotin-[acetyl-CoA carboxylase] synthetase	NA	NA	NA	NA	NA
AYU52432.1|3587825_3588854_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AYU52433.1|3594767_3595550_-	glutamate racemase	NA	NA	NA	NA	NA
AYU52434.1|3595563_3597408_-	vitamin B12 receptor protein	NA	A0A0P0I887	Acinetobacter_phage	30.0	2.2e-11
AYU52435.1|3597781_3598882_+|tRNA	tRNA (uracil-5)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 12
CP029846	Salmonella enterica subsp. enterica serovar Typhi strain 343078_273110 chromosome, complete genome	4801146	4460865	4535032	4801146	plate,portal,tail,terminase,integrase,capsid	Salmonella_phage(82.98%)	76	4522369:4522385	4535191:4535207
AYU53171.1|4460865_4462815_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYU53172.1|4462886_4463795_+	hypothetical protein	NA	NA	NA	NA	NA
AYU53173.1|4463868_4464768_+	hypothetical protein	NA	NA	NA	NA	NA
AYU53174.1|4464809_4465169_+	hypothetical protein	NA	NA	NA	NA	NA
AYU53175.1|4465268_4465538_-	hypothetical protein	NA	NA	NA	NA	NA
AYU53176.1|4465669_4466944_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYU53177.1|4467163_4467541_+	hypothetical protein	NA	NA	NA	NA	NA
AYU53178.1|4467627_4467846_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYU53179.1|4467913_4469014_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYU53180.1|4469010_4469496_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYU53181.1|4469495_4472276_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYU53182.1|4472268_4472388_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYU53183.1|4472402_4472705_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYU53184.1|4472759_4473275_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYU53185.1|4473284_4474457_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYU53186.1|4474991_4475714_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYU53187.1|4475911_4476319_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYU53188.1|4476325_4477945_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYU53189.1|4477941_4478547_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYU53190.1|4478539_4479448_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYU53191.1|4479434_4479794_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYU53192.1|4479790_4480369_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYU53193.1|4480437_4480884_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYU53194.1|4480876_4481308_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYU53195.1|4481403_4481829_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYU53196.1|4481828_4482206_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYU53197.1|4482210_4482681_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYU53198.1|4482700_4482916_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYU53199.1|4482919_4483123_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYU53200.1|4483122_4483587_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYU53201.1|4483680_4484331_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYU53202.1|4484334_4485399_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYU53203.1|4485415_4486249_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYU53204.1|4486391_4488158_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYU53205.1|4488154_4489201_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYU53206.1|4489249_4489945_-	hypothetical protein	NA	NA	NA	NA	NA
AYU53207.1|4489964_4491029_-	hypothetical protein	NA	NA	NA	NA	NA
AYU53208.1|4491025_4492090_-	hypothetical protein	NA	NA	NA	NA	NA
AYU53209.1|4493014_4493344_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYU53210.1|4493340_4495410_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYU53211.1|4495400_4496261_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYU53212.1|4496257_4496842_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYU53213.1|4496838_4497066_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYU53214.1|4497065_4497299_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYU53215.1|4497366_4497708_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYU53216.1|4497671_4497872_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYU53217.1|4497879_4498389_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYU53218.1|4498421_4498664_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYU53219.1|4498780_4499413_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYU53220.1|4499416_4500442_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYU53221.1|4500548_4500902_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYU53222.1|4501518_4501806_+	hypothetical protein	NA	NA	NA	NA	NA
AYU53223.1|4501816_4502707_+	methyltransferase	NA	NA	NA	NA	NA
AYU53224.1|4502706_4503453_+	hypothetical protein	NA	NA	NA	NA	NA
AYU53225.1|4503754_4505728_-	Vi polysaccharide export protein VexE	NA	NA	NA	NA	NA
AYU53226.1|4505747_4507052_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYU53227.1|4507074_4507770_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYU53228.1|4507795_4508590_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYU53229.1|4508599_4509667_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYU53230.1|4509711_4511448_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYU53231.1|4511447_4513943_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYU53232.1|4513966_4515013_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYU53233.1|4515015_4516293_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYU53234.1|4516537_4517077_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYU53235.1|4517930_4519442_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYU53236.1|4519425_4521015_+	hypothetical protein	NA	NA	NA	NA	NA
AYU53237.1|4521178_4522192_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4522369:4522385	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYU53238.1|4522618_4522912_+	hypothetical protein	NA	NA	NA	NA	NA
