The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029925	Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 chromosome, complete genome	4786711	930254	937566	4786711	integrase,protease	Dickeya_phage(16.67%)	6	931505:931519	942684:942698
AYS20132.1|930254_931373_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS20133.1|931369_933316_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931505:931519	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS20134.1|933445_933667_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS20135.1|933990_934311_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS20136.1|934341_936618_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS20137.1|937188_937566_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942684:942698	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029925	Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 chromosome, complete genome	4786711	1008509	1085821	4786711	protease,transposase,terminase,integrase,tail	Salmonella_phage(73.33%)	93	990575:990594	1061182:1061201
990575:990594	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS20187.1|1008509_1009850_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS20188.1|1009846_1010095_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS20189.1|1010135_1010381_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS20190.1|1010380_1011262_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS20191.1|1011258_1012323_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS20192.1|1012400_1013081_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS20193.1|1013077_1013863_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS20194.1|1013868_1014165_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS20195.1|1014255_1014456_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS20196.1|1014744_1015149_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS20197.1|1015480_1015855_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS20198.1|1015939_1016923_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS20199.1|1016925_1017675_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS20200.1|1017685_1018033_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYS20201.1|1018029_1018554_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS20202.1|1018553_1019027_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS20203.1|1019030_1019603_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS20204.1|1019696_1019963_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS20205.1|1020044_1020206_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS20206.1|1020638_1021136_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS20207.1|1021320_1021560_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS20208.1|1021549_1021855_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS20209.1|1021894_1022497_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS20210.1|1022705_1023317_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS20211.1|1023449_1024247_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS20212.1|1024645_1024771_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS20213.1|1024906_1025356_-	lipoprotein	NA	NA	NA	NA	NA
AYS20214.1|1025572_1025962_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS20215.1|1025948_1026230_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS20216.1|1026229_1026844_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS20217.1|1027062_1027317_+	hypothetical protein	NA	NA	NA	NA	NA
AYS20218.1|1027421_1027799_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS20219.1|1027862_1028123_+	hypothetical protein	NA	NA	NA	NA	NA
AYS20220.1|1028212_1028965_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS20221.1|1028930_1030334_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS20222.1|1030333_1031803_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS20223.1|1031894_1032425_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS20224.1|1032439_1033672_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS20225.1|1033676_1034174_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS20226.1|1034185_1035127_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS20227.1|1035168_1035537_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS20228.1|1035502_1035910_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS20229.1|1035906_1036461_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS20230.1|1036447_1036837_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS20231.1|1036811_1037375_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS20232.1|1037378_1038524_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS20233.1|1038535_1038976_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS20234.1|1038979_1039432_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS20235.1|1039609_1041562_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS20236.1|1041561_1042212_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS20237.1|1042215_1042518_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS20238.1|1042520_1043552_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS20239.1|1043548_1043884_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS20240.1|1044078_1044810_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS20241.1|1044809_1045238_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS20242.1|1045296_1046052_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS20243.1|1046139_1046277_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS20244.1|1046292_1046646_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS20245.1|1046646_1047846_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS20246.1|1047842_1048523_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS20247.1|1048522_1050034_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS20248.1|1050048_1050567_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS20249.1|1051488_1052190_-	hypothetical protein	NA	NA	NA	NA	NA
AYS20250.1|1052502_1052781_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS20251.1|1053206_1055819_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS20252.1|1056026_1057037_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS20253.1|1057199_1057745_+	hypothetical protein	NA	NA	NA	NA	NA
AYS20254.1|1057741_1058851_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS20255.1|1058949_1061058_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS20256.1|1061070_1062978_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061182:1061201	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS20257.1|1062992_1064246_+	inner membrane protein	NA	NA	NA	NA	NA
AYS20258.1|1064250_1065891_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS20259.1|1065887_1066451_+	lipoprotein	NA	NA	NA	NA	NA
