The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029852	Salmonella enterica subsp. enterica serovar Typhi strain 343078_201101 chromosome, complete genome	4782235	930415	937727	4782235	protease,integrase	Dickeya_phage(16.67%)	6	931666:931680	942845:942859
AYU19921.1|930415_931534_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYU19922.1|931530_933477_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931666:931680	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYU19923.1|933606_933828_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYU19924.1|934151_934472_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYU19925.1|934502_936779_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYU19926.1|937349_937727_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942845:942859	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029852	Salmonella enterica subsp. enterica serovar Typhi strain 343078_201101 chromosome, complete genome	4782235	1008865	1086177	4782235	tail,transposase,integrase,protease,terminase	Salmonella_phage(73.33%)	93	990931:990950	1061538:1061557
990931:990950	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYU19976.1|1008865_1010206_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYU19977.1|1010202_1010451_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYU19978.1|1010491_1010737_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYU19979.1|1010736_1011618_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYU19980.1|1011614_1012679_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYU19981.1|1012756_1013437_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYU19982.1|1013433_1014219_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYU19983.1|1014224_1014521_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYU19984.1|1014611_1014812_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYU19985.1|1015100_1015505_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYU19986.1|1015836_1016211_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYU19987.1|1016295_1017279_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYU19988.1|1017281_1018031_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYU19989.1|1018041_1018389_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYU19990.1|1018385_1018910_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYU19991.1|1018909_1019383_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYU19992.1|1019386_1019959_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYU19993.1|1020052_1020319_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYU19994.1|1020400_1020562_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU19995.1|1020994_1021492_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU19996.1|1021676_1021916_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYU19997.1|1021905_1022211_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYU19998.1|1022250_1022853_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYU19999.1|1023061_1023673_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYU20000.1|1023805_1024603_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYU20001.1|1025001_1025127_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU20002.1|1025262_1025712_-	lipoprotein	NA	NA	NA	NA	NA
AYU20003.1|1025928_1026318_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYU20004.1|1026304_1026586_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYU20005.1|1026585_1027200_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYU20006.1|1027418_1027673_+	hypothetical protein	NA	NA	NA	NA	NA
AYU20007.1|1027777_1028155_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYU20008.1|1028218_1028479_+	hypothetical protein	NA	NA	NA	NA	NA
AYU20009.1|1028568_1029321_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYU20010.1|1029286_1030690_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYU20011.1|1030689_1032159_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYU20012.1|1032250_1032781_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYU20013.1|1032795_1034028_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYU20014.1|1034032_1034530_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYU20015.1|1034541_1035483_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYU20016.1|1035524_1035893_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYU20017.1|1035858_1036266_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYU20018.1|1036262_1036817_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYU20019.1|1036803_1037193_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYU20020.1|1037167_1037731_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYU20021.1|1037734_1038880_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYU20022.1|1038891_1039332_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYU20023.1|1039335_1039788_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYU20024.1|1039965_1041918_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYU20025.1|1041917_1042568_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYU20026.1|1042571_1042874_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYU20027.1|1042876_1043908_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYU20028.1|1043904_1044240_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYU20029.1|1044434_1045166_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU20030.1|1045165_1045594_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU20031.1|1045652_1046408_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYU20032.1|1046495_1046633_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYU20033.1|1046648_1047002_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYU20034.1|1047002_1048202_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYU20035.1|1048198_1048879_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYU20036.1|1048878_1050390_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYU20037.1|1050404_1050923_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYU20038.1|1051844_1052546_-	hypothetical protein	NA	NA	NA	NA	NA
