The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029958	Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 chromosome, complete genome	4783542	930136	937448	4783542	protease,integrase	Dickeya_phage(16.67%)	6	931387:931401	942566:942580
AYR37238.1|930136_931255_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYR37239.1|931251_933198_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931387:931401	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYR37240.1|933327_933549_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYR37241.1|933872_934193_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYR37242.1|934223_936500_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYR37243.1|937070_937448_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942566:942580	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029958	Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 chromosome, complete genome	4783542	1008391	1085703	4783542	protease,integrase,tail,terminase,transposase	Salmonella_phage(73.33%)	93	990457:990476	1061064:1061083
990457:990476	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR37293.1|1008391_1009732_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYR37294.1|1009728_1009977_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYR37295.1|1010017_1010263_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYR37296.1|1010262_1011144_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYR37297.1|1011140_1012205_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYR37298.1|1012282_1012963_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYR37299.1|1012959_1013745_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYR37300.1|1013750_1014047_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYR37301.1|1014137_1014338_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYR37302.1|1014626_1015031_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYR37303.1|1015362_1015737_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYR37304.1|1015821_1016805_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYR37305.1|1016807_1017557_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYR37306.1|1017567_1017915_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYR37307.1|1017911_1018436_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYR37308.1|1018435_1018909_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYR37309.1|1018912_1019485_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYR37310.1|1019578_1019845_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYR37311.1|1019926_1020088_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR37312.1|1020520_1021018_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR37313.1|1021202_1021442_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYR37314.1|1021431_1021737_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYR37315.1|1021776_1022379_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYR37316.1|1022587_1023199_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYR37317.1|1023331_1024129_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYR37318.1|1024527_1024653_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR37319.1|1024788_1025238_-	lipoprotein	NA	NA	NA	NA	NA
AYR37320.1|1025454_1025844_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYR37321.1|1025830_1026112_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYR37322.1|1026111_1026726_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYR37323.1|1026944_1027199_+	hypothetical protein	NA	NA	NA	NA	NA
AYR37324.1|1027303_1027681_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYR37325.1|1027744_1028005_+	hypothetical protein	NA	NA	NA	NA	NA
AYR37326.1|1028094_1028847_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYR37327.1|1028812_1030216_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYR37328.1|1030215_1031685_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYR37329.1|1031776_1032307_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYR37330.1|1032321_1033554_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYR37331.1|1033558_1034056_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYR37332.1|1034067_1035009_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYR37333.1|1035050_1035419_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYR37334.1|1035384_1035792_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYR37335.1|1035788_1036343_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYR37336.1|1036329_1036719_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYR37337.1|1036693_1037257_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYR37338.1|1037260_1038406_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYR37339.1|1038417_1038858_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYR37340.1|1038861_1039314_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYR37341.1|1039491_1041444_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYR37342.1|1041443_1042094_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYR37343.1|1042097_1042400_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYR37344.1|1042402_1043434_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYR37345.1|1043430_1043766_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYR37346.1|1043960_1044692_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR37347.1|1044691_1045120_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR37348.1|1045178_1045934_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYR37349.1|1046021_1046159_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYR37350.1|1046174_1046528_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYR37351.1|1046528_1047728_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYR37352.1|1047724_1048405_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYR37353.1|1048404_1049916_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYR37354.1|1049930_1050449_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYR37355.1|1051370_1052072_-	hypothetical protein	NA	NA	NA	NA	NA