AYS20260.1|1066704_1066872_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS20261.1|1066971_1067490_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS20262.1|1067558_1069319_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS20263.1|1069504_1069957_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS20264.1|1070028_1071081_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS20265.1|1071435_1071945_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS20266.1|1072161_1072767_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS20267.1|1072753_1074907_-	inner membrane protein	NA	NA	NA	NA	NA
AYS20268.1|1074925_1075372_-	hypothetical protein	NA	NA	NA	NA	NA
AYS20269.1|1075495_1077550_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS20270.1|1077585_1078044_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS20271.1|1078138_1078801_-	hypothetical protein	NA	NA	NA	NA	NA
AYS20272.1|1078971_1079388_+	hypothetical protein	NA	NA	NA	NA	NA
AYS20273.1|1079432_1079750_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS20274.1|1079807_1081019_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS20275.1|1082150_1082609_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS20276.1|1083345_1083627_+	acylphosphatase	NA	NA	NA	NA	NA
AYS20277.1|1083623_1083953_-	sulfite reductase	NA	NA	NA	NA	NA
AYS20278.1|1084039_1084699_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS20279.1|1085362_1085821_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029925	Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 chromosome, complete genome	4786711	1529977	1570623	4786711	protease,plate,transposase,tail,head	Burkholderia_virus(50.0%)	52	NA	NA
AYS20680.1|1529977_1530436_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS20681.1|1530938_1531220_+	stress response protein	NA	NA	NA	NA	NA
AYS20682.1|1531488_1532310_+|protease	serine protease	protease	NA	NA	NA	NA
AYS20683.1|1532344_1532674_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS20684.1|1532660_1533023_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS20685.1|1533134_1533305_-	hypothetical protein	NA	NA	NA	NA	NA
AYS20686.1|1533439_1534474_+	hypothetical protein	NA	NA	NA	NA	NA
AYS20687.1|1534648_1536037_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS20688.1|1536047_1537577_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS20689.1|1538103_1539048_+	hypothetical protein	NA	NA	NA	NA	NA
AYS20690.1|1539229_1539619_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS20691.1|1539590_1540043_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS20692.1|1540237_1540468_-	hypothetical protein	NA	NA	NA	NA	NA
AYS20693.1|1540464_1541148_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS20694.1|1541144_1541360_-	hypothetical protein	NA	NA	NA	NA	NA
AYS20695.1|1541352_1541736_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYS20696.1|1541732_1542035_-	hypothetical protein	NA	NA	NA	NA	NA
AYS20697.1|1542044_1542317_-	hypothetical protein	NA	NA	NA	NA	NA
AYS20698.1|1542605_1543136_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS20699.1|1543163_1543433_-	hypothetical protein	NA	NA	NA	NA	NA
AYS20700.1|1543435_1544602_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS20701.1|1544612_1546382_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS20702.1|1546559_1546991_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYS20703.1|1546986_1547583_+	hypothetical protein	NA	NA	NA	NA	NA
AYS20704.1|1547826_1548177_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS20705.1|1548891_1549542_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS20706.1|1549538_1549865_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYS20707.1|1549864_1550176_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS20708.1|1550175_1550721_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS20709.1|1550717_1552313_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS20710.1|1552312_1553809_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS20711.1|1553789_1554611_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS20712.1|1554613_1555072_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS20713.1|1555286_1556402_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS20714.1|1556416_1557370_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS20715.1|1557379_1557718_+	hypothetical protein	NA	NA	NA	NA	NA
AYS20716.1|1557719_1558166_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS20717.1|1558165_1558630_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS20718.1|1558626_1558881_+	hypothetical protein	NA	NA	NA	NA	NA
AYS20719.1|1558870_1560298_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS20720.1|1560297_1560819_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS20721.1|1560821_1561103_+	hypothetical protein	NA	NA	NA	NA	NA
AYS20722.1|1561200_1561536_+	hypothetical protein	NA	NA	NA	NA	NA
AYS20723.1|1561711_1564177_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS20724.1|1564176_1565061_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS20725.1|1565057_1565273_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS20726.1|1565260_1566415_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS20727.1|1566411_1566939_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS20728.1|1566995_1567343_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS20729.1|1567333_1568437_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS20730.1|1568429_1569008_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS20731.1|1570005_1570623_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
>prophage 4
CP029925	Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 chromosome, complete genome	4786711	1784068	1788480	4786711		Escherichia_phage(50.0%)	6	NA	NA
AYS20942.1|1784068_1784308_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYS20943.1|1785180_1785990_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS20944.1|1786062_1786440_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS20945.1|1786587_1787130_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS20946.1|1787321_1788050_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS20947.1|1788066_1788480_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029925	Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 chromosome, complete genome	4786711	1992333	1999567	4786711		Morganella_phage(33.33%)	7	NA	NA
AYS21137.1|1992333_1993764_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYS21138.1|1993837_1994533_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYS21139.1|1994612_1994924_-	hypothetical protein	NA	NA	NA	NA	NA