AYU53239.1|4522908_4523397_+	hypothetical protein	NA	NA	NA	NA	NA
AYU53240.1|4523576_4524029_-	hypothetical protein	NA	NA	NA	NA	NA
AYU53241.1|4529251_4529713_+	hypothetical protein	NA	NA	NA	NA	NA
AYU53242.1|4529709_4529931_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYU53243.1|4530787_4531570_+	hypothetical protein	NA	NA	NA	NA	NA
AYU53244.1|4532196_4532421_-	hypothetical protein	NA	NA	NA	NA	NA
AYU53245.1|4532550_4533462_-	hypothetical protein	NA	NA	NA	NA	NA
AYU53246.1|4533772_4535032_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4535191:4535207	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 13
CP029846	Salmonella enterica subsp. enterica serovar Typhi strain 343078_273110 chromosome, complete genome	4801146	4677284	4687543	4801146	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYU53383.1|4677284_4678361_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYU53384.1|4678357_4679431_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYU53385.1|4679405_4680569_-	hypothetical protein	NA	NA	NA	NA	NA
AYU53386.1|4680844_4681411_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYU53387.1|4681426_4681666_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYU53388.1|4681669_4682530_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYU53389.1|4682952_4683276_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYU53390.1|4683259_4683760_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYU53391.1|4683756_4683984_+	hypothetical protein	NA	NA	NA	NA	NA
AYU53392.1|4683980_4684301_+	P4 phage protein	NA	NA	NA	NA	NA
AYU53393.1|4684315_4684990_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYU53394.1|4684986_4686648_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYU53395.1|4687384_4687543_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029847	Salmonella enterica subsp. enterica serovar Typhi strain 343078_273110 plasmid pHCM2, complete sequence	106705	284	10622	106705		Salmonella_phage(100.0%)	7	NA	NA
AYU53486.1|284_1313_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
AYU53487.1|1432_1864_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
AYU53488.1|2109_2700_+	hypothetical protein	NA	NA	NA	NA	NA
AYU53489.1|2793_3237_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.0e-71
AYU53490.1|3233_6752_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
AYU53491.1|6932_8168_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
AYU53492.1|8264_10622_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	90.7	0.0e+00
>prophage 2
CP029847	Salmonella enterica subsp. enterica serovar Typhi strain 343078_273110 plasmid pHCM2, complete sequence	106705	19112	106692	106705	tail	Salmonella_phage(95.19%)	106	NA	NA
AYU53505.1|19112_19418_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
AYU53506.1|19414_19567_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
AYU53507.1|19566_19773_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
AYU53508.1|19938_21261_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
AYU53509.1|21295_21553_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
AYU53510.1|21853_22648_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
AYU53511.1|22831_23884_+	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
AYU53512.1|23885_25097_-	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
AYU53513.1|25159_26500_-	putative DNA helicase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
AYU53514.1|26560_27286_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
AYU53515.1|27563_28619_+	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
AYU53516.1|28688_29444_-	hypothetical protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
AYU53517.1|29492_29852_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AYU53518.1|29851_30517_-	hypothetical protein	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
AYU53519.1|30847_31399_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
AYU53520.1|31449_31794_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.6	5.9e-27
AYU53521.1|31862_32582_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	1.5e-125
AYU53522.1|32568_32892_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
AYU53523.1|33006_35559_-	hypothetical protein	NA	A0A0A0YQM3	Citrobacter_virus	52.5	1.4e-152
AYU53524.1|35641_40030_-|tail	putative phage tail protein	tail	J9Q713	Salmonella_phage	86.7	0.0e+00
AYU53525.1|40044_40632_-|tail	putative phage tail protein	tail	J9Q7F8	Salmonella_phage	91.8	2.5e-102
AYU53526.1|40619_41417_-	hypothetical protein	NA	J9Q7R4	Salmonella_phage	95.8	1.2e-155
AYU53527.1|41409_42141_-|tail	putative phage tail protein	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
AYU53528.1|42197_42533_-	hypothetical protein	NA	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AYU53529.1|42574_47158_-	hypothetical protein	NA	J9Q712	Salmonella_phage	92.8	0.0e+00
AYU53530.1|47165_47435_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AYU53531.1|47515_47833_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYU53532.1|47892_48639_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
AYU53533.1|48713_49097_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AYU53534.1|49098_49572_-	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AYU53535.1|49562_49907_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AYU53536.1|50004_50838_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
AYU53537.1|50837_51272_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
AYU53538.1|51315_52239_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
AYU53539.1|52313_53189_-	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
AYU53540.1|53215_54112_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
