The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029858	Salmonella enterica subsp. enterica serovar Typhi strain 343077_285138 chromosome, complete genome	4800928	930368	937680	4800928	protease,integrase	Dickeya_phage(16.67%)	6	931619:931633	942798:942812
AYU06994.1|930368_931487_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYU06995.1|931483_933430_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931619:931633	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYU06996.1|933559_933781_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYU06997.1|934104_934425_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYU06998.1|934455_936732_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYU06999.1|937302_937680_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942798:942812	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029858	Salmonella enterica subsp. enterica serovar Typhi strain 343077_285138 chromosome, complete genome	4800928	1008662	1085974	4800928	terminase,integrase,transposase,protease,tail	Salmonella_phage(73.33%)	93	990728:990747	1061335:1061354
990728:990747	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYU07049.1|1008662_1010003_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYU07050.1|1009999_1010248_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYU07051.1|1010288_1010534_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYU07052.1|1010533_1011415_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYU07053.1|1011411_1012476_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYU07054.1|1012553_1013234_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYU07055.1|1013230_1014016_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYU07056.1|1014021_1014318_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYU07057.1|1014408_1014609_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYU07058.1|1014897_1015302_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYU07059.1|1015633_1016008_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYU07060.1|1016092_1017076_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYU07061.1|1017078_1017828_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYU07062.1|1017838_1018186_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYU07063.1|1018182_1018707_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYU07064.1|1018706_1019180_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYU07065.1|1019183_1019756_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYU07066.1|1019849_1020116_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYU07067.1|1020197_1020359_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU07068.1|1020791_1021289_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU07069.1|1021473_1021713_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYU07070.1|1021702_1022008_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYU07071.1|1022047_1022650_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYU07072.1|1022858_1023470_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYU07073.1|1023602_1024400_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYU07074.1|1024798_1024924_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU07075.1|1025059_1025509_-	lipoprotein	NA	NA	NA	NA	NA
AYU07076.1|1025725_1026115_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYU07077.1|1026101_1026383_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYU07078.1|1026382_1026997_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYU07079.1|1027215_1027470_+	hypothetical protein	NA	NA	NA	NA	NA
AYU07080.1|1027574_1027952_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYU07081.1|1028015_1028276_+	hypothetical protein	NA	NA	NA	NA	NA
AYU07082.1|1028365_1029118_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYU07083.1|1029083_1030487_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYU07084.1|1030486_1031956_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYU07085.1|1032047_1032578_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYU07086.1|1032592_1033825_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYU07087.1|1033829_1034327_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYU07088.1|1034338_1035280_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYU07089.1|1035321_1035690_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYU07090.1|1035655_1036063_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYU07091.1|1036059_1036614_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYU07092.1|1036600_1036990_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYU07093.1|1036964_1037528_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYU07094.1|1037531_1038677_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYU07095.1|1038688_1039129_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYU07096.1|1039132_1039585_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYU07097.1|1039762_1041715_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYU07098.1|1041714_1042365_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYU07099.1|1042368_1042671_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYU07100.1|1042673_1043705_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYU07101.1|1043701_1044037_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYU07102.1|1044231_1044963_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU07103.1|1044962_1045391_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU07104.1|1045449_1046205_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYU07105.1|1046292_1046430_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYU07106.1|1046445_1046799_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYU07107.1|1046799_1047999_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYU07108.1|1047995_1048676_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYU07109.1|1048675_1050187_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYU07110.1|1050201_1050720_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYU07111.1|1051641_1052343_-	hypothetical protein	NA	NA	NA	NA	NA