AYR37356.1|1052384_1052663_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYR37357.1|1053088_1055701_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYR37358.1|1055908_1056919_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYR37359.1|1057081_1057627_+	hypothetical protein	NA	NA	NA	NA	NA
AYR37360.1|1057623_1058733_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYR37361.1|1058831_1060940_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYR37362.1|1060952_1062860_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061064:1061083	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR37363.1|1062874_1064128_+	inner membrane protein	NA	NA	NA	NA	NA
AYR37364.1|1064132_1065773_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYR37365.1|1065769_1066333_+	lipoprotein	NA	NA	NA	NA	NA
AYR37366.1|1066586_1066754_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYR37367.1|1066853_1067372_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYR37368.1|1067440_1069201_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYR37369.1|1069386_1069839_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYR37370.1|1069910_1070963_-	outer membrane protein A	NA	NA	NA	NA	NA
AYR37371.1|1071317_1071827_-	cell division inhibitor	NA	NA	NA	NA	NA
AYR37372.1|1072043_1072649_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYR37373.1|1072635_1074789_-	inner membrane protein	NA	NA	NA	NA	NA
AYR37374.1|1074807_1075254_-	hypothetical protein	NA	NA	NA	NA	NA
AYR37375.1|1075377_1077432_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYR37376.1|1077467_1077926_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYR37377.1|1078020_1078683_-	hypothetical protein	NA	NA	NA	NA	NA
AYR37378.1|1078853_1079270_+	hypothetical protein	NA	NA	NA	NA	NA
AYR37379.1|1079314_1079632_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYR37380.1|1079689_1080901_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYR37381.1|1082032_1082491_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR37382.1|1083227_1083509_+	acylphosphatase	NA	NA	NA	NA	NA
AYR37383.1|1083505_1083835_-	sulfite reductase	NA	NA	NA	NA	NA
AYR37384.1|1083921_1084581_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYR37385.1|1085244_1085703_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029958	Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 chromosome, complete genome	4783542	1528521	1602119	4783542	protease,plate,head,tRNA,tail,transposase	Burkholderia_virus(44.12%)	72	NA	NA
AYR37785.1|1528521_1528980_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR37786.1|1529482_1529764_+	stress response protein	NA	NA	NA	NA	NA
AYR37787.1|1530032_1530854_+|protease	serine protease	protease	NA	NA	NA	NA
AYR37788.1|1530888_1531218_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYR37789.1|1531204_1531567_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYR37790.1|1531678_1531849_-	hypothetical protein	NA	NA	NA	NA	NA
AYR37791.1|1531983_1533018_+	hypothetical protein	NA	NA	NA	NA	NA
AYR37792.1|1533192_1534581_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYR37793.1|1534591_1536121_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYR37794.1|1536647_1537592_+	hypothetical protein	NA	NA	NA	NA	NA
AYR37795.1|1537773_1538163_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYR37796.1|1538134_1538587_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYR37797.1|1538781_1539012_-	hypothetical protein	NA	NA	NA	NA	NA
AYR37798.1|1539008_1539692_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYR37799.1|1540276_1540579_-	hypothetical protein	NA	NA	NA	NA	NA
AYR37800.1|1541149_1541680_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYR37801.1|1541979_1543146_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYR37802.1|1543156_1544926_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYR37803.1|1546370_1546721_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYR37804.1|1547435_1548086_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYR37805.1|1548408_1548720_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYR37806.1|1548719_1549265_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYR37807.1|1549261_1550857_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYR37808.1|1550856_1552353_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYR37809.1|1552333_1553155_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYR37810.1|1553157_1553616_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYR37811.1|1553830_1554946_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYR37812.1|1554960_1555914_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYR37813.1|1555923_1556262_+	hypothetical protein	NA	NA	NA	NA	NA
AYR37814.1|1556263_1556710_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYR37815.1|1556709_1557174_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYR37816.1|1557414_1558842_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYR37817.1|1558841_1559363_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYR37818.1|1559365_1559647_+	hypothetical protein	NA	NA	NA	NA	NA
AYR37819.1|1559744_1560080_+	hypothetical protein	NA	NA	NA	NA	NA
AYR37820.1|1560255_1562721_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYR37821.1|1562720_1563605_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYR37822.1|1563601_1563817_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYR37823.1|1563804_1564959_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYR37824.1|1564955_1565483_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYR37825.1|1565539_1565887_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYR37826.1|1565877_1566981_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYR37827.1|1566973_1567552_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYR37828.1|1567554_1568580_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYR37829.1|1569093_1569711_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYR37830.1|1571221_1571794_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYR37831.1|1572074_1573457_+	amino acid permease	NA	NA	NA	NA	NA