AYS21140.1|1995574_1996759_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYS21141.1|1997218_1997431_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYS21142.1|1997876_1999145_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYS21143.1|1999147_1999567_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029925	Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 chromosome, complete genome	4786711	2105868	2116375	4786711		Enterobacteria_phage(37.5%)	10	NA	NA
AYS21240.1|2105868_2107182_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS21241.1|2107208_2108288_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS21242.1|2108292_2109066_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS21243.1|2109081_2110056_-	reductase RfbI	NA	NA	NA	NA	NA
AYS21244.1|2110061_2110613_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS21245.1|2110613_2111492_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS21246.1|2111539_2112439_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS21247.1|2112438_2113524_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS21248.1|2113900_2114794_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS21249.1|2114971_2116375_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029925	Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 chromosome, complete genome	4786711	2193604	2202775	4786711	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS21309.1|2193604_2195638_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS21310.1|2195878_2196337_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS21311.1|2196508_2197039_+	lipoprotein	NA	NA	NA	NA	NA
AYS21312.1|2197095_2197563_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS21313.1|2197609_2198329_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS21314.1|2198325_2200011_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS21315.1|2200233_2200965_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS21316.1|2201024_2201132_+	hypothetical protein	NA	NA	NA	NA	NA
AYS21317.1|2201112_2201844_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS21318.1|2201827_2202775_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029925	Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 chromosome, complete genome	4786711	2739630	2753022	4786711	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS21748.1|2739630_2739849_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS21749.1|2739939_2741040_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS21750.1|2741036_2741522_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS21751.1|2741518_2744596_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS21752.1|2744588_2744708_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS21753.1|2744722_2745025_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS21754.1|2745079_2745595_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS21755.1|2745604_2746777_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS21756.1|2746919_2747492_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS21757.1|2748169_2749285_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS21758.1|2749365_2753022_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029925	Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 chromosome, complete genome	4786711	3070183	3113886	4786711	bacteriocin,protease,transposase,tRNA	Bacillus_virus(33.33%)	44	NA	NA
AYS22046.1|3070183_3070642_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS22047.1|3070831_3071911_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS22048.1|3072012_3073176_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS22049.1|3073197_3074244_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS22050.1|3074617_3075043_+	hypothetical protein	NA	NA	NA	NA	NA
AYS22051.1|3075068_3075647_+	hypothetical protein	NA	NA	NA	NA	NA
AYS22052.1|3075680_3076355_+	hypothetical protein	NA	NA	NA	NA	NA
AYS22053.1|3076336_3077020_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS22054.1|3077013_3077670_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS22055.1|3077774_3078233_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS22056.1|3078421_3080413_-	transketolase	NA	NA	NA	NA	NA
AYS22057.1|3080688_3081447_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS22058.1|3081547_3082468_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS22059.1|3082695_3084672_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS22060.1|3084680_3084812_-	hypothetical protein	NA	NA	NA	NA	NA
AYS22061.1|3085106_3085406_-	membrane protein	NA	NA	NA	NA	NA
AYS22062.1|3085461_3086616_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS22063.1|3087108_3088503_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS22064.1|3088581_3089079_+	hypothetical protein	NA	NA	NA	NA	NA
AYS22065.1|3089174_3089882_+	endonuclease I	NA	NA	NA	NA	NA
AYS22066.1|3089958_3090690_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS22067.1|3090709_3091657_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS22068.1|3091872_3092436_+	hypothetical protein	NA	NA	NA	NA	NA
AYS22069.1|3092435_3092852_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS22070.1|3092898_3093585_-	global regulatory protein	NA	NA	NA	NA	NA
AYS22071.1|3093714_3094695_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS22072.1|3094712_3095417_+	hypothetical protein	NA	NA	NA	NA	NA
AYS22073.1|3095435_3096002_+	hypothetical protein	NA	NA	NA	NA	NA
AYS22074.1|3095998_3096289_+	hypothetical protein	NA	NA	NA	NA	NA
AYS22075.1|3096296_3096890_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS22076.1|3096882_3098019_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS22077.1|3098109_3099117_-	hypothetical protein	NA	NA	NA	NA	NA
AYS22078.1|3099249_3100296_-	L-asparaginase	NA	NA	NA	NA	NA
AYS22079.1|3100614_3101073_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS22080.1|3101195_3101915_-	hypothetical protein	NA	NA	NA	NA	NA
AYS22081.1|3101964_3102291_-	hypothetical protein	NA	NA	NA	NA	NA
AYS22082.1|3102290_3103010_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS22083.1|3103164_3104217_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS22084.1|3104244_3104520_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS22085.1|3104632_3105718_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS22086.1|3105934_3107191_+	nucleoside permease	NA	NA	NA	NA	NA
AYS22087.1|3109801_3110509_+	hypothetical protein	NA	NA	NA	NA	NA
AYS22088.1|3113098_3113365_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS22089.1|3113607_3113886_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029925	Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 chromosome, complete genome	4786711	3491205	3529263	4786711	plate,transposase,terminase,capsid,integrase,tail,portal	Salmonella_phage(82.05%)	46	3486169:3486183	3498335:3498349
3486169:3486183	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS22417.1|3491205_3492852_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS22418.1|3492991_3493090_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS22419.1|3493345_3493675_+	hypothetical protein	NA	NA	NA	NA	NA