AYU20039.1|1052858_1053137_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYU20040.1|1053562_1056175_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYU20041.1|1056382_1057393_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYU20042.1|1057555_1058101_+	hypothetical protein	NA	NA	NA	NA	NA
AYU20043.1|1058097_1059207_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYU20044.1|1059305_1061414_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYU20045.1|1061426_1063334_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061538:1061557	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYU20046.1|1063348_1064602_+	inner membrane protein	NA	NA	NA	NA	NA
AYU20047.1|1064606_1066247_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYU20048.1|1066243_1066807_+	lipoprotein	NA	NA	NA	NA	NA
AYU20049.1|1067060_1067228_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYU20050.1|1067327_1067846_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYU20051.1|1067914_1069675_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYU20052.1|1069860_1070313_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYU20053.1|1070384_1071437_-	outer membrane protein A	NA	NA	NA	NA	NA
AYU20054.1|1071791_1072301_-	cell division inhibitor	NA	NA	NA	NA	NA
AYU20055.1|1072517_1073123_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYU20056.1|1073109_1075263_-	inner membrane protein	NA	NA	NA	NA	NA
AYU20057.1|1075281_1075728_-	hypothetical protein	NA	NA	NA	NA	NA
AYU20058.1|1075851_1077906_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYU20059.1|1077941_1078400_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYU20060.1|1078494_1079157_-	hypothetical protein	NA	NA	NA	NA	NA
AYU20061.1|1079327_1079744_+	hypothetical protein	NA	NA	NA	NA	NA
AYU20062.1|1079788_1080106_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYU20063.1|1080163_1081375_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYU20064.1|1082506_1082965_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU20065.1|1083701_1083983_+	acylphosphatase	NA	NA	NA	NA	NA
AYU20066.1|1083979_1084309_-	sulfite reductase	NA	NA	NA	NA	NA
AYU20067.1|1084395_1085055_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYU20068.1|1085718_1086177_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029852	Salmonella enterica subsp. enterica serovar Typhi strain 343078_201101 chromosome, complete genome	4782235	1528995	1602565	4782235	head,tail,transposase,tRNA,protease,plate	Burkholderia_virus(42.11%)	81	NA	NA
AYU20467.1|1528995_1529454_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU20468.1|1529956_1530238_+	stress response protein	NA	NA	NA	NA	NA
AYU20469.1|1530506_1531328_+|protease	serine protease	protease	NA	NA	NA	NA
AYU20470.1|1531362_1531692_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYU20471.1|1531678_1532041_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYU20472.1|1532152_1532323_-	hypothetical protein	NA	NA	NA	NA	NA
AYU20473.1|1532457_1533492_+	hypothetical protein	NA	NA	NA	NA	NA
AYU20474.1|1533666_1535055_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYU20475.1|1535065_1536595_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYU20476.1|1537121_1538066_+	hypothetical protein	NA	NA	NA	NA	NA
AYU20477.1|1538247_1538637_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYU20478.1|1538608_1539061_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYU20479.1|1539255_1539486_-	hypothetical protein	NA	NA	NA	NA	NA
AYU20480.1|1539482_1540166_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYU20481.1|1540162_1540378_-	hypothetical protein	NA	NA	NA	NA	NA
AYU20482.1|1540370_1540754_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYU20483.1|1540750_1541053_-	hypothetical protein	NA	NA	NA	NA	NA
AYU20484.1|1541062_1541335_-	hypothetical protein	NA	NA	NA	NA	NA
AYU20485.1|1541623_1542154_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYU20486.1|1542181_1542451_-	hypothetical protein	NA	NA	NA	NA	NA
AYU20487.1|1542453_1543620_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYU20488.1|1543630_1545400_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYU20489.1|1545577_1546009_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYU20490.1|1546004_1546601_+	hypothetical protein	NA	NA	NA	NA	NA
AYU20491.1|1546844_1547195_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYU20492.1|1547909_1548560_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYU20493.1|1548556_1548883_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYU20494.1|1548882_1549194_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYU20495.1|1549193_1549739_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYU20496.1|1549735_1551331_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYU20497.1|1551330_1552827_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYU20498.1|1552807_1553629_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYU20499.1|1553631_1554090_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYU20500.1|1554304_1555420_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYU20501.1|1555434_1556388_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYU20502.1|1556397_1556736_+	hypothetical protein	NA	NA	NA	NA	NA