AYR37832.1|1573518_1573854_-	hypothetical protein	NA	NA	NA	NA	NA
AYR37833.1|1573980_1574712_+	two-component response regulator	NA	NA	NA	NA	NA
AYR37834.1|1575192_1576344_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYR37835.1|1576496_1578203_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYR37836.1|1578310_1579615_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYR37837.1|1579690_1580620_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYR37838.1|1580616_1582020_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYR37839.1|1582187_1583834_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYR37840.1|1584033_1585209_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYR37841.1|1585311_1586820_+	hypothetical protein	NA	NA	NA	NA	NA
AYR37842.1|1587525_1588527_+	adenosine deaminase	NA	NA	NA	NA	NA
AYR37843.1|1588600_1589716_-	oxidoreductase	NA	NA	NA	NA	NA
AYR37844.1|1589818_1589974_+	hypothetical protein	NA	NA	NA	NA	NA
AYR37845.1|1590272_1590488_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYR37846.1|1590576_1591017_+	hypothetical protein	NA	NA	NA	NA	NA
AYR37847.1|1591093_1591675_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYR37848.1|1591674_1592253_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYR37849.1|1592245_1594267_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYR37850.1|1594267_1595326_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYR37851.1|1595329_1595950_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYR37852.1|1595952_1596645_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYR37853.1|1596644_1597280_+	endonuclease III	NA	NA	NA	NA	NA
AYR37854.1|1597880_1599386_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYR37855.1|1599490_1600096_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYR37856.1|1600844_1602119_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029958	Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 chromosome, complete genome	4783542	1783156	1787568	4783542		Escherichia_phage(50.0%)	6	NA	NA
AYR38040.1|1783156_1783396_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYR38041.1|1784268_1785078_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYR38042.1|1785150_1785528_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYR38043.1|1785675_1786218_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYR38044.1|1786409_1787138_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYR38045.1|1787154_1787568_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029958	Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 chromosome, complete genome	4783542	1991421	1998655	4783542		Morganella_phage(33.33%)	7	NA	NA
AYR38235.1|1991421_1992852_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYR38236.1|1992925_1993621_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYR38237.1|1993700_1994012_-	hypothetical protein	NA	NA	NA	NA	NA
AYR38238.1|1994662_1995847_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYR38239.1|1996306_1996519_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYR38240.1|1996964_1998233_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYR38241.1|1998235_1998655_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029958	Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 chromosome, complete genome	4783542	2104956	2115463	4783542		Enterobacteria_phage(37.5%)	10	NA	NA
AYR38338.1|2104956_2106270_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYR38339.1|2106296_2107376_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYR38340.1|2107380_2108154_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYR38341.1|2108169_2109144_-	reductase RfbI	NA	NA	NA	NA	NA
AYR38342.1|2109149_2109701_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYR38343.1|2109701_2110580_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYR38344.1|2110627_2111527_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYR38345.1|2111526_2112612_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYR38346.1|2112988_2113882_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYR38347.1|2114059_2115463_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029958	Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 chromosome, complete genome	4783542	2192692	2201863	4783542	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYR38407.1|2192692_2194726_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYR38408.1|2194966_2195425_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYR38409.1|2195596_2196127_+	lipoprotein	NA	NA	NA	NA	NA
AYR38410.1|2196183_2196651_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYR38411.1|2196697_2197417_-	two-component system response regulator	NA	NA	NA	NA	NA
AYR38412.1|2197413_2199099_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYR38413.1|2199321_2200053_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYR38414.1|2200112_2200220_+	hypothetical protein	NA	NA	NA	NA	NA
AYR38415.1|2200200_2200932_-	ABC transporter permease	NA	NA	NA	NA	NA
AYR38416.1|2200915_2201863_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029958	Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 chromosome, complete genome	4783542	2737300	2750692	4783542	tail	Salmonella_phage(70.0%)	11	NA	NA
AYR38845.1|2737300_2737519_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYR38846.1|2737609_2738710_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYR38847.1|2738706_2739192_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYR38848.1|2739188_2742266_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYR38849.1|2742258_2742378_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYR38850.1|2742392_2742695_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYR38851.1|2742749_2743265_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYR38852.1|2743274_2744447_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYR38853.1|2744589_2745162_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYR38854.1|2745839_2746955_+	glycosyltransferase	NA	NA	NA	NA	NA
