The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029908	Salmonella enterica subsp. enterica serovar Typhi strain 311189_239103 chromosome, complete genome	4778864	929971	937283	4778864	protease,integrase	Dickeya_phage(16.67%)	6	931222:931236	942214:942228
AYS59599.1|929971_931090_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS59600.1|931086_933033_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931222:931236	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS59601.1|933162_933384_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS59602.1|933707_934028_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS59603.1|934058_936335_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS59604.1|936905_937283_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942214:942228	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029908	Salmonella enterica subsp. enterica serovar Typhi strain 311189_239103 chromosome, complete genome	4778864	1008026	1085340	4778864	tail,transposase,integrase,terminase,protease	Salmonella_phage(73.33%)	93	990105:990124	1060700:1060719
990105:990124	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS59654.1|1008026_1009367_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS59655.1|1009363_1009612_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS59656.1|1009652_1009898_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS59657.1|1009897_1010779_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS59658.1|1010775_1011840_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS59659.1|1011917_1012598_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS59660.1|1012594_1013380_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS59661.1|1013385_1013682_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS59662.1|1013772_1013973_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS59663.1|1014261_1014666_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS59664.1|1014997_1015372_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS59665.1|1015456_1016440_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS59666.1|1016442_1017192_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS59667.1|1017202_1017550_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	3.7e-53
AYS59668.1|1017546_1018071_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS59669.1|1018070_1018544_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS59670.1|1018547_1019120_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS59671.1|1019213_1019480_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS59672.1|1019561_1019723_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS59673.1|1020155_1020653_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS59674.1|1020837_1021077_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS59675.1|1021066_1021372_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS59676.1|1021411_1022014_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS59677.1|1022222_1022834_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS59678.1|1022966_1023764_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS59679.1|1024162_1024288_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS59680.1|1024423_1024873_-	lipoprotein	NA	NA	NA	NA	NA
AYS59681.1|1025089_1025479_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS59682.1|1025465_1025747_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS59683.1|1025746_1026361_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS59684.1|1026580_1026835_+	hypothetical protein	NA	NA	NA	NA	NA
AYS59685.1|1026939_1027317_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS59686.1|1027380_1027641_+	hypothetical protein	NA	NA	NA	NA	NA
AYS59687.1|1027730_1028483_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS59688.1|1028448_1029852_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS59689.1|1029851_1031321_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS59690.1|1031412_1031943_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS59691.1|1031957_1033190_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS59692.1|1033194_1033692_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS59693.1|1033703_1034645_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS59694.1|1034686_1035055_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS59695.1|1035020_1035428_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS59696.1|1035424_1035979_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS59697.1|1035965_1036355_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS59698.1|1036329_1036893_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS59699.1|1036896_1038042_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS59700.1|1038053_1038494_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.0	7.8e-56
AYS59701.1|1038497_1038950_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS59702.1|1039127_1041080_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS59703.1|1041079_1041730_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS59704.1|1041733_1042036_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS59705.1|1042038_1043070_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS59706.1|1043066_1043402_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS59707.1|1043596_1044328_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS59708.1|1044327_1044756_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS59709.1|1044814_1045570_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	84.9	7.0e-105
AYS59710.1|1045657_1045795_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS59711.1|1045810_1046164_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS59712.1|1046164_1047364_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS59713.1|1047360_1048041_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS59714.1|1048040_1049552_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS59715.1|1049566_1050085_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS59716.1|1051006_1051708_-	hypothetical protein	NA	NA	NA	NA	NA