AYU20503.1|1556737_1557184_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYU20504.1|1557183_1557648_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYU20505.1|1557644_1557899_+	hypothetical protein	NA	NA	NA	NA	NA
AYU20506.1|1557888_1559316_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYU20507.1|1559315_1559837_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYU20508.1|1559839_1560121_+	hypothetical protein	NA	NA	NA	NA	NA
AYU20509.1|1560218_1560554_+	hypothetical protein	NA	NA	NA	NA	NA
AYU20510.1|1560729_1563195_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYU20511.1|1563194_1564079_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYU20512.1|1564075_1564291_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYU20513.1|1564278_1565433_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYU20514.1|1565429_1565957_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYU20515.1|1566013_1566361_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYU20516.1|1566351_1567455_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYU20517.1|1567447_1568026_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYU20518.1|1568028_1569054_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYU20519.1|1569567_1570185_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYU20520.1|1570678_1571071_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	51.1	6.8e-19
AYU20521.1|1571667_1572240_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYU20522.1|1572520_1573903_+	amino acid permease	NA	NA	NA	NA	NA
AYU20523.1|1573964_1574300_-	hypothetical protein	NA	NA	NA	NA	NA
AYU20524.1|1574426_1575158_+	two-component response regulator	NA	NA	NA	NA	NA
AYU20525.1|1575638_1576790_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYU20526.1|1576942_1578649_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYU20527.1|1578756_1580061_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYU20528.1|1580136_1581066_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYU20529.1|1581062_1582466_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYU20530.1|1582633_1584280_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYU20531.1|1584479_1585655_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYU20532.1|1585757_1587266_+	hypothetical protein	NA	NA	NA	NA	NA
AYU20533.1|1587971_1588973_+	adenosine deaminase	NA	NA	NA	NA	NA
AYU20534.1|1589046_1590162_-	oxidoreductase	NA	NA	NA	NA	NA
AYU20535.1|1590264_1590420_+	hypothetical protein	NA	NA	NA	NA	NA
AYU20536.1|1590718_1590934_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYU20537.1|1591022_1591463_+	hypothetical protein	NA	NA	NA	NA	NA
AYU20538.1|1591539_1592121_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYU20539.1|1592120_1592699_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYU20540.1|1592691_1594713_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYU20541.1|1594713_1595772_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYU20542.1|1595775_1596396_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYU20543.1|1596398_1597091_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYU20544.1|1597090_1597726_+	endonuclease III	NA	NA	NA	NA	NA
AYU20545.1|1598326_1599832_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYU20546.1|1599936_1600542_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYU20547.1|1601290_1602565_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029852	Salmonella enterica subsp. enterica serovar Typhi strain 343078_201101 chromosome, complete genome	4782235	1783602	1788012	4782235		Escherichia_phage(50.0%)	6	NA	NA
AYU20731.1|1783602_1783842_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYU20732.1|1784714_1785524_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYU20733.1|1785596_1785833_+	hypothetical protein	NA	A0A2K9VHJ4	Pseudomonas_phage	45.3	1.0e-09
AYU20734.1|1786119_1786662_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYU20735.1|1786853_1787582_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYU20736.1|1787598_1788012_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029852	Salmonella enterica subsp. enterica serovar Typhi strain 343078_201101 chromosome, complete genome	4782235	1991865	1999099	4782235		Morganella_phage(33.33%)	7	NA	NA
AYU20926.1|1991865_1993296_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYU20927.1|1993369_1994065_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYU20928.1|1994144_1994456_-	hypothetical protein	NA	NA	NA	NA	NA
AYU20929.1|1995106_1996291_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYU20930.1|1996750_1996963_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYU20931.1|1997408_1998677_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYU20932.1|1998679_1999099_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029852	Salmonella enterica subsp. enterica serovar Typhi strain 343078_201101 chromosome, complete genome	4782235	2105400	2115907	4782235		Enterobacteria_phage(37.5%)	10	NA	NA
AYU21029.1|2105400_2106714_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYU21030.1|2106740_2107820_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYU21031.1|2107824_2108598_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYU21032.1|2108613_2109588_-	reductase RfbI	NA	NA	NA	NA	NA