AYR38855.1|2747035_2750692_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029958	Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 chromosome, complete genome	4783542	3067853	3111556	4783542	protease,transposase,tRNA,bacteriocin	Bacillus_virus(33.33%)	44	NA	NA
AYR39143.1|3067853_3068312_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR39144.1|3068501_3069581_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYR39145.1|3069682_3070846_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYR39146.1|3070867_3071914_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYR39147.1|3072287_3072713_+	hypothetical protein	NA	NA	NA	NA	NA
AYR39148.1|3072738_3073317_+	hypothetical protein	NA	NA	NA	NA	NA
AYR39149.1|3073350_3074025_+	hypothetical protein	NA	NA	NA	NA	NA
AYR39150.1|3074006_3074690_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYR39151.1|3074683_3075340_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYR39152.1|3075444_3075903_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR39153.1|3076091_3078083_-	transketolase	NA	NA	NA	NA	NA
AYR39154.1|3078358_3079117_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYR39155.1|3079217_3080138_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYR39156.1|3080365_3082342_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYR39157.1|3082350_3082482_-	hypothetical protein	NA	NA	NA	NA	NA
AYR39158.1|3082776_3083076_-	membrane protein	NA	NA	NA	NA	NA
AYR39159.1|3083131_3084286_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYR39160.1|3084778_3086173_+	galactose-proton symport	NA	NA	NA	NA	NA
AYR39161.1|3086251_3086749_+	hypothetical protein	NA	NA	NA	NA	NA
AYR39162.1|3086844_3087552_+	endonuclease I	NA	NA	NA	NA	NA
AYR39163.1|3087628_3088360_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYR39164.1|3088379_3089327_+	glutathione synthetase	NA	NA	NA	NA	NA
AYR39165.1|3089542_3090106_+	hypothetical protein	NA	NA	NA	NA	NA
AYR39166.1|3090105_3090522_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYR39167.1|3090568_3091255_-	global regulatory protein	NA	NA	NA	NA	NA
AYR39168.1|3091384_3092365_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYR39169.1|3092382_3093087_+	hypothetical protein	NA	NA	NA	NA	NA
AYR39170.1|3093105_3093672_+	hypothetical protein	NA	NA	NA	NA	NA
AYR39171.1|3093668_3093959_+	hypothetical protein	NA	NA	NA	NA	NA
AYR39172.1|3093966_3094560_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYR39173.1|3094552_3095689_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYR39174.1|3095779_3096787_-	hypothetical protein	NA	NA	NA	NA	NA
AYR39175.1|3096919_3097966_-	L-asparaginase	NA	NA	NA	NA	NA
AYR39176.1|3098284_3098743_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR39177.1|3098865_3099585_-	hypothetical protein	NA	NA	NA	NA	NA
AYR39178.1|3099634_3099961_-	hypothetical protein	NA	NA	NA	NA	NA
AYR39179.1|3099960_3100680_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYR39180.1|3100834_3101887_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYR39181.1|3101914_3102190_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYR39182.1|3102302_3103388_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYR39183.1|3103604_3104861_+	nucleoside permease	NA	NA	NA	NA	NA
AYR39184.1|3107471_3108179_+	hypothetical protein	NA	NA	NA	NA	NA
AYR39185.1|3110768_3111035_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYR39186.1|3111277_3111556_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029958	Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 chromosome, complete genome	4783542	3489256	3527314	4783542	integrase,plate,portal,tail,capsid,terminase,transposase	Salmonella_phage(82.05%)	46	3484220:3484234	3496386:3496400
3484220:3484234	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYR39514.1|3489256_3490903_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYR39515.1|3491042_3491141_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYR39516.1|3491396_3491726_+	hypothetical protein	NA	NA	NA	NA	NA
AYR39517.1|3491766_3492819_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYR39518.1|3493214_3493784_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYR39519.1|3493909_3494131_+	hypothetical protein	NA	NA	NA	NA	NA
AYR39520.1|3494163_3494673_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYR39521.1|3494847_3495072_+	hypothetical protein	NA	NA	NA	NA	NA
AYR39522.1|3495094_3495436_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYR39523.1|3495503_3495737_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYR39524.1|3495736_3495964_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYR39525.1|3495960_3496818_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3496386:3496400	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYR39526.1|3496814_3499229_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYR39527.1|3499382_3499571_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYR39528.1|3501538_3502453_+	hypothetical protein	NA	NA	NA	NA	NA
AYR39529.1|3502449_3503190_+	hypothetical protein	NA	NA	NA	NA	NA
AYR39530.1|3503224_3504262_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYR39531.1|3504261_3506028_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYR39532.1|3506170_3507004_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYR39533.1|3507020_3508079_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYR39534.1|3508082_3508733_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYR39535.1|3508765_3509293_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYR39536.1|3509292_3509496_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYR39537.1|3509499_3509715_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYR39538.1|3509734_3510208_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYR39539.1|3510209_3510587_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYR39540.1|3510583_3511012_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYR39541.1|3511107_3511539_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYR39542.1|3511531_3511978_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYR39543.1|3512046_3512625_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYR39544.1|3512621_3512981_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYR39545.1|3512967_3513876_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYR39546.1|3513868_3514474_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYR39547.1|3514470_3515985_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYR39548.1|3515984_3516578_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYR39549.1|3516549_3516990_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYR39550.1|3517412_3517985_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYR39551.1|3518127_3519300_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYR39552.1|3519309_3519825_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYR39553.1|3519879_3520182_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYR39554.1|3520196_3520316_+	