AYS59717.1|1052020_1052299_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS59718.1|1052724_1055337_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS59719.1|1055544_1056555_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS59720.1|1056717_1057263_+	hypothetical protein	NA	NA	NA	NA	NA
AYS59721.1|1057259_1058369_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS59722.1|1058467_1060576_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS59723.1|1060588_1062496_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1060700:1060719	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS59724.1|1062510_1063764_+	inner membrane protein	NA	NA	NA	NA	NA
AYS59725.1|1063768_1065409_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS59726.1|1065405_1065969_+	lipoprotein	NA	NA	NA	NA	NA
AYS59727.1|1066222_1066390_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS59728.1|1066489_1067008_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS59729.1|1067076_1068837_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS59730.1|1069022_1069475_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS59731.1|1069546_1070599_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS59732.1|1070954_1071464_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS59733.1|1071680_1072286_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS59734.1|1072272_1074426_-	inner membrane protein	NA	NA	NA	NA	NA
AYS59735.1|1074444_1074891_-	hypothetical protein	NA	NA	NA	NA	NA
AYS59736.1|1075014_1077069_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS59737.1|1077104_1077563_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS59738.1|1077657_1078320_-	hypothetical protein	NA	NA	NA	NA	NA
AYS59739.1|1078490_1078907_+	hypothetical protein	NA	NA	NA	NA	NA
AYS59740.1|1078951_1079269_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS59741.1|1079326_1080538_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS59742.1|1081669_1082128_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS59743.1|1082864_1083146_+	acylphosphatase	NA	NA	NA	NA	NA
AYS59744.1|1083142_1083472_-	sulfite reductase	NA	NA	NA	NA	NA
AYS59745.1|1083558_1084218_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS59746.1|1084881_1085340_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029908	Salmonella enterica subsp. enterica serovar Typhi strain 311189_239103 chromosome, complete genome	4778864	1530446	1573717	4778864	tail,head,transposase,plate,protease	Burkholderia_virus(48.48%)	53	NA	NA
AYS60144.1|1530446_1530905_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS60145.1|1531407_1531689_+	stress response protein	NA	NA	NA	NA	NA
AYS60146.1|1531957_1532779_+|protease	serine protease	protease	NA	NA	NA	NA
AYS60147.1|1532813_1533143_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS60148.1|1533129_1533492_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS60149.1|1533603_1533774_-	hypothetical protein	NA	NA	NA	NA	NA
AYS60150.1|1533908_1534943_+	hypothetical protein	NA	NA	NA	NA	NA
AYS60151.1|1535117_1536506_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS60152.1|1536516_1538046_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS60153.1|1538572_1539517_+	hypothetical protein	NA	NA	NA	NA	NA
AYS60154.1|1539698_1540088_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS60155.1|1540059_1540512_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS60156.1|1540706_1540937_-	hypothetical protein	NA	NA	NA	NA	NA
AYS60157.1|1540933_1541617_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS60158.1|1541613_1541829_-	hypothetical protein	NA	NA	NA	NA	NA
AYS60159.1|1541821_1542205_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYS60160.1|1542201_1542504_-	hypothetical protein	NA	NA	NA	NA	NA
AYS60161.1|1542513_1542786_-	hypothetical protein	NA	NA	NA	NA	NA
AYS60162.1|1543074_1543605_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS60163.1|1543632_1543902_-	hypothetical protein	NA	NA	NA	NA	NA
AYS60164.1|1543904_1545071_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS60165.1|1545081_1546851_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS60166.1|1547028_1547460_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYS60167.1|1547455_1548052_+	hypothetical protein	NA	NA	NA	NA	NA
AYS60168.1|1548295_1548646_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS60169.1|1549360_1550011_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS60170.1|1550007_1550334_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYS60171.1|1550333_1550645_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS60172.1|1550644_1551190_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS60173.1|1551186_1552782_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS60174.1|1552781_1554278_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS60175.1|1554258_1555080_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS60176.1|1555082_1555541_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS60177.1|1555755_1556871_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS60178.1|1556885_1557839_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS60179.1|1557848_1558187_+	hypothetical protein	NA	NA	NA	NA	NA
AYS60180.1|1558188_1558635_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS60181.1|1558634_1559099_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS60182.1|1559095_1559350_+	hypothetical protein	NA	NA	NA	NA	NA
AYS60183.1|1559339_1560767_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS60184.1|1560766_1561288_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS60185.1|1561290_1561572_+	hypothetical protein	NA	NA	NA	NA	NA
AYS60186.1|1561669_1562005_+	hypothetical protein	NA	NA	NA	NA	NA
AYS60187.1|1562180_1564646_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS60188.1|1564645_1565530_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS60189.1|1565729_1566884_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS60190.1|1566880_1567408_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS60191.1|1567464_1567812_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS60192.1|1567802_1568906_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS60193.1|1568898_1569477_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS60194.1|1569479_1570505_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYS60195.1|1571018_1571636_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS60196.1|1573144_1573717_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