AYU53541.1|54134_55709_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
AYU53542.1|55742_56999_-	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
AYU53543.1|57001_57643_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	99.1	1.2e-108
AYU53544.1|57838_58105_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AYU53545.1|58114_59014_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
AYU53546.1|59010_59265_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AYU53547.1|59257_59896_-	putative ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	99.1	5.5e-111
AYU53548.1|59892_60561_-	hypothetical protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
AYU53549.1|60560_61241_-	hypothetical protein	NA	J9Q756	Salmonella_phage	99.6	7.4e-122
AYU53550.1|61323_62883_+	putative helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
AYU53551.1|62885_63164_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AYU53552.1|63223_63646_+	putative lipoprotein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
AYU53553.1|63650_64178_+	putative transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
AYU53554.1|64812_65463_+	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
AYU53555.1|65547_65775_+	hypothetical protein	NA	NA	NA	NA	NA
AYU53556.1|66406_66889_-	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
AYU53557.1|67094_67382_-	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
AYU53558.1|67502_67895_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
AYU53559.1|68023_68335_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
AYU53560.1|68411_68726_-	hypothetical protein	NA	NA	NA	NA	NA
AYU53561.1|68820_69039_-	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AYU53562.1|69049_69265_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
AYU53563.1|69407_69653_+	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
AYU53564.1|71089_72280_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
AYU53565.1|72289_72607_-	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
AYU53566.1|72691_72973_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
AYU53567.1|73146_73350_+	hypothetical protein	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
AYU53568.1|73410_73698_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
AYU53569.1|73694_74003_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
AYU53570.1|74014_74557_-	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
AYU53571.1|74553_75195_-	hypothetical protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
AYU53572.1|75286_75658_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
AYU53573.1|75768_75942_-	hypothetical protein	NA	J9Q801	Salmonella_phage	98.2	9.5e-26
AYU53574.1|75938_76628_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
AYU53575.1|76686_78390_-	putative DNA modification methylase	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
AYU53576.1|78513_79086_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AYU53577.1|79194_80037_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AYU53578.1|80145_80334_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AYU53579.1|80343_80838_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
AYU53580.1|80980_81589_-	putative ribonuclease H	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AYU53581.1|82174_82405_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AYU53582.1|82607_83201_-	hypothetical protein	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
AYU53583.1|83386_84313_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.1e-107
AYU53584.1|84357_84915_-	hypothetical protein	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AYU53585.1|84924_85344_-	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
AYU53586.1|85407_86052_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AYU53587.1|86051_86528_-	hypothetical protein	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AYU53588.1|86524_86938_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AYU53589.1|86939_88055_-	putative thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
AYU53590.1|88170_89100_-	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
AYU53591.1|89182_90325_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
AYU53592.1|90432_92748_-	ribonucleotide-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AYU53593.1|92825_93395_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
AYU53594.1|93407_94154_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
AYU53595.1|94143_96060_-	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AYU53596.1|96056_96293_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AYU53597.1|96289_97375_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
AYU53598.1|97801_98107_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.0	2.0e-50
AYU53599.1|98138_98633_-	hypothetical protein	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
AYU53600.1|98708_99353_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
AYU53601.1|100097_101153_+	putative replication protein A	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
AYU53602.1|101681_101885_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
AYU53603.1|101884_102190_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
AYU53604.1|102229_102505_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
AYU53605.1|102573_102984_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
AYU53606.1|102967_103339_-	hypothetical protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
AYU53607.1|103501_104344_-	putative lipoprotein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
AYU53608.1|104639_105716_-	putative recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AYU53609.1|105718_105985_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYU53610.1|105984_106692_-	hypothetical protein	NA	J9Q7S6	Salmonella_phage	99.1	3.7e-132