AYU07112.1|1052655_1052934_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYU07113.1|1053359_1055972_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYU07114.1|1056179_1057190_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYU07115.1|1057352_1057898_+	hypothetical protein	NA	NA	NA	NA	NA
AYU07116.1|1057894_1059004_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYU07117.1|1059102_1061211_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYU07118.1|1061223_1063131_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061335:1061354	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYU07119.1|1063145_1064399_+	inner membrane protein	NA	NA	NA	NA	NA
AYU07120.1|1064403_1066044_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYU07121.1|1066040_1066604_+	lipoprotein	NA	NA	NA	NA	NA
AYU07122.1|1066857_1067025_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYU07123.1|1067124_1067643_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYU07124.1|1067711_1069472_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYU07125.1|1069657_1070110_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYU07126.1|1070181_1071234_-	outer membrane protein A	NA	NA	NA	NA	NA
AYU07127.1|1071588_1072098_-	cell division inhibitor	NA	NA	NA	NA	NA
AYU07128.1|1072314_1072920_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYU07129.1|1072906_1075060_-	inner membrane protein	NA	NA	NA	NA	NA
AYU07130.1|1075078_1075525_-	hypothetical protein	NA	NA	NA	NA	NA
AYU07131.1|1075648_1077703_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYU07132.1|1077738_1078197_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYU07133.1|1078291_1078954_-	hypothetical protein	NA	NA	NA	NA	NA
AYU07134.1|1079124_1079541_+	hypothetical protein	NA	NA	NA	NA	NA
AYU07135.1|1079585_1079903_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYU07136.1|1079960_1081172_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYU07137.1|1082303_1082762_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU07138.1|1083498_1083780_+	acylphosphatase	NA	NA	NA	NA	NA
AYU07139.1|1083776_1084106_-	sulfite reductase	NA	NA	NA	NA	NA
AYU07140.1|1084192_1084852_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYU07141.1|1085515_1085974_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029858	Salmonella enterica subsp. enterica serovar Typhi strain 343077_285138 chromosome, complete genome	4800928	1528792	1602390	4800928	head,transposase,plate,tRNA,protease,tail	Burkholderia_virus(44.12%)	72	NA	NA
AYU07541.1|1528792_1529251_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU07542.1|1529753_1530035_+	stress response protein	NA	NA	NA	NA	NA
AYU07543.1|1530303_1531125_+|protease	serine protease	protease	NA	NA	NA	NA
AYU07544.1|1531159_1531489_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYU07545.1|1531475_1531838_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYU07546.1|1531949_1532120_-	hypothetical protein	NA	NA	NA	NA	NA
AYU07547.1|1532254_1533289_+	hypothetical protein	NA	NA	NA	NA	NA
AYU07548.1|1533463_1534852_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYU07549.1|1534862_1536392_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYU07550.1|1536918_1537863_+	hypothetical protein	NA	NA	NA	NA	NA
AYU07551.1|1538044_1538434_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYU07552.1|1538405_1538858_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYU07553.1|1539052_1539283_-	hypothetical protein	NA	NA	NA	NA	NA
AYU07554.1|1539279_1539963_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYU07555.1|1540547_1540850_-	hypothetical protein	NA	NA	NA	NA	NA
AYU07556.1|1541420_1541951_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYU07557.1|1542250_1543417_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYU07558.1|1543427_1545197_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYU07559.1|1546641_1546992_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYU07560.1|1547706_1548357_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYU07561.1|1548679_1548991_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYU07562.1|1548990_1549536_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYU07563.1|1549532_1551128_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYU07564.1|1551127_1552624_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYU07565.1|1552604_1553426_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYU07566.1|1553428_1553887_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYU07567.1|1554101_1555217_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYU07568.1|1555231_1556185_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYU07569.1|1556194_1556533_+	hypothetical protein	NA	NA	NA	NA	NA
AYU07570.1|1556534_1556981_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYU07571.1|1556980_1557445_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYU07572.1|1557685_1559113_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYU07573.1|1559112_1559634_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYU07574.1|1559636_1559918_+	hypothetical protein	NA	NA	NA	NA	NA
AYU07575.1|1560015_1560351_+	hypothetical protein	NA	NA	NA	NA	NA
AYU07576.1|1560526_1562992_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYU07577.1|1562991_1563876_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYU07578.1|1563872_1564088_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYU07579.1|1564075_1565230_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYU07580.1|1565226_1565754_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYU07581.1|1565810_1566158_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYU07582.1|1566148_1567252_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYU07583.1|1567244_1567823_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYU07584.1|1567825_1568851_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYU07585.1|1569364_1569982_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYU07586.1|1571492_1572065_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYU07587.1|1572345_1573728_+	amino acid permease	NA	NA	NA	NA	NA
