The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029856	Salmonella enterica subsp. enterica serovar Typhi strain 343077_286126 chromosome, complete genome	4797628	930227	937539	4797628	integrase,protease	Dickeya_phage(16.67%)	6	931478:931492	942657:942671
AYU11346.1|930227_931346_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYU11347.1|931342_933289_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931478:931492	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYU11348.1|933418_933640_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYU11349.1|933963_934284_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYU11350.1|934314_936591_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYU11351.1|937161_937539_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942657:942671	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029856	Salmonella enterica subsp. enterica serovar Typhi strain 343077_286126 chromosome, complete genome	4797628	1008491	1085802	4797628	transposase,integrase,terminase,tail,protease	Salmonella_phage(73.33%)	93	990557:990576	1061163:1061182
990557:990576	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYU11401.1|1008491_1009832_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYU11402.1|1009828_1010077_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYU11403.1|1010117_1010363_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYU11404.1|1010362_1011244_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYU11405.1|1011240_1012305_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYU11406.1|1012382_1013063_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYU11407.1|1013059_1013845_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYU11408.1|1013850_1014147_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYU11409.1|1014237_1014438_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYU11410.1|1014725_1015130_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYU11411.1|1015461_1015836_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYU11412.1|1015920_1016904_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYU11413.1|1016906_1017656_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYU11414.1|1017666_1018014_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYU11415.1|1018010_1018535_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYU11416.1|1018534_1019008_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYU11417.1|1019011_1019584_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYU11418.1|1019677_1019944_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYU11419.1|1020025_1020187_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU11420.1|1020619_1021117_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU11421.1|1021301_1021541_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYU11422.1|1021530_1021836_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYU11423.1|1021875_1022478_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYU11424.1|1022686_1023298_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYU11425.1|1023430_1024228_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYU11426.1|1024626_1024752_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU11427.1|1024887_1025337_-	lipoprotein	NA	NA	NA	NA	NA
AYU11428.1|1025553_1025943_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYU11429.1|1025929_1026211_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYU11430.1|1026210_1026825_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYU11431.1|1027043_1027298_+	hypothetical protein	NA	NA	NA	NA	NA
AYU11432.1|1027402_1027780_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYU11433.1|1027843_1028104_+	hypothetical protein	NA	NA	NA	NA	NA
AYU11434.1|1028193_1028946_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYU11435.1|1028911_1030315_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYU11436.1|1030314_1031784_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYU11437.1|1031875_1032406_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYU11438.1|1032420_1033653_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYU11439.1|1033657_1034155_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYU11440.1|1034166_1035108_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYU11441.1|1035149_1035518_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYU11442.1|1035483_1035891_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYU11443.1|1035887_1036442_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYU11444.1|1036428_1036818_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYU11445.1|1036792_1037356_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYU11446.1|1037359_1038505_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYU11447.1|1038516_1038957_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYU11448.1|1038960_1039413_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYU11449.1|1039590_1041543_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYU11450.1|1041542_1042193_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYU11451.1|1042196_1042499_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYU11452.1|1042501_1043533_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYU11453.1|1043529_1043865_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYU11454.1|1044059_1044791_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU11455.1|1044790_1045219_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU11456.1|1045277_1046033_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYU11457.1|1046120_1046258_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYU11458.1|1046273_1046627_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYU11459.1|1046627_1047827_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYU11460.1|1047823_1048504_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYU11461.1|1048503_1050015_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYU11462.1|1050029_1050548_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYU11463.1|1051469_1052171_-	hypothetical protein	NA	NA	NA	NA	NA