AYU21033.1|2109593_2110145_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYU21034.1|2110145_2111024_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYU21035.1|2111071_2111971_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYU21036.1|2111970_2113056_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYU21037.1|2113432_2114326_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYU21038.1|2114503_2115907_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029852	Salmonella enterica subsp. enterica serovar Typhi strain 343078_201101 chromosome, complete genome	4782235	2191798	2200969	4782235	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYU21097.1|2191798_2193832_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYU21098.1|2194072_2194531_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYU21099.1|2194702_2195233_+	lipoprotein	NA	NA	NA	NA	NA
AYU21100.1|2195289_2195757_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYU21101.1|2195803_2196523_-	two-component system response regulator	NA	NA	NA	NA	NA
AYU21102.1|2196519_2198205_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYU21103.1|2198427_2199159_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYU21104.1|2199218_2199326_+	hypothetical protein	NA	NA	NA	NA	NA
AYU21105.1|2199306_2200038_-	ABC transporter permease	NA	NA	NA	NA	NA
AYU21106.1|2200021_2200969_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029852	Salmonella enterica subsp. enterica serovar Typhi strain 343078_201101 chromosome, complete genome	4782235	2736493	2749885	4782235	tail	Salmonella_phage(70.0%)	11	NA	NA
AYU21535.1|2736493_2736712_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYU21536.1|2736802_2737903_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYU21537.1|2737899_2738385_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYU21538.1|2738381_2741459_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYU21539.1|2741451_2741571_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYU21540.1|2741585_2741888_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYU21541.1|2741942_2742458_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYU21542.1|2742467_2743640_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYU21543.1|2743782_2744355_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYU21544.1|2745032_2746148_+	glycosyltransferase	NA	NA	NA	NA	NA
AYU21545.1|2746228_2749885_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029852	Salmonella enterica subsp. enterica serovar Typhi strain 343078_201101 chromosome, complete genome	4782235	3067241	3110944	4782235	tRNA,protease,transposase,bacteriocin	Bacillus_virus(33.33%)	44	NA	NA
AYU21832.1|3067241_3067700_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU21833.1|3067889_3068969_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYU21834.1|3069070_3070234_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYU21835.1|3070255_3071302_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYU21836.1|3071675_3072101_+	hypothetical protein	NA	NA	NA	NA	NA
AYU21837.1|3072126_3072705_+	hypothetical protein	NA	NA	NA	NA	NA
AYU21838.1|3072738_3073413_+	hypothetical protein	NA	NA	NA	NA	NA
AYU21839.1|3073394_3074078_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYU21840.1|3074071_3074728_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYU21841.1|3074832_3075291_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU21842.1|3075479_3077471_-	transketolase	NA	NA	NA	NA	NA
AYU21843.1|3077746_3078505_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYU21844.1|3078605_3079526_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYU21845.1|3079753_3081730_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYU21846.1|3081738_3081870_-	hypothetical protein	NA	NA	NA	NA	NA
AYU21847.1|3082164_3082464_-	membrane protein	NA	NA	NA	NA	NA
AYU21848.1|3082519_3083674_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYU21849.1|3084166_3085561_+	galactose-proton symport	NA	NA	NA	NA	NA
AYU21850.1|3085639_3086137_+	hypothetical protein	NA	NA	NA	NA	NA
AYU21851.1|3086232_3086940_+	endonuclease I	NA	NA	NA	NA	NA
AYU21852.1|3087016_3087748_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYU21853.1|3087767_3088715_+	glutathione synthetase	NA	NA	NA	NA	NA
AYU21854.1|3088930_3089494_+	hypothetical protein	NA	NA	NA	NA	NA
AYU21855.1|3089493_3089910_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYU21856.1|3089956_3090643_-	global regulatory protein	NA	NA	NA	NA	NA
AYU21857.1|3090772_3091753_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYU21858.1|3091770_3092475_+	hypothetical protein	NA	NA	NA	NA	NA
AYU21859.1|3092493_3093060_+	hypothetical protein	NA	NA	NA	NA	NA
AYU21860.1|3093056_3093347_+	hypothetical protein	NA	NA	NA	NA	NA
AYU21861.1|3093354_3093948_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYU21862.1|3093940_3095077_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYU21863.1|3095167_3096175_-	hypothetical protein	NA	NA	NA	NA	NA
AYU21864.1|3096307_3097354_-	L-asparaginase	NA	NA	NA	NA	NA
AYU21865.1|3097672_3098131_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU21866.1|3098253_3098973_-	hypothetical protein	NA	NA	NA	NA	NA
AYU21867.1|3099022_3099349_-	hypothetical protein	NA	NA	NA	NA	NA
AYU21868.1|3099348_3100068_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYU21869.1|3100222_3101275_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYU21870.1|3101302_3101578_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYU21871.1|3101690_3102776_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYU21872.1|3102992_3104249_+	nucleoside permease	NA	NA	NA	NA	NA
AYU21873.1|3106859_3107567_+	hypothetical protein	NA	NA	NA	NA	NA
AYU21874.1|3110156_3110423_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYU21875.1|3110665_3110944_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029852	Salmonella enterica subsp. enterica serovar Typhi strain 343078_201101 chromosome, complete genome	4782235	3488066	3526124	4782235	tail,capsid,transposase,integrase,portal,plate,terminase	Salmonella_phage(82.05%)	46	3483030:3483044	3495196:3495210