AYU07588.1|1573789_1574125_-	hypothetical protein	NA	NA	NA	NA	NA
AYU07589.1|1574251_1574983_+	two-component response regulator	NA	NA	NA	NA	NA
AYU07590.1|1575463_1576615_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYU07591.1|1576767_1578474_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYU07592.1|1578581_1579886_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYU07593.1|1579961_1580891_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYU07594.1|1580887_1582291_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYU07595.1|1582458_1584105_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYU07596.1|1584304_1585480_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYU07597.1|1585582_1587091_+	hypothetical protein	NA	NA	NA	NA	NA
AYU07598.1|1587796_1588798_+	adenosine deaminase	NA	NA	NA	NA	NA
AYU07599.1|1588871_1589987_-	oxidoreductase	NA	NA	NA	NA	NA
AYU07600.1|1590089_1590245_+	hypothetical protein	NA	NA	NA	NA	NA
AYU07601.1|1590543_1590759_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYU07602.1|1590847_1591288_+	hypothetical protein	NA	NA	NA	NA	NA
AYU07603.1|1591364_1591946_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYU07604.1|1591945_1592524_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYU07605.1|1592516_1594538_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYU07606.1|1594538_1595597_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYU07607.1|1595600_1596221_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYU07608.1|1596223_1596916_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYU07609.1|1596915_1597551_+	endonuclease III	NA	NA	NA	NA	NA
AYU07610.1|1598151_1599657_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYU07611.1|1599761_1600367_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYU07612.1|1601115_1602390_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029858	Salmonella enterica subsp. enterica serovar Typhi strain 343077_285138 chromosome, complete genome	4800928	1783427	1787839	4800928		Escherichia_phage(50.0%)	6	NA	NA
AYU07796.1|1783427_1783667_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYU07797.1|1784539_1785349_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYU07798.1|1785421_1785799_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYU07799.1|1785946_1786489_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYU07800.1|1786680_1787409_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYU07801.1|1787425_1787839_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029858	Salmonella enterica subsp. enterica serovar Typhi strain 343077_285138 chromosome, complete genome	4800928	1991693	1998927	4800928		Morganella_phage(33.33%)	7	NA	NA
AYU07992.1|1991693_1993124_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYU07993.1|1993197_1993893_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYU07994.1|1993972_1994284_-	hypothetical protein	NA	NA	NA	NA	NA
AYU07995.1|1994934_1996119_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYU07996.1|1996578_1996791_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYU07997.1|1997236_1998505_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYU07998.1|1998507_1998927_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029858	Salmonella enterica subsp. enterica serovar Typhi strain 343077_285138 chromosome, complete genome	4800928	2105227	2115734	4800928		Enterobacteria_phage(37.5%)	10	NA	NA
AYU08095.1|2105227_2106541_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYU08096.1|2106567_2107647_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYU08097.1|2107651_2108425_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYU08098.1|2108440_2109415_-	reductase RfbI	NA	NA	NA	NA	NA
AYU08099.1|2109420_2109972_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYU08100.1|2109972_2110851_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYU08101.1|2110898_2111798_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYU08102.1|2111797_2112883_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYU08103.1|2113259_2114153_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYU08104.1|2114330_2115734_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029858	Salmonella enterica subsp. enterica serovar Typhi strain 343077_285138 chromosome, complete genome	4800928	2191625	2200796	4800928	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYU08163.1|2191625_2193659_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYU08164.1|2193899_2194358_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYU08165.1|2194529_2195060_+	lipoprotein	NA	NA	NA	NA	NA
AYU08166.1|2195116_2195584_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYU08167.1|2195630_2196350_-	two-component system response regulator	NA	NA	NA	NA	NA
AYU08168.1|2196346_2198032_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYU08169.1|2198254_2198986_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYU08170.1|2199045_2199153_+	hypothetical protein	NA	NA	NA	NA	NA
AYU08171.1|2199133_2199865_-	ABC transporter permease	NA	NA	NA	NA	NA
AYU08172.1|2199848_2200796_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029858	Salmonella enterica subsp. enterica serovar Typhi strain 343077_285138 chromosome, complete genome	4800928	2736240	2749632	4800928	tail	Salmonella_phage(70.0%)	11	NA	NA
AYU08601.1|2736240_2736459_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYU08602.1|2736549_2737650_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYU08603.1|2737646_2738132_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYU08604.1|2738128_2741206_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYU08605.1|2741198_2741318_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYU08606.1|2741332_2741635_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYU08607.1|2741689_2742205_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYU08608.1|2742214_2743387_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYU08609.1|2743529_2744102_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYU08610.1|2744779_2745895_+	glycosyltransferase	NA	NA	NA	NA	NA