AYU11464.1|1052483_1052762_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYU11465.1|1053187_1055800_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYU11466.1|1056007_1057018_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYU11467.1|1057180_1057726_+	hypothetical protein	NA	NA	NA	NA	NA
AYU11468.1|1057722_1058832_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYU11469.1|1058930_1061039_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYU11470.1|1061051_1062959_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061163:1061182	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYU11471.1|1062973_1064227_+	inner membrane protein	NA	NA	NA	NA	NA
AYU11472.1|1064231_1065872_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYU11473.1|1065868_1066432_+	lipoprotein	NA	NA	NA	NA	NA
AYU11474.1|1066685_1066853_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYU11475.1|1066952_1067471_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYU11476.1|1067539_1069300_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYU11477.1|1069485_1069938_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYU11478.1|1070009_1071062_-	outer membrane protein A	NA	NA	NA	NA	NA
AYU11479.1|1071416_1071926_-	cell division inhibitor	NA	NA	NA	NA	NA
AYU11480.1|1072142_1072748_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYU11481.1|1072734_1074888_-	inner membrane protein	NA	NA	NA	NA	NA
AYU11482.1|1074906_1075353_-	hypothetical protein	NA	NA	NA	NA	NA
AYU11483.1|1075476_1077531_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYU11484.1|1077566_1078025_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYU11485.1|1078119_1078782_-	hypothetical protein	NA	NA	NA	NA	NA
AYU11486.1|1078952_1079369_+	hypothetical protein	NA	NA	NA	NA	NA
AYU11487.1|1079413_1079731_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYU11488.1|1079788_1081000_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYU11489.1|1082131_1082590_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU11490.1|1083326_1083608_+	acylphosphatase	NA	NA	NA	NA	NA
AYU11491.1|1083604_1083934_-	sulfite reductase	NA	NA	NA	NA	NA
AYU11492.1|1084020_1084680_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYU11493.1|1085343_1085802_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029856	Salmonella enterica subsp. enterica serovar Typhi strain 343077_286126 chromosome, complete genome	4797628	1528048	1601618	4797628	transposase,head,tRNA,tail,protease,plate	Burkholderia_virus(42.11%)	81	NA	NA
AYU11891.1|1528048_1528507_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU11892.1|1529009_1529291_+	stress response protein	NA	NA	NA	NA	NA
AYU11893.1|1529559_1530381_+|protease	serine protease	protease	NA	NA	NA	NA
AYU11894.1|1530415_1530745_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYU11895.1|1530731_1531094_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYU11896.1|1531205_1531376_-	hypothetical protein	NA	NA	NA	NA	NA
AYU11897.1|1531510_1532545_+	hypothetical protein	NA	NA	NA	NA	NA
AYU11898.1|1532719_1534108_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYU11899.1|1534118_1535648_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYU11900.1|1536174_1537119_+	hypothetical protein	NA	NA	NA	NA	NA
AYU11901.1|1537300_1537690_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYU11902.1|1537661_1538114_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYU11903.1|1538308_1538539_-	hypothetical protein	NA	NA	NA	NA	NA
AYU11904.1|1538535_1539219_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYU11905.1|1539215_1539431_-	hypothetical protein	NA	NA	NA	NA	NA
AYU11906.1|1539423_1539807_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYU11907.1|1539803_1540106_-	hypothetical protein	NA	NA	NA	NA	NA
AYU11908.1|1540115_1540388_-	hypothetical protein	NA	NA	NA	NA	NA
AYU11909.1|1540676_1541207_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYU11910.1|1541234_1541504_-	hypothetical protein	NA	NA	NA	NA	NA
AYU11911.1|1541506_1542673_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYU11912.1|1542683_1544453_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYU11913.1|1544630_1545062_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYU11914.1|1545057_1545654_+	hypothetical protein	NA	NA	NA	NA	NA
AYU11915.1|1545897_1546248_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYU11916.1|1546962_1547613_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYU11917.1|1547609_1547936_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYU11918.1|1547935_1548247_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYU11919.1|1548246_1548792_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYU11920.1|1548788_1550384_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYU11921.1|1550383_1551880_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYU11922.1|1551860_1552682_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYU11923.1|1552684_1553143_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYU11924.1|1553357_1554473_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYU11925.1|1554487_1555441_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYU11926.1|1555450_1555789_+	hypothetical protein	NA	NA	NA	NA	NA