3483030:3483044	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYU22204.1|3488066_3489713_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYU22205.1|3489852_3489951_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYU22206.1|3490206_3490536_+	hypothetical protein	NA	NA	NA	NA	NA
AYU22207.1|3490576_3491629_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYU22208.1|3492024_3492594_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYU22209.1|3492719_3492941_+	hypothetical protein	NA	NA	NA	NA	NA
AYU22210.1|3492973_3493483_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYU22211.1|3493657_3493882_+	hypothetical protein	NA	NA	NA	NA	NA
AYU22212.1|3493904_3494246_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYU22213.1|3494313_3494547_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYU22214.1|3494546_3494774_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYU22215.1|3494770_3495628_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3495196:3495210	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYU22216.1|3495624_3498039_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYU22217.1|3498192_3498381_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYU22218.1|3500348_3501263_+	hypothetical protein	NA	NA	NA	NA	NA
AYU22219.1|3501259_3502000_+	hypothetical protein	NA	NA	NA	NA	NA
AYU22220.1|3502034_3503072_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYU22221.1|3503071_3504838_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYU22222.1|3504980_3505814_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYU22223.1|3505830_3506889_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYU22224.1|3506892_3507543_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYU22225.1|3507575_3508103_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYU22226.1|3508102_3508306_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYU22227.1|3508309_3508525_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYU22228.1|3508544_3509018_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYU22229.1|3509019_3509397_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYU22230.1|3509393_3509822_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYU22231.1|3509917_3510349_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYU22232.1|3510341_3510788_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYU22233.1|3510856_3511435_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYU22234.1|3511431_3511791_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYU22235.1|3511777_3512686_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYU22236.1|3512678_3513284_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYU22237.1|3513280_3514795_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYU22238.1|3514794_3515388_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYU22239.1|3515359_3515800_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYU22240.1|3516222_3516795_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYU22241.1|3516937_3518110_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYU22242.1|3518119_3518635_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYU22243.1|3518689_3518992_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYU22244.1|3519006_3519126_+	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYU22245.1|3519118_3522196_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYU22246.1|3522192_3522678_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYU22247.1|3522674_3523775_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYU22248.1|3523865_3524084_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYU22249.1|3525665_3526124_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029852	Salmonella enterica subsp. enterica serovar Typhi strain 343078_201101 chromosome, complete genome	4782235	4441981	4516145	4782235	tail,capsid,integrase,portal,plate,terminase	Salmonella_phage(82.98%)	76	4503482:4503498	4516304:4516320
AYU23020.1|4441981_4443931_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYU23021.1|4444002_4444911_+	hypothetical protein	NA	NA	NA	NA	NA
AYU23022.1|4444984_4445884_+	hypothetical protein	NA	NA	NA	NA	NA
AYU23023.1|4445925_4446285_+	hypothetical protein	NA	NA	NA	NA	NA
AYU23024.1|4446384_4446654_-	hypothetical protein	NA	NA	NA	NA	NA
AYU23025.1|4446785_4448060_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYU23026.1|4448279_4448657_+	hypothetical protein	NA	NA	NA	NA	NA
AYU23027.1|4448743_4448962_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYU23028.1|4449029_4450130_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYU23029.1|4450126_4450612_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYU23030.1|4450611_4453392_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYU23031.1|4453384_4453504_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYU23032.1|4453518_4453821_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYU23033.1|4453875_4454391_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYU23034.1|4454400_4455573_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYU23035.1|4456107_4456830_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYU23036.1|4457027_4457435_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYU23037.1|4457441_4459061_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYU23038.1|4459057_4459663_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYU23039.1|4459655_4