AYU08611.1|2745975_2749632_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029858	Salmonella enterica subsp. enterica serovar Typhi strain 343077_285138 chromosome, complete genome	4800928	3067571	3111274	4800928	tRNA,transposase,protease,bacteriocin	Bacillus_virus(33.33%)	44	NA	NA
AYU08900.1|3067571_3068030_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU08901.1|3068219_3069299_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYU08902.1|3069400_3070564_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYU08903.1|3070585_3071632_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYU08904.1|3072005_3072431_+	hypothetical protein	NA	NA	NA	NA	NA
AYU08905.1|3072456_3073035_+	hypothetical protein	NA	NA	NA	NA	NA
AYU08906.1|3073068_3073743_+	hypothetical protein	NA	NA	NA	NA	NA
AYU08907.1|3073724_3074408_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYU08908.1|3074401_3075058_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYU08909.1|3075162_3075621_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU08910.1|3075809_3077801_-	transketolase	NA	NA	NA	NA	NA
AYU08911.1|3078076_3078835_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYU08912.1|3078935_3079856_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYU08913.1|3080083_3082060_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYU08914.1|3082068_3082200_-	hypothetical protein	NA	NA	NA	NA	NA
AYU08915.1|3082494_3082794_-	membrane protein	NA	NA	NA	NA	NA
AYU08916.1|3082849_3084004_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYU08917.1|3084496_3085891_+	galactose-proton symport	NA	NA	NA	NA	NA
AYU08918.1|3085969_3086467_+	hypothetical protein	NA	NA	NA	NA	NA
AYU08919.1|3086562_3087270_+	endonuclease I	NA	NA	NA	NA	NA
AYU08920.1|3087346_3088078_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYU08921.1|3088097_3089045_+	glutathione synthetase	NA	NA	NA	NA	NA
AYU08922.1|3089260_3089824_+	hypothetical protein	NA	NA	NA	NA	NA
AYU08923.1|3089823_3090240_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYU08924.1|3090286_3090973_-	global regulatory protein	NA	NA	NA	NA	NA
AYU08925.1|3091102_3092083_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYU08926.1|3092100_3092805_+	hypothetical protein	NA	NA	NA	NA	NA
AYU08927.1|3092823_3093390_+	hypothetical protein	NA	NA	NA	NA	NA
AYU08928.1|3093386_3093677_+	hypothetical protein	NA	NA	NA	NA	NA
AYU08929.1|3093684_3094278_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYU08930.1|3094270_3095407_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYU08931.1|3095497_3096505_-	hypothetical protein	NA	NA	NA	NA	NA
AYU08932.1|3096637_3097684_-	L-asparaginase	NA	NA	NA	NA	NA
AYU08933.1|3098002_3098461_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU08934.1|3098583_3099303_-	hypothetical protein	NA	NA	NA	NA	NA
AYU08935.1|3099352_3099679_-	hypothetical protein	NA	NA	NA	NA	NA
AYU08936.1|3099678_3100398_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYU08937.1|3100552_3101605_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYU08938.1|3101632_3101908_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYU08939.1|3102020_3103106_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYU08940.1|3103322_3104579_+	nucleoside permease	NA	NA	NA	NA	NA
AYU08941.1|3107189_3107897_+	hypothetical protein	NA	NA	NA	NA	NA
AYU08942.1|3110486_3110753_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYU08943.1|3110995_3111274_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029858	Salmonella enterica subsp. enterica serovar Typhi strain 343077_285138 chromosome, complete genome	4800928	3489505	3527563	4800928	terminase,capsid,integrase,transposase,plate,portal,tail	Salmonella_phage(82.05%)	46	3484469:3484483	3496635:3496649
3484469:3484483	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYU09272.1|3489505_3491152_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYU09273.1|3491291_3491390_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYU09274.1|3491645_3491975_+	hypothetical protein	NA	NA	NA	NA	NA
AYU09275.1|3492015_3493068_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYU09276.1|3493463_3494033_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYU09277.1|3494158_3494380_+	hypothetical protein	NA	NA	NA	NA	NA
AYU09278.1|3494412_3494922_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYU09279.1|3495096_3495321_+	hypothetical protein	NA	NA	NA	NA	NA
AYU09280.1|3495343_3495685_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYU09281.1|3495752_3495986_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYU09282.1|3495985_3496213_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYU09283.1|3496209_3497067_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3496635:3496649	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYU09284.1|3497063_3499478_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYU09285.1|3499631_3499820_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYU09286.1|3501787_3502702_+	hypothetical protein	NA	NA	NA	NA	NA
AYU09287.1|3502698_3503439_+	hypothetical protein	NA	NA	NA	NA	NA
AYU09288.1|3503473_3504511_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYU09289.1|3504510_3506277_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYU09290.1|3506419_3507253_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYU09291.1|3507269_3508328_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYU09292.1|3508331_3508982_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYU09293.1|3509014_3509542_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYU09294.1|3509541_3509745_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYU09295.1|3509748_3509964_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYU09296.1|3509983_3510457_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYU09297.1|3510458_3510836_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYU09298.1|3510832_3511261_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYU09299.1|3511356_3511788_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYU09300.1|3511780_3512227_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYU09301.1|3512295_3512874_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYU09302.1|3512870_3513230_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYU09303.1|3513216_3514125_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYU09304.1|3514117_3514723_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYU09305.1|3514719_3516234_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYU09306.1|3516233_3516827_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYU09307.1|3516798_3517239_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYU09308.1|3517661_3518234_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYU09309.1|3518376_3519549_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYU09310.1|3519558_3520074_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYU09311.1|3520128_3520431_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYU09312.1|3520445_3520565_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYU09313.1|3520557_3523635_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYU09314.1|3523631_3524117_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYU09315.1|3524113_3525214_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYU09316.1|3525304_3525523_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYU09317.1|3527104_3527563_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029858	Salmonella enterica subsp. enterica serovar Typhi strain 343077_285138 chromosome, complete genome	4800928	4460680	4534844	4800928	terminase,tail,capsid,integrase,portal,plate	Salmonella_phage(82.98%)	76	4522181:4522197	4535003:4535019
AYU10110.1|4460680_4462630_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYU10111.1|4462701_4463610_+	hypothetical protein	NA	NA	NA	NA	NA
AYU10112.1|4463683_4464583_+	hypothetical protein	NA	NA	NA	NA	NA
AYU10113.1|4464624_4464984_+	hypothetical protein	NA	NA	NA	NA	NA
AYU10114.1|4465083_4465353_-	hypothetical protein	NA	NA	NA	NA	NA
AYU10115.1|4465484_4466759_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYU10116.1|4466978_4467356_+	hypothetical protein	NA	NA	NA	NA	NA
AYU10117.1|4467442_4467661_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYU10118.1|4467728_4468829_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYU10119.1|4468825_4469311_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYU10120.1|4469310_4472091_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYU10121.1|4472083_4472203_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYU10122.1|4472217_4472520_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYU10123.1|4472574_4473090_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYU10124.1|4473099_4474272_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYU10125.1|4474806_4475529_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYU10126.1|4475726_4476134_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYU10127.1|4476140_4477760_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYU10128.1|4477756_4478362_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYU10129.1|4478354_4479263_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYU10130.1|4479249_4479609_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYU10131.1|4479605_4480184_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYU10132.1|4480252_4480699_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYU10133.1|4480691_4481123_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYU10134.1|4481218_4481644_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYU10135.1|4481643_4482021_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYU10136.1|4482025_4482496_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYU10137.1|4482515_4482731_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYU10138.1|4482734_4482938_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYU10139.1|4482937_4483402_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYU10140.1|4483495_4484146_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYU10141.1|4484149_4485214_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYU10142.1|4485230_4486064_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYU10143.1|4486206_4487973_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYU10144.1|4487969_4489016_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYU10145.1|4489064_4489760_-	hypothetical protein	NA	NA	NA	NA	NA
AYU10146.1|4489779_4490844_-	hypothetical protein	NA	NA	NA	NA	NA
AYU10147.1|4490840_4491905_-	hypothetical protein	NA	NA	NA	NA	NA
AYU10148.1|4492829_4493159_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYU10149.1|4493155_4495225_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYU10150.1|4495215_4496076_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYU10151.1|4496072_4496657_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYU10152.1|4496653_4496881_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYU10153.1|4496880_4497114_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYU10154.1|4497181_4497523_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYU10155.1|4497486_4497687_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYU10156.1|4497694_4498204_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYU10157.1|4498236_4498479_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYU10158.1|4498595_4499228_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYU10159.1|4499231_4500257_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYU10160.1|4500363_4500717_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYU10161.1|4501333_4501621_+	hypothetical protein	NA	NA	NA	NA	NA
AYU10162.1|4501631_4502522_+	methyltransferase	NA	NA	NA	NA	NA
AYU10163.1|4502521_4503268_+	hypothetical protein	NA	NA	NA	NA	NA