AYU11927.1|1555790_1556237_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYU11928.1|1556236_1556701_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYU11929.1|1556697_1556952_+	hypothetical protein	NA	NA	NA	NA	NA
AYU11930.1|1556941_1558369_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYU11931.1|1558368_1558890_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYU11932.1|1558892_1559174_+	hypothetical protein	NA	NA	NA	NA	NA
AYU11933.1|1559271_1559607_+	hypothetical protein	NA	NA	NA	NA	NA
AYU11934.1|1559782_1562248_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYU11935.1|1562247_1563132_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYU11936.1|1563128_1563344_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYU11937.1|1563331_1564486_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYU11938.1|1564482_1565010_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYU11939.1|1565066_1565414_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYU11940.1|1565404_1566508_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYU11941.1|1566500_1567079_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYU11942.1|1567081_1568107_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYU11943.1|1568620_1569238_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYU11944.1|1569731_1570124_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	51.1	6.8e-19
AYU11945.1|1570720_1571293_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYU11946.1|1571573_1572956_+	amino acid permease	NA	NA	NA	NA	NA
AYU11947.1|1573017_1573353_-	hypothetical protein	NA	NA	NA	NA	NA
AYU11948.1|1573479_1574211_+	two-component response regulator	NA	NA	NA	NA	NA
AYU11949.1|1574691_1575843_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYU11950.1|1575995_1577702_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYU11951.1|1577809_1579114_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYU11952.1|1579189_1580119_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYU11953.1|1580115_1581519_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYU11954.1|1581686_1583333_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYU11955.1|1583532_1584708_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYU11956.1|1584810_1586319_+	hypothetical protein	NA	NA	NA	NA	NA
AYU11957.1|1587024_1588026_+	adenosine deaminase	NA	NA	NA	NA	NA
AYU11958.1|1588099_1589215_-	oxidoreductase	NA	NA	NA	NA	NA
AYU11959.1|1589317_1589473_+	hypothetical protein	NA	NA	NA	NA	NA
AYU11960.1|1589771_1589987_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYU11961.1|1590075_1590516_+	hypothetical protein	NA	NA	NA	NA	NA
AYU11962.1|1590592_1591174_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYU11963.1|1591173_1591752_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYU11964.1|1591744_1593766_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYU11965.1|1593766_1594825_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYU11966.1|1594828_1595449_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYU11967.1|1595451_1596144_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYU11968.1|1596143_1596779_+	endonuclease III	NA	NA	NA	NA	NA
AYU11969.1|1597379_1598885_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYU11970.1|1598989_1599595_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYU11971.1|1600343_1601618_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029856	Salmonella enterica subsp. enterica serovar Typhi strain 343077_286126 chromosome, complete genome	4797628	1782655	1787067	4797628		Escherichia_phage(50.0%)	6	NA	NA
AYU12155.1|1782655_1782895_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYU12156.1|1783767_1784577_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYU12157.1|1784649_1785027_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYU12158.1|1785174_1785717_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYU12159.1|1785908_1786637_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYU12160.1|1786653_1787067_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029856	Salmonella enterica subsp. enterica serovar Typhi strain 343077_286126 chromosome, complete genome	4797628	1990921	1998155	4797628		Morganella_phage(33.33%)	7	NA	NA
AYU12351.1|1990921_1992352_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYU12352.1|1992425_1993121_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYU12353.1|1993200_1993512_-	hypothetical protein	NA	NA	NA	NA	NA
AYU12354.1|1994162_1995347_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYU12355.1|1995806_1996019_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYU12356.1|1996464_1997733_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYU12357.1|1997735_1998155_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029856	Salmonella enterica subsp. enterica serovar Typhi strain 343077_286126 chromosome, complete genome	4797628	2104455	2114962	4797628		Enterobacteria_phage(37.5%)	10	NA	NA