460564_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYU23040.1|4460550_4460910_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYU23041.1|4460906_4461485_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYU23042.1|4461553_4462000_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYU23043.1|4461992_4462424_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYU23044.1|4462519_4462945_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYU23045.1|4462944_4463322_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYU23046.1|4463326_4463797_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYU23047.1|4463816_4464032_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYU23048.1|4464035_4464239_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYU23049.1|4464238_4464703_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYU23050.1|4464796_4465447_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYU23051.1|4465450_4466515_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYU23052.1|4466531_4467365_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYU23053.1|4467507_4469274_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYU23054.1|4469270_4470317_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYU23055.1|4470365_4471061_-	hypothetical protein	NA	NA	NA	NA	NA
AYU23056.1|4471080_4472145_-	hypothetical protein	NA	NA	NA	NA	NA
AYU23057.1|4472141_4473206_-	hypothetical protein	NA	NA	NA	NA	NA
AYU23058.1|4474130_4474460_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYU23059.1|4474456_4476526_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYU23060.1|4476516_4477377_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYU23061.1|4477373_4477958_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYU23062.1|4477954_4478182_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYU23063.1|4478181_4478415_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYU23064.1|4478482_4478824_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYU23065.1|4478787_4478988_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYU23066.1|4478995_4479505_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYU23067.1|4479537_4479780_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYU23068.1|4479896_4480529_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYU23069.1|4480532_4481558_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYU23070.1|4481664_4482018_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYU23071.1|4482634_4482922_+	hypothetical protein	NA	NA	NA	NA	NA
AYU23072.1|4482932_4483823_+	methyltransferase	NA	NA	NA	NA	NA
AYU23073.1|4483822_4484569_+	hypothetical protein	NA	NA	NA	NA	NA
AYU23074.1|4484870_4486841_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYU23075.1|4486860_4488165_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYU23076.1|4488187_4488883_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYU23077.1|4488908_4489703_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYU23078.1|4489712_4490780_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYU23079.1|4490824_4492561_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYU23080.1|4492560_4495056_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYU23081.1|4495079_4496126_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYU23082.1|4496128_4497406_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYU23083.1|4497650_4498190_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYU23084.1|4499043_4500555_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYU23085.1|4500538_4502128_+	hypothetical protein	NA	NA	NA	NA	NA
AYU23086.1|4502291_4503305_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4503482:4503498	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYU23087.1|4503731_4504025_+	hypothetical protein	NA	NA	NA	NA	NA
AYU23088.1|4504021_4504510_+	hypothetical protein	NA	NA	NA	NA	NA
AYU23089.1|4504689_4505142_-	hypothetical protein	NA	NA	NA	NA	NA
AYU23090.1|4510364_4510826_+	hypothetical protein	NA	NA	NA	NA	NA
AYU23091.1|4510822_4511044_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYU23092.1|4511900_4512683_+	hypothetical protein	NA	NA	NA	NA	NA
AYU23093.1|4513309_4513534_-	hypothetical protein	NA	NA	NA	NA	NA
AYU23094.1|4513663_4514575_-	hypothetical protein	NA	NA	NA	NA	NA
AYU23095.1|4514885_4516145_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4516304:4516320	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029852	Salmonella enterica subsp. enterica serovar Typhi strain 343078_201101 chromosome, complete genome	4782235	4658397	4668656	4782235	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYU23232.1|4658397_4659474_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYU23233.1|4659470_4660544_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYU23234.1|4660518_4661682_-	hypothetical protein	NA	NA	NA	NA	NA
AYU23235.1|4661957_4662524_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYU23236.1|4662539_4662779_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYU23237.1|4662782_4663643_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYU23238.1|4664065_4664389_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYU23239.1|4664372_4664873_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYU23240.1|4664869_4665097_+	hypothetical protein	NA	NA	NA	NA	NA
AYU23241.1|4665093_4665414_+	P4 phage protein	NA	NA	NA	NA	NA
AYU23242.1|4665428_4666103_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYU23243.1|4666099_4667761_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYU23244.1|4668497_4668656_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