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYR39555.1|3520308_3523386_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYR39556.1|3523382_3523868_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYR39557.1|3523864_3524965_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYR39558.1|3525055_3525274_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYR39559.1|3526855_3527314_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029958	Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 chromosome, complete genome	4783542	4443009	4517452	4783542	integrase,plate,portal,tail,capsid,terminase	Salmonella_phage(82.98%)	76	4504510:4504526	4517611:4517627
AYR40330.1|4443009_4444959_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYR40331.1|4445030_4445939_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40332.1|4446012_4446912_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40333.1|4446953_4447313_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40334.1|4447412_4447682_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40335.1|4447813_4449088_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYR40336.1|4449307_4449685_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40337.1|4449771_4449990_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYR40338.1|4450057_4451158_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYR40339.1|4451154_4451640_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYR40340.1|4451639_4454420_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYR40341.1|4454412_4454532_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYR40342.1|4454546_4454849_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYR40343.1|4454903_4455419_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYR40344.1|4455428_4456601_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYR40345.1|4457135_4457858_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYR40346.1|4458055_4458463_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYR40347.1|4458469_4460089_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYR40348.1|4460085_4460691_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYR40349.1|4460683_4461592_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYR40350.1|4461578_4461938_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYR40351.1|4461934_4462513_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYR40352.1|4462581_4463028_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYR40353.1|4463020_4463452_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYR40354.1|4463547_4463973_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYR40355.1|4463972_4464350_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYR40356.1|4464354_4464825_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYR40357.1|4464844_4465060_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYR40358.1|4465063_4465267_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYR40359.1|4465266_4465731_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYR40360.1|4465824_4466475_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYR40361.1|4466478_4467543_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYR40362.1|4467559_4468393_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYR40363.1|4468535_4470302_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYR40364.1|4470298_4471345_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYR40365.1|4471393_4472089_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40366.1|4472108_4473173_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40367.1|4473169_4474234_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40368.1|4475158_4475488_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYR40369.1|4475484_4477554_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYR40370.1|4477544_4478405_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYR40371.1|4478401_4478986_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYR40372.1|4478982_4479210_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYR40373.1|4479209_4479443_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYR40374.1|4479510_4479852_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYR40375.1|4479815_4480016_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYR40376.1|4480023_4480533_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYR40377.1|4480565_4480808_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYR40378.1|4480924_4481557_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYR40379.1|4481560_4482586_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYR40380.1|4482692_4483046_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYR40381.1|4483662_4483950_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40382.1|4483960_4484851_+	methyltransferase	NA	NA	NA	NA	NA