AYU12454.1|2104455_2105769_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYU12455.1|2105795_2106875_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYU12456.1|2106879_2107653_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYU12457.1|2107668_2108643_-	reductase RfbI	NA	NA	NA	NA	NA
AYU12458.1|2108648_2109200_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYU12459.1|2109200_2110079_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYU12460.1|2110126_2111026_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYU12461.1|2111025_2112111_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYU12462.1|2112487_2113381_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYU12463.1|2113558_2114962_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029856	Salmonella enterica subsp. enterica serovar Typhi strain 343077_286126 chromosome, complete genome	4797628	2190853	2200024	4797628	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYU12522.1|2190853_2192887_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYU12523.1|2193127_2193586_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYU12524.1|2193757_2194288_+	lipoprotein	NA	NA	NA	NA	NA
AYU12525.1|2194344_2194812_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYU12526.1|2194858_2195578_-	two-component system response regulator	NA	NA	NA	NA	NA
AYU12527.1|2195574_2197260_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYU12528.1|2197482_2198214_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYU12529.1|2198273_2198381_+	hypothetical protein	NA	NA	NA	NA	NA
AYU12530.1|2198361_2199093_-	ABC transporter permease	NA	NA	NA	NA	NA
AYU12531.1|2199076_2200024_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029856	Salmonella enterica subsp. enterica serovar Typhi strain 343077_286126 chromosome, complete genome	4797628	2735460	2748852	4797628	tail	Salmonella_phage(70.0%)	11	NA	NA
AYU12960.1|2735460_2735679_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYU12961.1|2735769_2736870_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYU12962.1|2736866_2737352_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYU12963.1|2737348_2740426_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYU12964.1|2740418_2740538_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYU12965.1|2740552_2740855_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYU12966.1|2740909_2741425_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYU12967.1|2741434_2742607_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYU12968.1|2742749_2743322_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYU12969.1|2743999_2745115_+	glycosyltransferase	NA	NA	NA	NA	NA
AYU12970.1|2745195_2748852_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029856	Salmonella enterica subsp. enterica serovar Typhi strain 343077_286126 chromosome, complete genome	4797628	3065801	3109504	4797628	transposase,bacteriocin,protease,tRNA	Bacillus_virus(33.33%)	44	NA	NA
AYU13257.1|3065801_3066260_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU13258.1|3066449_3067529_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYU13259.1|3067630_3068794_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYU13260.1|3068815_3069862_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYU13261.1|3070235_3070661_+	hypothetical protein	NA	NA	NA	NA	NA
AYU13262.1|3070686_3071265_+	hypothetical protein	NA	NA	NA	NA	NA
AYU13263.1|3071298_3071973_+	hypothetical protein	NA	NA	NA	NA	NA
AYU13264.1|3071954_3072638_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYU13265.1|3072631_3073288_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYU13266.1|3073392_3073851_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU13267.1|3074039_3076031_-	transketolase	NA	NA	NA	NA	NA
AYU13268.1|3076306_3077065_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYU13269.1|3077165_3078086_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYU13270.1|3078313_3080290_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYU13271.1|3080298_3080430_-	hypothetical protein	NA	NA	NA	NA	NA
AYU13272.1|3080724_3081024_-	membrane protein	NA	NA	NA	NA	NA
AYU13273.1|3081079_3082234_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYU13274.1|3082726_3084121_+	galactose-proton symport	NA	NA	NA	NA	NA
AYU13275.1|3084199_3084697_+	hypothetical protein	NA	NA	NA	NA	NA
AYU13276.1|3084792_3085500_+	endonuclease I	NA	NA	NA	NA	NA
AYU13277.1|3085576_3086308_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYU13278.1|3086327_3087275_+	glutathione synthetase	NA	NA	NA	NA	NA
AYU13279.1|3087490_3088054_+	hypothetical protein	NA	NA	NA	NA	NA
AYU13280.1|3088053_3088470_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYU13281.1|3088516_3089203_-	global regulatory protein	NA	NA	NA	NA	NA
AYU13282.1|3089332_3090313_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYU13283.1|3090330_3091035_+	hypothetical protein	NA	NA	NA	NA	NA
AYU13284.1|3091053_3091620_+	hypothetical protein	NA	NA	NA	NA	NA
AYU13285.1|3091616_3091907_+	hypothetical protein	NA	NA	NA	NA	NA
AYU13286.1|3091914_3092508_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYU13287.1|3092500_3093637_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYU13288.1|3093727_3094735_-	hypothetical protein	NA	NA	NA	NA	NA
AYU13289.1|3094867_3095914_-	L-asparaginase	NA	NA	NA	NA	NA
AYU13290.1|3096232_3096691_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU13291.1|3096813_3097533_-	hypothetical protein	NA	NA	NA	NA	NA