>prophage 4
CP029908	Salmonella enterica subsp. enterica serovar Typhi strain 311189_239103 chromosome, complete genome	4778864	1785088	1789500	4778864		Escherichia_phage(50.0%)	6	NA	NA
AYS60405.1|1785088_1785328_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AYS60406.1|1786200_1787010_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS60407.1|1787082_1787460_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS60408.1|1787607_1788150_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS60409.1|1788341_1789070_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS60410.1|1789086_1789500_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029908	Salmonella enterica subsp. enterica serovar Typhi strain 311189_239103 chromosome, complete genome	4778864	1993387	2000621	4778864		Morganella_phage(33.33%)	7	NA	NA
AYS60600.1|1993387_1994818_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYS60601.1|1994891_1995587_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYS60602.1|1995666_1995978_-	hypothetical protein	NA	NA	NA	NA	NA
AYS60603.1|1996628_1997813_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYS60604.1|1998272_1998485_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYS60605.1|1998930_2000199_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYS60606.1|2000201_2000621_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029908	Salmonella enterica subsp. enterica serovar Typhi strain 311189_239103 chromosome, complete genome	4778864	2084363	2094870	4778864		Enterobacteria_phage(37.5%)	10	NA	NA
AYS60683.1|2084363_2085677_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS60684.1|2085703_2086783_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS60685.1|2086787_2087561_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS60686.1|2087576_2088551_-	reductase RfbI	NA	NA	NA	NA	NA
AYS60687.1|2088556_2089108_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS60688.1|2089108_2089987_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS60689.1|2090034_2090934_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS60690.1|2090933_2092019_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS60691.1|2092395_2093289_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS60692.1|2093466_2094870_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029908	Salmonella enterica subsp. enterica serovar Typhi strain 311189_239103 chromosome, complete genome	4778864	2170762	2179933	4778864	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS60751.1|2170762_2172796_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS60752.1|2173036_2173495_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS60753.1|2173666_2174197_+	lipoprotein	NA	NA	NA	NA	NA
AYS60754.1|2174253_2174721_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS60755.1|2174767_2175487_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS60756.1|2175483_2177169_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS60757.1|2177391_2178123_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS60758.1|2178182_2178290_+	hypothetical protein	NA	NA	NA	NA	NA
AYS60759.1|2178270_2179002_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS60760.1|2178985_2179933_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029908	Salmonella enterica subsp. enterica serovar Typhi strain 311189_239103 chromosome, complete genome	4778864	2715401	2728793	4778864	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS61188.1|2715401_2715620_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS61189.1|2715710_2716811_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS61190.1|2716807_2717293_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS61191.1|2717289_2720367_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYS61192.1|2720359_2720479_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS61193.1|2720493_2720796_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS61194.1|2720850_2721366_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS61195.1|2721375_2722548_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS61196.1|2722690_2723263_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS61197.1|2723940_2725056_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS61198.1|2725136_2728793_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029908	Salmonella enterica subsp. enterica serovar Typhi strain 311189_239103 chromosome, complete genome	4778864	3047301	3091003	4778864	protease,bacteriocin,transposase,tRNA	Bacillus_virus(33.33%)	44	NA	NA
AYS61489.1|3047301_3047760_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS61490.1|3047949_3049029_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS61491.1|3049130_3050294_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS61492.1|3050315_3051362_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS61493.1|3051735_3052161_+	hypothetical protein	NA	NA	NA	NA	NA
AYS61494.1|3052186_3052765_+	hypothetical protein	NA	NA	NA	NA	NA
AYS61495.1|3052798_3053473_+	hypothetical protein	NA	NA	NA	NA	NA
AYS61496.1|3053454_3054138_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS61497.1|3054131_3054788_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS61498.1|3054892_3055351_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS61499.1|3055539_3057531_-	transketolase	NA	NA	NA	NA	NA
AYS61500.1|3057806_3058565_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS61501.1|3058665_3059586_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS61502.1|3059813_3061790_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS61503.1|3061798_3061930_-	hypothetical protein	NA	NA	NA	NA	NA
AYS61504.1|3062224_3062524_-	membrane protein	NA	NA	NA	NA	NA
AYS61505.1|3062579_3063734_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS61506.1|3064226_3065621_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS61507.1|3065699_3066197_+	hypothetical protein	NA	NA	NA	NA	NA
AYS61508.1|3066292_3067000_+	endonuclease I	NA	NA	NA	NA	NA