AYS22420.1|3493715_3494768_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS22421.1|3495163_3495733_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS22422.1|3495858_3496080_+	hypothetical protein	NA	NA	NA	NA	NA
AYS22423.1|3496112_3496622_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS22424.1|3496796_3497021_+	hypothetical protein	NA	NA	NA	NA	NA
AYS22425.1|3497043_3497385_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS22426.1|3497452_3497686_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS22427.1|3497685_3497913_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS22428.1|3497909_3498767_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3498335:3498349	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS22429.1|3498763_3501178_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS22430.1|3501331_3501520_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS22431.1|3503487_3504402_+	hypothetical protein	NA	NA	NA	NA	NA
AYS22432.1|3504398_3505139_+	hypothetical protein	NA	NA	NA	NA	NA
AYS22433.1|3505173_3506211_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS22434.1|3506210_3507977_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS22435.1|3508119_3508953_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS22436.1|3508969_3510028_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS22437.1|3510031_3510682_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS22438.1|3510714_3511242_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS22439.1|3511241_3511445_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS22440.1|3511448_3511664_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS22441.1|3511683_3512157_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS22442.1|3512158_3512536_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS22443.1|3512532_3512961_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS22444.1|3513056_3513488_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS22445.1|3513480_3513927_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS22446.1|3513995_3514574_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS22447.1|3514570_3514930_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS22448.1|3514916_3515825_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS22449.1|3515817_3516423_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS22450.1|3516419_3517934_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYS22451.1|3517933_3518527_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS22452.1|3518498_3518939_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS22453.1|3519361_3519934_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS22454.1|3520076_3521249_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS22455.1|3521258_3521774_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS22456.1|3521828_3522131_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS22457.1|3522145_3522265_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS22458.1|3522257_3525335_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYS22459.1|3525331_3525817_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS22460.1|3525813_3526914_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS22461.1|3527004_3527223_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS22462.1|3528804_3529263_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029925	Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 chromosome, complete genome	4786711	4445119	4519283	4786711	plate,terminase,capsid,integrase,tail,portal	Salmonella_phage(82.98%)	76	4506620:4506636	4519442:4519458
AYS23233.1|4445119_4447069_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS23234.1|4447140_4448049_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23235.1|4448122_4449022_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23236.1|4449063_4449423_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23237.1|4449522_4449792_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23238.1|4449923_4451198_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS23239.1|4451417_4451795_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23240.1|4451881_4452100_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS23241.1|4452167_4453268_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS23242.1|4453264_4453750_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS23243.1|4453749_4456530_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS23244.1|4456522_4456642_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS23245.1|4456656_4456959_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS23246.1|4457013_4457529_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS23247.1|4457538_4458711_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS23248.1|4459245_4459968_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS23249.1|4460165_4460573_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS23250.1|4460579_4462199_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS23251.1|4462195_4462801_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS23252.1|4462793_4463702_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYS23253.1|4463688_4464048_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS23254.1|4464044_4464623_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS23255.1|4464691_4465138_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS23256.1|4465130_4465562_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYS23257.1|4465657_4466083_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS23258.1|4466082_4466460_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS23259.1|4466464_4466935_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS23260.1|4466954_4467170_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS23261.1|4467173_4467377_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS23262.1|4467376_4467841_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS23263.1|4467934_4468585_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS23264.1|4468588_4469653_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS23265.1|4469669_4470503_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS23266.1|4470645_4472412_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS23267.1|4472408_4473455_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS23268.1|4473503_4474199_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23269.1|4474218_4475283_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23270.1|4475279_4476344_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23271.1|4477268_4477598_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYS23272.1|4477594_4479664_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYS23273.1|4479654_4480515_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS23274.1|4480511_4481096_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS23275.1|4481092_4481320_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS23276.1|4481319_4481553_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS23277.1|4481620_4481962_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS23278.1|4481925_4482126_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS23279.1|4482133_4482643_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS23280.1|4482675_4482918_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS23281.1|4483034_4483667_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS23282.1|4483670_4484696_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS23283.1|4484802_4485156_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS23284.1|4485772_4486060_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23285.1|4486070_4486961_+	methyltransferase	NA	NA	NA	NA	NA
AYS23286.1|4486960_4487707_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23287.1|4488008_4489979_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS23288.1|4489998_4491303_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS23289.1|4491325_4492021_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS23290.1|4492046_4492841_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS23291.1|4492850_4493918_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS23292.1|4493962_4495699_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS23293.1|4495698_4498194_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS23294.1|4498217_4499264_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS23295.1|4499266_4500544_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS23296.1|4500788_4501328_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS23297.1|4502181_4503693_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS23298.1|4503676_4505266_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23299.1|4505429_4506443_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4506620:4506636	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS23300.1|4506869_4507163_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23301.1|4507159_4507648_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23302.1|4507827_4508280_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23303.1|4513502_4513964_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23304.1|4513960_4514182_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS23305.1|4515038_4515821_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23306.1|4516447_4516672_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23307.1|4516801_4517713_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23308.1|4518023_4519283_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4519442:4519458	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029925	Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 chromosome, complete genome	4786711	4661535	4671794	4786711	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYS23445.1|4661535_4662612_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS23446.1|4662608_4663682_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS23447.1|4663656_4664820_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23448.1|4665095_4665662_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS23449.1|4665677_4665917_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS23450.1|4665920_4666781_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS23451.1|4667203_4667527_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS23452.1|4667510_4668011_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYS23453.1|4668007_4668235_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23454.1|4668231_4668552_+	P4 phage protein	NA	NA	NA	NA	NA
AYS23455.1|4668566_4669241_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYS23456.1|4669237_4670899_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYS23457.1|4671635_4671794_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029926	Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence	217120	24260	76713	217120	transposase,integrase	Escherichia_phage(50.0%)	63	49164:49178	73664:73678
AYS23569.1|24260_24764_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS23570.1|24682_24958_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS23571.1|24999_26856_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYS23572.1|27253_28129_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23573.1|28187_28565_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23574.1|28625_29612_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23575.1|29671_30724_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23576.1|30762_31032_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23577.1|31102_32230_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23578.1|32307_34320_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23579.1|34391_34613_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23580.1|34727_35960_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYS23581.1|36234_36759_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23582.1|36749_37715_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23583.1|37785_38721_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23584.1|38798_39719_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23585.1|39791_40727_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23586.1|40903_41860_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23587.1|42272_42542_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23588.1|42596_43187_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23589.1|43194_43452_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23590.1|43525_44062_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23591.1|44078_44534_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23592.1|44517_44745_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23593.1|44793_45048_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23594.1|45115_46075_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23595.1|46085_46994_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23596.1|47298_48480_-	recombinase	NA	NA	NA	NA	NA
AYS23597.1|48694_48907_+	regulatory protein	NA	NA	NA	NA	NA
49164:49178	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYS23598.1|49213_49489_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	7.7e-46
49164:49178	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYS23599.1|49407_49911_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS23600.1|50017_50452_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYS23601.1|50469_50874_+	MerT	NA	NA	NA	NA	NA