AYU13292.1|3097582_3097909_-	hypothetical protein	NA	NA	NA	NA	NA
AYU13293.1|3097908_3098628_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYU13294.1|3098782_3099835_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYU13295.1|3099862_3100138_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYU13296.1|3100250_3101336_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYU13297.1|3101552_3102809_+	nucleoside permease	NA	NA	NA	NA	NA
AYU13298.1|3105419_3106127_+	hypothetical protein	NA	NA	NA	NA	NA
AYU13299.1|3108716_3108983_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYU13300.1|3109225_3109504_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029856	Salmonella enterica subsp. enterica serovar Typhi strain 343077_286126 chromosome, complete genome	4797628	3487540	3525598	4797628	capsid,portal,transposase,integrase,terminase,tail,plate	Salmonella_phage(82.05%)	46	3482504:3482518	3494670:3494684
3482504:3482518	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYU13629.1|3487540_3489187_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYU13630.1|3489326_3489425_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYU13631.1|3489680_3490010_+	hypothetical protein	NA	NA	NA	NA	NA
AYU13632.1|3490050_3491103_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYU13633.1|3491498_3492068_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYU13634.1|3492193_3492415_+	hypothetical protein	NA	NA	NA	NA	NA
AYU13635.1|3492447_3492957_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYU13636.1|3493131_3493356_+	hypothetical protein	NA	NA	NA	NA	NA
AYU13637.1|3493378_3493720_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYU13638.1|3493787_3494021_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYU13639.1|3494020_3494248_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYU13640.1|3494244_3495102_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3494670:3494684	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYU13641.1|3495098_3497513_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYU13642.1|3497666_3497855_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYU13643.1|3499822_3500737_+	hypothetical protein	NA	NA	NA	NA	NA
AYU13644.1|3500733_3501474_+	hypothetical protein	NA	NA	NA	NA	NA
AYU13645.1|3501508_3502546_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYU13646.1|3502545_3504312_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYU13647.1|3504454_3505288_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYU13648.1|3505304_3506363_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYU13649.1|3506366_3507017_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYU13650.1|3507049_3507577_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYU13651.1|3507576_3507780_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYU13652.1|3507783_3507999_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYU13653.1|3508018_3508492_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYU13654.1|3508493_3508871_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYU13655.1|3508867_3509296_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYU13656.1|3509391_3509823_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYU13657.1|3509815_3510262_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYU13658.1|3510330_3510909_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYU13659.1|3510905_3511265_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYU13660.1|3511251_3512160_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYU13661.1|3512152_3512758_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYU13662.1|3512754_3514269_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.0	4.4e-199
AYU13663.1|3514268_3514862_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYU13664.1|3514833_3515274_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYU13665.1|3515696_3516269_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYU13666.1|3516411_3517584_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYU13667.1|3517593_3518109_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYU13668.1|3518163_3518466_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYU13669.1|3518480_3518600_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYU13670.1|3518592_3521670_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYU13671.1|3521666_3522152_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYU13672.1|3522148_3523249_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYU13673.1|3523339_3523558_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYU13674.1|3525139_3525598_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029856	Salmonella enterica subsp. enterica serovar Typhi strain 343077_286126 chromosome, complete genome	4797628	4457380	4531544	4797628	capsid,portal,integrase,terminase,tail,plate	Salmonella_phage(82.98%)	76	4518881:4518897	4531703:4531719
AYU14464.1|4457380_4459330_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYU14465.1|4459401_4460310_+	hypothetical protein	NA	NA	NA	NA	NA
AYU14466.1|4460383_4461283_+	hypothetical protein	NA	NA	NA	NA	NA
AYU14467.1|4461324_4461684_+	hypothetical protein	NA	NA	NA	NA	NA
AYU14468.1|4461783_4462053_-	hypothetical protein	NA	NA	NA	NA	NA
AYU14469.1|4462184_4463459_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYU14470.1|4463678_4464056_+	hypothetical protein	NA	NA	NA	NA	NA