AYS61509.1|3067076_3067808_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS61510.1|3067827_3068775_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS61511.1|3068990_3069554_+	hypothetical protein	NA	NA	NA	NA	NA
AYS61512.1|3069553_3069970_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS61513.1|3070016_3070703_-	global regulatory protein	NA	NA	NA	NA	NA
AYS61514.1|3070832_3071813_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS61515.1|3071830_3072535_+	hypothetical protein	NA	NA	NA	NA	NA
AYS61516.1|3072553_3073120_+	hypothetical protein	NA	NA	NA	NA	NA
AYS61517.1|3073116_3073407_+	hypothetical protein	NA	NA	NA	NA	NA
AYS61518.1|3073414_3074008_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS61519.1|3074000_3075137_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS61520.1|3075227_3076235_-	hypothetical protein	NA	NA	NA	NA	NA
AYS61521.1|3076367_3077414_-	L-asparaginase	NA	NA	NA	NA	NA
AYS61522.1|3077732_3078191_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS61523.1|3078313_3079033_-	hypothetical protein	NA	NA	NA	NA	NA
AYS61524.1|3079082_3079409_-	hypothetical protein	NA	NA	NA	NA	NA
AYS61525.1|3079408_3080128_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS61526.1|3080282_3081335_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS61527.1|3081362_3081638_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS61528.1|3081750_3082836_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS61529.1|3083052_3084309_+	nucleoside permease	NA	NA	NA	NA	NA
AYS61530.1|3086919_3087627_+	hypothetical protein	NA	NA	NA	NA	NA
AYS61531.1|3090215_3090482_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS61532.1|3090724_3091003_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029908	Salmonella enterica subsp. enterica serovar Typhi strain 311189_239103 chromosome, complete genome	4778864	3468542	3506600	4778864	tail,capsid,plate,transposase,integrase,terminase,portal	Salmonella_phage(82.05%)	45	3463506:3463520	3475672:3475686
3463506:3463520	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS61862.1|3468542_3470189_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS61863.1|3470328_3470427_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS61864.1|3470682_3471012_+	hypothetical protein	NA	NA	NA	NA	NA
AYS61865.1|3471052_3472105_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS61866.1|3472500_3473070_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS61867.1|3473449_3473959_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS61868.1|3474133_3474358_+	hypothetical protein	NA	NA	NA	NA	NA
AYS61869.1|3474380_3474722_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS61870.1|3474789_3475023_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS61871.1|3475022_3475250_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS61872.1|3475246_3476104_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3475672:3475686	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS61873.1|3476100_3478515_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS61874.1|3478668_3478857_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS61875.1|3480824_3481739_+	hypothetical protein	NA	NA	NA	NA	NA
AYS61876.1|3481735_3482476_+	hypothetical protein	NA	NA	NA	NA	NA
AYS61877.1|3482510_3483548_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS61878.1|3483547_3485314_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS61879.1|3485456_3486290_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS61880.1|3486306_3487365_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS61881.1|3487368_3488019_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS61882.1|3488051_3488579_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS61883.1|3488578_3488782_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS61884.1|3488785_3489001_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS61885.1|3489020_3489494_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS61886.1|3489495_3489873_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS61887.1|3489869_3490298_+	regulatory protein	NA	E5G6N2	Salmonella_phage	76.6	5.4e-46
AYS61888.1|3490393_3490825_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS61889.1|3490817_3491264_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS61890.1|3491332_3491911_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS61891.1|3491907_3492267_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS61892.1|3492253_3493162_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS61893.1|3493154_3493760_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS61894.1|3493756_3495271_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYS61895.1|3495270_3495864_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS61896.1|3495835_3496276_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS61897.1|3496698_3497271_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS61898.1|3497413_3498586_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS61899.1|3498595_3499111_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS61900.1|3499165_3499468_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS61901.1|3499482_3499602_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS61902.1|3499594_3502672_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYS61903.1|3502668_3503154_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS61904.1|3503150_3504251_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS61905.1|3504341_3504560_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS61906.1|3506141_3506600_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029908	Salmonella enterica subsp. enterica serovar Typhi strain 311189_239103 chromosome, complete genome	4778864	4438501	4512771	4778864	capsid,tail,plate,integrase,terminase,portal	Salmonella_phage(82.61%)	75	4500015:4500031	4512930:4512946
AYS62684.1|4438501_4440451_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS62685.1|4440522_4441431_+	hypothetical protein	NA	NA	NA	NA	NA
AYS62686.1|4441504_4442404_+	hypothetical protein	NA	NA	NA	NA	NA
AYS62687.1|4442445_4442805_+	hypothetical protein	NA	NA	NA	NA	NA
AYS62688.1|4442904_4443174_-	hypothetical protein	NA	NA	NA	NA	NA
AYS62689.1|4443305_4444580_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS62690.1|4444799_4445177_+	hypothetical protein	NA	NA	NA	NA	NA