AYS23602.1|50887_51163_+	mercuric transport protein	NA	NA	NA	NA	NA
AYS23603.1|51198_51621_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYS23604.1|51672_53367_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYS23605.1|53384_53747_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYS23606.1|53743_53980_+	mercury resistance protein	NA	NA	NA	NA	NA
AYS23607.1|53976_54684_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23608.1|54722_56027_+|integrase	integrase	integrase	NA	NA	NA	NA
AYS23609.1|56055_56778_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS23610.1|57533_58385_+	replication protein	NA	NA	NA	NA	NA
AYS23611.1|58692_59508_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYS23612.1|59568_60372_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS23613.1|60371_61208_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYS23614.1|61268_61991_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS23615.1|62570_63431_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
63025:63039	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYS23616.1|63613_63880_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
63025:63039	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYS23617.1|63912_64635_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYS23618.1|64868_65795_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYS23619.1|65701_66082_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYS23620.1|66278_66878_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYS23621.1|66909_67923_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYS23622.1|67912_68476_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYS23623.1|68601_69162_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYS23624.1|69164_72131_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYS23625.1|72197_72575_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23626.1|72775_73435_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYS23627.1|73713_73989_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS23628.1|73907_74411_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	1.1e-93
AYS23629.1|74992_75748_+	replication protein	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
AYS23630.1|76015_76291_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS23631.1|76209_76713_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	92.8	1.4e-88
>prophage 2
CP029926	Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence	217120	162823	216341	217120	holin,transposase	Escherichia_phage(43.75%)	56	NA	NA
AYS23721.1|162823_163099_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYS23722.1|163017_163521_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	6.3e-94
AYS23723.1|163847_164072_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23724.1|164727_164988_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23725.1|165076_165568_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23726.1|165572_165881_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23727.1|166088_166469_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23728.1|166554_166803_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23729.1|166840_167062_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYS23730.1|167224_167608_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23731.1|167922_168147_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23732.1|168233_168698_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23733.1|168880_171310_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23734.1|171432_171879_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23735.1|171926_172733_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23736.1|172960_173203_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23737.1|173280_173613_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23738.1|174112_175294_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23739.1|175302_175599_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYS23740.1|175662_176130_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23741.1|176989_177766_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23742.1|177915_178692_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23743.1|178880_179222_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23744.1|179322_179586_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYS23745.1|179819_180518_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYS23746.1|180672_180969_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23747.1|181056_183441_-	periplasmic protein	NA	NA	NA	NA	NA
AYS23748.1|183691_184300_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23749.1|184412_184709_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23750.1|184713_185310_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23751.1|185701_186583_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYS23752.1|187168_187684_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23753.1|188334_190791_-	periplasmic protein	NA	NA	NA	NA	NA
AYS23754.1|191427_193182_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYS23755.1|193367_194525_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYS23756.1|194884_195709_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYS23757.1|195723_196545_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23758.1|196827_197535_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23759.1|197749_198826_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYS23760.1|199360_200236_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYS23761.1|200489_201071_-	hypothetical protein	NA	NA	NA	NA	NA
AYS23762.1|201677_202031_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23763.1|202082_202400_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23764.1|202399_203197_+	pilus assembly protein	NA	NA	NA	NA	NA
AYS23765.1|203199_204432_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23766.1|204433_204874_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23767.1|204851_206222_+	TrhB	NA	NA	NA	NA	NA
AYS23768.1|206230_206743_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23769.1|206743_207601_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYS23770.1|207610_208561_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23771.1|208569_211251_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23772.1|211884_212160_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYS23773.1|212288_214292_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYS23774.1|214354_215650_+	hypothetical protein	NA	NA	NA	NA	NA
AYS23775.1|215643_216147_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYS23776.1|216065_216341_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