AYU14471.1|4464142_4464361_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYU14472.1|4464428_4465529_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYU14473.1|4465525_4466011_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYU14474.1|4466010_4468791_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYU14475.1|4468783_4468903_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYU14476.1|4468917_4469220_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYU14477.1|4469274_4469790_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYU14478.1|4469799_4470972_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYU14479.1|4471506_4472229_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYU14480.1|4472426_4472834_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYU14481.1|4472840_4474460_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYU14482.1|4474456_4475062_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYU14483.1|4475054_4475963_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYU14484.1|4475949_4476309_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYU14485.1|4476305_4476884_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYU14486.1|4476952_4477399_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYU14487.1|4477391_4477823_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYU14488.1|4477918_4478344_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYU14489.1|4478343_4478721_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYU14490.1|4478725_4479196_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYU14491.1|4479215_4479431_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYU14492.1|4479434_4479638_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYU14493.1|4479637_4480102_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYU14494.1|4480195_4480846_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYU14495.1|4480849_4481914_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYU14496.1|4481930_4482764_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYU14497.1|4482906_4484673_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYU14498.1|4484669_4485716_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYU14499.1|4485764_4486460_-	hypothetical protein	NA	NA	NA	NA	NA
AYU14500.1|4486479_4487544_-	hypothetical protein	NA	NA	NA	NA	NA
AYU14501.1|4487540_4488605_-	hypothetical protein	NA	NA	NA	NA	NA
AYU14502.1|4489529_4489859_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYU14503.1|4489855_4491925_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYU14504.1|4491915_4492776_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYU14505.1|4492772_4493357_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYU14506.1|4493353_4493581_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYU14507.1|4493580_4493814_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYU14508.1|4493881_4494223_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYU14509.1|4494186_4494387_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYU14510.1|4494394_4494904_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYU14511.1|4494936_4495179_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYU14512.1|4495295_4495928_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYU14513.1|4495931_4496957_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYU14514.1|4497063_4497417_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYU14515.1|4498033_4498321_+	hypothetical protein	NA	NA	NA	NA	NA
AYU14516.1|4498331_4499222_+	methyltransferase	NA	NA	NA	NA	NA
AYU14517.1|4499221_4499968_+	hypothetical protein	NA	NA	NA	NA	NA
AYU14518.1|4500269_4502240_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYU14519.1|4502259_4503564_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYU14520.1|4503586_4504282_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYU14521.1|4504307_4505102_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYU14522.1|4505111_4506179_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYU14523.1|4506223_4507960_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYU14524.1|4507959_4510455_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYU14525.1|4510478_4511525_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYU14526.1|4511527_4512805_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYU14527.1|4513049_4513589_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYU14528.1|4514442_4515954_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYU14529.1|4515937_4517527_+	hypothetical protein	NA	NA	NA	NA	NA
AYU14530.1|4517690_4518704_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4518881:4518897	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYU14531.1|4519130_4519424_+	hypothetical protein	NA	NA	NA	NA	NA
AYU14532.1|4519420_4519909_+	hypothetical protein	NA	NA	NA	NA	NA
AYU14533.1|4520088_4520541_-	hypothetical protein	NA	NA	NA	NA	NA
AYU14534.1|4525763_4526225_+	hypothetical protein	NA	NA	NA	NA	NA
AYU14535.1|4526221_4526443_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYU14536.1|4527299_4528082_+	hypothetical protein	NA	NA	NA	NA	NA
AYU14537.1|4528708_4528933_-	hypothetical protein	NA	NA	NA	NA	NA
AYU14538.1|4529062_4529974_-	hypothetical protein	NA	NA	NA	NA	NA