AYR40383.1|4484850_4485597_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40384.1|4485898_4487869_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYR40385.1|4487888_4489193_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYR40386.1|4489215_4489911_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYR40387.1|4489936_4490731_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYR40388.1|4490740_4491808_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYR40389.1|4491852_4493589_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYR40390.1|4493588_4496084_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYR40391.1|4496107_4497154_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYR40392.1|4497156_4498434_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYR40393.1|4498678_4499218_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYR40394.1|4500071_4501583_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYR40395.1|4501566_4503156_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40396.1|4503319_4504333_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4504510:4504526	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYR40397.1|4504759_4505053_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40398.1|4505049_4505538_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40399.1|4505717_4506170_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40400.1|4511392_4511854_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40401.1|4511850_4512072_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYR40402.1|4512928_4513711_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40403.1|4514337_4514562_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40404.1|4514691_4515882_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYR40405.1|4516192_4517452_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4517611:4517627	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029958	Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 chromosome, complete genome	4783542	4659704	4669963	4783542	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYR40542.1|4659704_4660781_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYR40543.1|4660777_4661851_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYR40544.1|4661825_4662989_-	hypothetical protein	NA	NA	NA	NA	NA
AYR40545.1|4663264_4663831_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYR40546.1|4663846_4664086_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYR40547.1|4664089_4664950_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYR40548.1|4665372_4665696_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYR40549.1|4665679_4666180_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYR40550.1|4666176_4666404_+	hypothetical protein	NA	NA	NA	NA	NA
AYR40551.1|4666400_4666721_+	P4 phage protein	NA	NA	NA	NA	NA
AYR40552.1|4666735_4667410_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYR40553.1|4667406_4669068_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYR40554.1|4669804_4669963_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029957	Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence	216847	3612	57130	216847	transposase,holin	Escherichia_phage(43.75%)	56	NA	NA
AYR36221.1|3612_3888_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR36222.1|3806_4310_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR36223.1|4636_4861_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36224.1|5516_5777_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36225.1|5865_6357_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36226.1|6361_6670_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36227.1|6877_7258_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36228.1|7343_7592_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36229.1|7629_7851_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYR36230.1|8013_8397_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36231.1|8711_8936_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36232.1|9022_9487_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36233.1|9669_12099_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36234.1|12221_12668_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36235.1|12715_13522_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36236.1|13749_13992_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36237.1|14069_14402_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36238.1|14901_16083_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36239.1|16091_16388_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYR36240.1|16451_16919_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36241.1|17778_18555_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36242.1|18704_19481_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36243.1|19669_20011_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36244.1|20111_20375_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYR36245.1|20608_21307_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYR36246.1|21461_21758_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36247.1|21845_24230_-	periplasmic protein	NA	NA	NA	NA	NA
AYR36248.1|24480_25089_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36249.1|25201_25498_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36250.1|25502_26099_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36251.1|26490_27372_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYR36252.1|27957_28473_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36253.1|29123_31580_-	periplasmic protein	NA	NA	NA	NA	NA
AYR36254.1|32216_33971_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYR36255.1|34156_35314_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYR36256.1|35673_36498_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYR36257.1|36512_37334_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36258.1|37616_38324_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36259.1|38538_39615_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYR36260.1|40149_41025_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYR36261.1|41278_41860_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36262.1|42466_42820_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36263.1|42871_43189_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36264.1|43188_43986_+	pilus assembly protein	NA	NA	NA	NA	NA