AYS62691.1|4445263_4445482_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS62692.1|4445549_4446650_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS62693.1|4446646_4447132_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS62694.1|4447131_4449912_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS62695.1|4449904_4450024_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS62696.1|4450038_4450341_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS62697.1|4450395_4450911_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS62698.1|4450920_4452093_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS62699.1|4452627_4453350_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS62700.1|4453547_4453955_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS62701.1|4453961_4455581_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS62702.1|4455577_4456183_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS62703.1|4456175_4457084_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYS62704.1|4457070_4457430_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS62705.1|4457426_4458005_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS62706.1|4458073_4458520_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS62707.1|4458512_4458944_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
AYS62708.1|4459039_4459465_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS62709.1|4459464_4459842_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS62710.1|4459846_4460317_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS62711.1|4460336_4460552_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS62712.1|4460555_4460759_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS62713.1|4460758_4461223_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS62714.1|4461316_4461967_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS62715.1|4461970_4463035_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS62716.1|4463051_4463885_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS62717.1|4464027_4465794_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS62718.1|4465790_4466837_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS62719.1|4466885_4467581_-	hypothetical protein	NA	NA	NA	NA	NA
AYS62720.1|4467600_4468665_-	hypothetical protein	NA	NA	NA	NA	NA
AYS62721.1|4468661_4469726_-	hypothetical protein	NA	NA	NA	NA	NA
AYS62722.1|4470650_4473059_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.1	0.0e+00
AYS62723.1|4473049_4473910_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS62724.1|4473906_4474491_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS62725.1|4474487_4474715_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS62726.1|4474714_4474948_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS62727.1|4475015_4475357_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS62728.1|4475320_4475521_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS62729.1|4475528_4476038_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS62730.1|4476070_4476313_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS62731.1|4476429_4477062_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS62732.1|4477065_4478091_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS62733.1|4478197_4478551_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS62734.1|4479167_4479455_+	hypothetical protein	NA	NA	NA	NA	NA
AYS62735.1|4479465_4480356_+	methyltransferase	NA	NA	NA	NA	NA
AYS62736.1|4480355_4481102_+	hypothetical protein	NA	NA	NA	NA	NA
AYS62737.1|4481403_4483374_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS62738.1|4483393_4484698_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS62739.1|4484720_4485416_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS62740.1|4485441_4486236_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS62741.1|4486245_4487313_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS62742.1|4487357_4489094_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS62743.1|4489093_4491589_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS62744.1|4491612_4492659_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS62745.1|4492661_4493939_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS62746.1|4494183_4494723_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS62747.1|4495576_4497088_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS62748.1|4497071_4498661_+	hypothetical protein	NA	NA	NA	NA	NA
AYS62749.1|4498824_4499838_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4500015:4500031	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS62750.1|4500264_4500558_+	hypothetical protein	NA	NA	NA	NA	NA
AYS62751.1|4500554_4501043_+	hypothetical protein	NA	NA	NA	NA	NA
AYS62752.1|4501222_4501675_-	hypothetical protein	NA	NA	NA	NA	NA
AYS62753.1|4506897_4507359_+	hypothetical protein	NA	NA	NA	NA	NA
AYS62754.1|4507355_4507577_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS62755.1|4508433_4509216_+	hypothetical protein	NA	NA	NA	NA	NA
AYS62756.1|4509842_4510067_-	hypothetical protein	NA	NA	NA	NA	NA
AYS62757.1|4510196_4511201_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYS62758.1|4511511_4512771_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4512930:4512946	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029908	Salmonella enterica subsp. enterica serovar Typhi strain 311189_239103 chromosome, complete genome	4778864	4655024	4661507	4778864	capsid	Enterobacteria_phage(66.67%)	8	NA	NA
AYS62895.1|4655024_4656101_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS62896.1|4656097_4657171_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS62897.1|4657145_4658309_-	hypothetical protein	NA	NA	NA	NA	NA
AYS62898.1|4658584_4659151_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS62899.1|4659166_4659406_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS62900.1|4659409_4660270_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS62901.1|4660692_4660959_+	hypothetical protein	NA	Q7M299	Enterobacteria_phage	70.5	5.8e-30
AYS62902.1|4661006_4661507_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