AYU14539.1|4530284_4531544_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4531703:4531719	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029856	Salmonella enterica subsp. enterica serovar Typhi strain 343077_286126 chromosome, complete genome	4797628	4673796	4684055	4797628	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYU14676.1|4673796_4674873_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYU14677.1|4674869_4675943_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYU14678.1|4675917_4677081_-	hypothetical protein	NA	NA	NA	NA	NA
AYU14679.1|4677356_4677923_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYU14680.1|4677938_4678178_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYU14681.1|4678181_4679042_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYU14682.1|4679464_4679788_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYU14683.1|4679771_4680272_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYU14684.1|4680268_4680496_+	hypothetical protein	NA	NA	NA	NA	NA
AYU14685.1|4680492_4680813_+	P4 phage protein	NA	NA	NA	NA	NA
AYU14686.1|4680827_4681502_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYU14687.1|4681498_4683160_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYU14688.1|4683896_4684055_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029857	Salmonella enterica subsp. enterica serovar Typhi strain 343077_286126 plasmid pHCM2, complete sequence	106706	212	63505	106706	tail	Salmonella_phage(93.33%)	77	NA	NA
AYU14779.1|212_443_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AYU14780.1|1028_1637_+	putative ribonuclease H	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AYU14781.1|1779_2274_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
AYU14782.1|2283_2472_+	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AYU14783.1|2580_3423_+	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AYU14784.1|3531_4104_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AYU14785.1|4227_5931_+	putative DNA modification methylase	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
AYU14786.1|5989_6679_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
AYU14787.1|6675_6849_+	hypothetical protein	NA	J9Q801	Salmonella_phage	98.2	9.5e-26
AYU14788.1|6959_7331_+	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
AYU14789.1|7422_8064_+	hypothetical protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
AYU14790.1|8060_8603_+	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
AYU14791.1|8614_8923_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
AYU14792.1|8919_9207_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
AYU14793.1|9267_9471_-	hypothetical protein	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
AYU14794.1|9644_9926_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
AYU14795.1|10010_10328_+	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
AYU14796.1|10337_11528_+	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
AYU14797.1|12964_13210_-	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
AYU14798.1|13352_13568_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
AYU14799.1|13578_13797_+	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AYU14800.1|13891_14206_+	hypothetical protein	NA	NA	NA	NA	NA
AYU14801.1|14282_14594_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
AYU14802.1|14722_15115_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
AYU14803.1|15235_15523_+	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
AYU14804.1|15728_16211_+	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
AYU14805.1|16842_17070_-	hypothetical protein	NA	NA	NA	NA	NA
AYU14806.1|17154_17805_-	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
AYU14807.1|18439_18967_-	putative transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
AYU14808.1|18971_19394_-	putative lipoprotein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
AYU14809.1|19453_19732_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AYU14810.1|19734_21294_-	putative helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
AYU14811.1|21376_22057_+	hypothetical protein	NA	J9Q756	Salmonella_phage	99.6	7.4e-122
AYU14812.1|22056_22725_+	hypothetical protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
AYU14813.1|22721_23360_+	putative ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	99.1	5.5e-111
AYU14814.1|23352_23607_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AYU14815.1|23603_24503_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
AYU14816.1|24512_24779_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AYU14817.1|24974_25616_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.5	1.8e-109
AYU14818.1|25618_26875_+	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
AYU14819.1|26908_28483_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
AYU14820.1|28505_29402_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
AYU14821.1|29428_30304_+	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
AYU14822.1|30378_31302_+	hypothetical protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
AYU14823.1|31345_31780_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
AYU14824.1|31779_32613_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
AYU14825.1|32710_33055_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AYU14826.1|33045_33519_+	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AYU14827.1|33520_33904_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AYU14828.1|33978_34725_+	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