AYR36265.1|43988_45221_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36266.1|45222_45663_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36267.1|45640_47011_+	TrhB	NA	NA	NA	NA	NA
AYR36268.1|47019_47532_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36269.1|47532_48390_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYR36270.1|48399_49350_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36271.1|49358_52040_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36272.1|52673_52949_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYR36273.1|53077_55081_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYR36274.1|55143_56439_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36275.1|56432_56936_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR36276.1|56854_57130_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 2
CP029957	Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence	216847	81906	134349	216847	integrase,transposase	Escherichia_phage(45.83%)	63	106810:106824	131310:131324
AYR36296.1|81906_82410_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR36297.1|82328_82604_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR36298.1|82645_84502_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYR36299.1|84899_85775_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36300.1|85833_86211_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36301.1|86271_87258_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36302.1|87317_88370_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36303.1|88408_88678_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36304.1|88748_89876_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36305.1|89953_91966_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36306.1|92037_92259_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36307.1|92373_93606_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYR36308.1|93880_94405_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36309.1|94395_95361_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36310.1|95431_96367_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36311.1|96444_97365_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36312.1|97437_98373_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36313.1|98549_99506_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36314.1|99918_100188_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36315.1|100242_100833_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36316.1|100840_101098_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36317.1|101171_101708_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36318.1|101724_102180_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36319.1|102163_102391_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36320.1|102439_102694_-	hypothetical protein	NA	NA	NA	NA	NA
AYR36321.1|102761_103721_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36322.1|103731_104640_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36323.1|104944_106126_-	recombinase	NA	NA	NA	NA	NA
AYR36324.1|106340_106553_+	regulatory protein	NA	NA	NA	NA	NA
106810:106824	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR36325.1|106859_107135_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	7.7e-46
106810:106824	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR36326.1|107053_107557_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR36327.1|107663_108098_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYR36328.1|108115_108520_+	MerT	NA	NA	NA	NA	NA
AYR36329.1|108533_108809_+	mercuric transport protein	NA	NA	NA	NA	NA
AYR36330.1|108844_109267_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYR36331.1|109318_111013_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYR36332.1|111030_111393_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYR36333.1|111389_111626_+	mercury resistance protein	NA	NA	NA	NA	NA
AYR36334.1|111622_112330_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36335.1|112368_113673_+|integrase	integrase	integrase	NA	NA	NA	NA
AYR36336.1|113701_114424_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR36337.1|115179_116031_+	replication protein	NA	NA	NA	NA	NA
AYR36338.1|116338_117154_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYR36339.1|117214_118018_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR36340.1|118017_118854_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR36341.1|118914_119637_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR36342.1|120216_121077_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
120671:120685	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR36343.1|121259_121526_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
120671:120685	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR36344.1|121558_122281_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR36345.1|122514_123441_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYR36346.1|123347_123728_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYR36347.1|123924_124524_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYR36348.1|124555_125569_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYR36349.1|125558_126122_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYR36350.1|126247_126808_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYR36351.1|126810_129777_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYR36352.1|129843_130221_+	hypothetical protein	NA	NA	NA	NA	NA
AYR36353.1|130421_131081_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYR36354.1|131359_131635_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR36355.1|131643_131937_+	hypothetical protein	NA	U5P0U6	Shigella_phage	70.1	7.0e-45
AYR36356.1|132518_133274_+	replication protein	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
AYR36357.1|133651_133927_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR36358.1|133845_134349_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	92.8	1.4e-88