AYU10164.1|4503569_4505540_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYU10165.1|4505559_4506864_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYU10166.1|4506886_4507582_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYU10167.1|4507607_4508402_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYU10168.1|4508411_4509479_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYU10169.1|4509523_4511260_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYU10170.1|4511259_4513755_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYU10171.1|4513778_4514825_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYU10172.1|4514827_4516105_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYU10173.1|4516349_4516889_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYU10174.1|4517742_4519254_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYU10175.1|4519237_4520827_+	hypothetical protein	NA	NA	NA	NA	NA
AYU10176.1|4520990_4522004_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4522181:4522197	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYU10177.1|4522430_4522724_+	hypothetical protein	NA	NA	NA	NA	NA
AYU10178.1|4522720_4523209_+	hypothetical protein	NA	NA	NA	NA	NA
AYU10179.1|4523388_4523841_-	hypothetical protein	NA	NA	NA	NA	NA
AYU10180.1|4529063_4529525_+	hypothetical protein	NA	NA	NA	NA	NA
AYU10181.1|4529521_4529743_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYU10182.1|4530599_4531382_+	hypothetical protein	NA	NA	NA	NA	NA
AYU10183.1|4532008_4532233_-	hypothetical protein	NA	NA	NA	NA	NA
AYU10184.1|4532362_4533274_-	hypothetical protein	NA	NA	NA	NA	NA
AYU10185.1|4533584_4534844_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4535003:4535019	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029858	Salmonella enterica subsp. enterica serovar Typhi strain 343077_285138 chromosome, complete genome	4800928	4677096	4687355	4800928	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYU10322.1|4677096_4678173_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYU10323.1|4678169_4679243_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYU10324.1|4679217_4680381_-	hypothetical protein	NA	NA	NA	NA	NA
AYU10325.1|4680656_4681223_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYU10326.1|4681238_4681478_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYU10327.1|4681481_4682342_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYU10328.1|4682764_4683088_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYU10329.1|4683071_4683572_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYU10330.1|4683568_4683796_+	hypothetical protein	NA	NA	NA	NA	NA
AYU10331.1|4683792_4684113_+	P4 phage protein	NA	NA	NA	NA	NA
AYU10332.1|4684127_4684802_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYU10333.1|4684798_4686460_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYU10334.1|4687196_4687355_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029859	Salmonella enterica subsp. enterica serovar Typhi strain 343077_285138 plasmid pHCM2, complete sequence	106706	1100	85860	106706	tail	Salmonella_phage(96.77%)	96	NA	NA
AYU10427.1|1100_1424_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
AYU10428.1|1538_4091_-	hypothetical protein	NA	A0A0A0YQM3	Citrobacter_virus	52.5	1.4e-152
AYU10429.1|4173_8562_-|tail	putative phage tail protein	tail	J9Q713	Salmonella_phage	86.7	0.0e+00
AYU10430.1|8576_9164_-|tail	putative phage tail protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
AYU10431.1|9151_9949_-	hypothetical protein	NA	J9Q7R4	Salmonella_phage	95.8	1.2e-155
AYU10432.1|9941_10673_-|tail	putative phage tail protein	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
AYU10433.1|10729_11065_-	hypothetical protein	NA	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AYU10434.1|11106_15690_-	hypothetical protein	NA	J9Q712	Salmonella_phage	92.9	0.0e+00
AYU10435.1|15697_15967_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AYU10436.1|16047_16365_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYU10437.1|16424_17171_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
AYU10438.1|17245_17629_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AYU10439.1|17630_18104_-	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AYU10440.1|18094_18439_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AYU10441.1|18536_19370_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
AYU10442.1|19369_19804_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
AYU10443.1|19847_20771_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
AYU10444.1|20845_21721_-	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
AYU10445.1|21747_22644_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
AYU10446.1|22666_24241_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
AYU10447.1|24274_25531_-	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
AYU10448.1|25533_26175_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.5	1.8e-109
AYU10449.1|26370_26637_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AYU10450.1|26646_27546_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
AYU10451.1|27542_27797_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AYU10452.1|27789_28428_-	putative ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	99.1	5.5e-111
AYU10453.1|28424_29093_-	hypothetical protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
AYU10454.1|29092_29773_-	hypothetical protein	NA	J9Q756	Salmonella_phage	99.6	7.4e-122
AYU10455.1|29855_31415_+	putative helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
AYU10456.1|31417_31696_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AYU10457.1|31755_32178_+	putative lipoprotein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
AYU10458.1|32182_32710_+	putative transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
AYU10459.1|33344_33995_+	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
AYU10460.1|34079_34307_+	hypothetical protein	NA	NA	NA	NA	NA
AYU10461.1|34938_35421_-	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
AYU10462.1|35626_35914_-	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
AYU10463.1|36034_36427_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
AYU10464.1|36555_36867_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
AYU10465.1|36943_37258_-	hypothetical protein	NA	NA	NA	NA	NA
AYU10466.1|37352_37571_-	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AYU10467.1|37581_37797_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