AYU14829.1|34784_35102_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYU14830.1|35182_35452_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AYU14831.1|35459_40043_+	hypothetical protein	NA	J9Q712	Salmonella_phage	92.9	0.0e+00
AYU14832.1|40084_40420_+	hypothetical protein	NA	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AYU14833.1|40476_41208_+|tail	putative phage tail protein	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
AYU14834.1|41200_41998_+	hypothetical protein	NA	J9Q7R4	Salmonella_phage	95.8	1.2e-155
AYU14835.1|41985_42573_+|tail	putative phage tail protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
AYU14836.1|42587_46976_+|tail	putative phage tail protein	tail	J9Q713	Salmonella_phage	86.7	0.0e+00
AYU14837.1|47058_49611_+	hypothetical protein	NA	A0A0A0YQM3	Citrobacter_virus	52.5	1.4e-152
AYU14838.1|49725_50049_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
AYU14839.1|50035_50755_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	1.5e-125
AYU14840.1|50823_51168_+	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.6	5.9e-27
AYU14841.1|51218_51770_-	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
AYU14842.1|52100_52766_+	hypothetical protein	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
AYU14843.1|52765_53125_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AYU14844.1|53173_53929_+	hypothetical protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
AYU14845.1|53998_55054_-	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
AYU14846.1|55331_56057_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
AYU14847.1|56117_57458_+	putative DNA helicase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
AYU14848.1|57520_58732_+	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
AYU14849.1|58733_59786_-	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
AYU14850.1|59969_60764_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
AYU14851.1|61064_61322_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
AYU14852.1|61356_62679_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
AYU14853.1|62844_63051_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
AYU14854.1|63050_63203_+	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
AYU14855.1|63199_63505_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
>prophage 2
CP029857	Salmonella enterica subsp. enterica serovar Typhi strain 343077_286126 plasmid pHCM2, complete sequence	106706	71995	105937	106706		Salmonella_phage(100.0%)	35	NA	NA
AYU14868.1|71995_74353_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	90.7	0.0e+00
AYU14869.1|74449_75685_+	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
AYU14870.1|75865_79384_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
AYU14871.1|79380_79824_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.0e-71
AYU14872.1|79917_80508_-	hypothetical protein	NA	NA	NA	NA	NA
AYU14873.1|80753_81185_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
AYU14874.1|81304_82333_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
AYU14875.1|82393_83338_+	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
AYU14876.1|83337_83604_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYU14877.1|83606_84683_+	putative recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AYU14878.1|84978_85821_+	putative lipoprotein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
AYU14879.1|85983_86355_+	hypothetical protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
AYU14880.1|86338_86749_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
AYU14881.1|86817_87093_+	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
AYU14882.1|87133_87439_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
AYU14883.1|87438_87642_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
AYU14884.1|88170_89226_-	putative replication protein A	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
AYU14885.1|89970_90615_+	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
AYU14886.1|90690_91185_+	hypothetical protein	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
AYU14887.1|91216_91522_-	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.0	2.0e-50
AYU14888.1|91948_93034_+	exonuclease	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
AYU14889.1|93030_93267_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AYU14890.1|93263_95180_+	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AYU14891.1|95169_95916_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
AYU14892.1|95928_96498_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
AYU14893.1|96575_98891_+	ribonucleotide-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AYU14894.1|98998_100141_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
AYU14895.1|100223_101153_+	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
AYU14896.1|101268_102384_+	putative thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
AYU14897.1|102385_102799_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AYU14898.1|102795_103272_+	hypothetical protein	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AYU14899.1|103271_103916_+	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AYU14900.1|103979_104399_+	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
AYU14901.1|104408_104966_+	hypothetical protein	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AYU14902.1|105010_105937_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.1e-107