AYU10468.1|37939_38185_+	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
AYU10469.1|39621_40812_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
AYU10470.1|40821_41139_-	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
AYU10471.1|41223_41505_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
AYU10472.1|41678_41882_+	hypothetical protein	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
AYU10473.1|41942_42230_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
AYU10474.1|42226_42535_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
AYU10475.1|42546_43089_-	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
AYU10476.1|43085_43727_-	hypothetical protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
AYU10477.1|43818_44190_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
AYU10478.1|44300_44474_-	hypothetical protein	NA	J9Q801	Salmonella_phage	98.2	9.5e-26
AYU10479.1|44470_45160_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
AYU10480.1|45218_46922_-	putative DNA modification methylase	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
AYU10481.1|47045_47618_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AYU10482.1|47726_48569_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AYU10483.1|48677_48866_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AYU10484.1|48875_49370_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
AYU10485.1|49512_50121_-	putative ribonuclease H	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AYU10486.1|50706_50937_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AYU10487.1|51139_51733_-	hypothetical protein	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
AYU10488.1|51918_52845_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.1e-107
AYU10489.1|52889_53447_-	hypothetical protein	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AYU10490.1|53456_53876_-	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
AYU10491.1|53939_54584_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AYU10492.1|54583_55060_-	hypothetical protein	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AYU10493.1|55056_55470_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AYU10494.1|55471_56587_-	putative thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
AYU10495.1|56702_57632_-	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
AYU10496.1|57714_58857_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
AYU10497.1|58964_61280_-	ribonucleotide-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AYU10498.1|61357_61927_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
AYU10499.1|61939_62686_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
AYU10500.1|62675_64592_-	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AYU10501.1|64588_64825_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AYU10502.1|64821_65907_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
AYU10503.1|66333_66639_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.0	2.0e-50
AYU10504.1|66670_67165_-	hypothetical protein	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
AYU10505.1|67240_67885_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
AYU10506.1|68629_69685_+	putative replication protein A	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
AYU10507.1|70213_70417_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
AYU10508.1|70416_70722_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
AYU10509.1|70762_71038_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
AYU10510.1|71106_71517_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
AYU10511.1|71500_71872_-	hypothetical protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
AYU10512.1|72034_72877_-	putative lipoprotein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
AYU10513.1|73172_74249_-	putative recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AYU10514.1|74251_74518_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYU10515.1|74517_75462_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
AYU10516.1|75522_76551_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
AYU10517.1|76670_77102_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
AYU10518.1|77347_77938_+	hypothetical protein	NA	NA	NA	NA	NA
AYU10519.1|78031_78475_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.0e-71
AYU10520.1|78471_81990_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
AYU10521.1|82170_83406_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
AYU10522.1|83502_85860_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	90.7	0.0e+00
>prophage 2
CP029859	Salmonella enterica subsp. enterica serovar Typhi strain 343077_285138 plasmid pHCM2, complete sequence	106706	94350	106637	106706		Salmonella_phage(86.67%)	15	NA	NA
AYU10535.1|94350_94656_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
AYU10536.1|94652_94805_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
AYU10537.1|94804_95011_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
AYU10538.1|95176_96499_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
AYU10539.1|96533_96791_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
AYU10540.1|97091_97886_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
AYU10541.1|98069_99122_+	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
AYU10542.1|99123_100335_-	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
AYU10543.1|100397_101738_-	putative DNA helicase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
AYU10544.1|101798_102524_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
AYU10545.1|102801_103857_+	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
AYU10546.1|103926_104682_-	hypothetical protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
AYU10547.1|104730_105090_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AYU10548.1|105089_105755_-	hypothetical protein	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
AYU10549.1|106085_106637_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
