The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033631	Klebsiella sp. P1CD1 chromosome, complete genome	5633647	708331	748830	5633647	lysis,tRNA,tail,capsid,portal,head,plate,integrase	Salmonella_phage(84.62%)	48	708246:708292	742641:742687
708246:708292	attL	TGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGTC	NA	NA	NA	NA
AYW17783.1|708331_709417_-|integrase	site-specific integrase	integrase	F1BUS9	Erwinia_phage	60.7	2.6e-121
AYW17784.1|709418_710297_-	hypothetical protein	NA	NA	NA	NA	NA
AYW17785.1|710305_710929_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	38.5	5.3e-34
AYW17786.1|711029_711266_+	regulator	NA	NA	NA	NA	NA
AYW17787.1|711300_711810_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	84.0	2.1e-76
AYW22207.1|711817_712018_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	84.6	1.3e-26
AYW17788.1|711981_712323_+	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	85.8	4.2e-49
AYW17789.1|712390_712624_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	92.2	3.5e-31
AYW17790.1|712623_712851_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	90.7	2.5e-34
AYW17791.1|712847_713735_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	69.4	6.9e-112
AYW17792.1|713715_716121_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.7	0.0e+00
AYW17793.1|716292_716481_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	7.9e-26
AYW22208.1|716494_716728_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	81.8	2.3e-30
AYW17794.1|716803_717061_+	hypothetical protein	NA	NA	NA	NA	NA
AYW17795.1|717314_718583_+	hypothetical protein	NA	NA	NA	NA	NA
AYW17796.1|718655_719693_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.2	2.0e-174
AYW17797.1|719692_721456_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	92.6	0.0e+00
AYW17798.1|721596_722430_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.9	6.1e-102
AYW17799.1|722446_723511_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.7	1.4e-183
AYW17800.1|723514_724165_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	86.1	3.6e-102
AYW17801.1|724261_724726_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	87.0	2.1e-75
AYW17802.1|724725_724929_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	86.6	8.3e-29
AYW17803.1|724932_725148_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	1.0e-29
AYW17804.1|725128_725638_+	lysozyme	NA	E5G6N1	Salmonella_phage	84.0	3.3e-82
AYW17805.1|725642_726071_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	78.7	1.5e-51
AYW17806.1|726166_726598_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AYW17807.1|726590_727034_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	77.1	9.6e-54
AYW17808.1|727046_727481_-	hypothetical protein	NA	NA	NA	NA	NA
AYW17809.1|727565_728138_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	7.9e-77
AYW17810.1|728134_728497_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	4.4e-49
AYW17811.1|728483_729392_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	67.2	3.4e-106
AYW17812.1|729384_729984_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.2e-56
AYW22209.1|730777_734215_+	hypothetical protein	NA	NA	NA	NA	NA
AYW17813.1|734229_735306_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	41.3	1.1e-29
AYW17814.1|735453_736626_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.6	8.6e-211
AYW17815.1|736635_737151_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.8	2.8e-81
AYW17816.1|737204_737504_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	8.2e-33
AYW22210.1|737518_737638_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AYW17817.1|737630_740258_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	38.1	1.2e-116
AYW17818.1|740254_740740_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	1.5e-63
AYW17819.1|740736_741834_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.1	6.7e-173
AYW17820.1|741904_742123_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
AYW17821.1|742135_742513_-	hypothetical protein	NA	NA	NA	NA	NA
AYW17822.1|742840_743347_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
742641:742687	attR	TGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGTC	NA	NA	NA	NA
AYW17823.1|743446_745288_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AYW17824.1|745506_747252_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	1.2e-75
AYW17825.1|747363_747579_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AYW17826.1|747816_748830_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	3.7e-109
>prophage 2
CP033631	Klebsiella sp. P1CD1 chromosome, complete genome	5633647	1501226	1570579	5633647	head,holin,terminase	Salmonella_phage(17.11%)	108	NA	NA
AYW18512.1|1501226_1501685_-	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	36.5	1.8e-10
AYW18513.1|1501817_1502759_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.6	1.4e-09
AYW22237.1|1502755_1503616_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.9e-05
AYW18514.1|1503993_1504476_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AYW18515.1|1504830_1505034_-	AlpA family transcriptional regulator	NA	I6RSG8	Salmonella_phage	61.2	2.5e-17
AYW18516.1|1505354_1505984_-	Eac protein	NA	A0A220NQT7	Salmonella_phage	70.8	1.8e-85
AYW18517.1|1506272_1506530_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	68.8	7.0e-25
AYW18518.1|1506575_1506809_-	hypothetical protein	NA	NA	NA	NA	NA
AYW18519.1|1506854_1507091_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	54.0	7.7e-10
AYW18520.1|1507175_1507478_-	hypothetical protein	NA	K7PJS3	Enterobacterial_phage	61.0	1.0e-27
AYW18521.1|1508256_1508550_-	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	85.6	2.9e-43
AYW18522.1|1508549_1509383_-	hypothetical protein	NA	A0A2H4N7C3	Pectobacterium_phage	51.4	2.5e-07
AYW18523.1|1509379_1509586_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	95.6	4.0e-31
AYW18524.1|1509582_1509789_-	hypothetical protein	NA	NA	NA	NA	NA
AYW18525.1|1509798_1510140_-	hypothetical protein	NA	R9TQX7	Aeromonas_phage	37.4	1.2e-08
AYW18526.1|1510148_1510352_-	hypothetical protein	NA	NA	NA	NA	NA
AYW18527.1|1510320_1510719_-	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	41.1	1.0e-14
AYW18528.1|1510718_1510895_-	DUF2737 family protein	NA	Q5G8U5	Enterobacteria_phage	55.4	5.7e-10
AYW18529.1|1510961_1511729_-	dcm methylase	NA	D5LH17	Escherichia_phage	53.4	9.4e-65
AYW18530.1|1511725_1511950_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	73.2	1.2e-20
AYW18531.1|1511946_1512219_-	hypothetical protein	NA	Q716F1	Shigella_phage	62.7	1.2e-22
AYW18532.1|1512215_1512515_-	hypothetical protein	NA	A0A0M4R304	Salmonella_phage	58.2	4.5e-23
AYW18533.1|1512525_1513008_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	76.2	1.2e-62
AYW18534.1|1513000_1513894_-	DNA recombinase	NA	K7P7A0	Enterobacteria_phage	82.0	1.4e-136
AYW18535.1|1514178_1514487_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	51.0	2.1e-23
AYW18536.1|1514614_1514905_-	hypothetical protein	NA	R9TNI1	Aeromonas_phage	63.6	1.3e-27
AYW18537.1|1514904_1515057_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
AYW18538.1|1515035_1515173_-	hypothetical protein	NA	NA	NA	NA	NA
AYW18539.1|1515420_1515729_-	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	64.6	3.8e-25
AYW18540.1|1515868_1516237_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	70.5	3.2e-47
AYW18541.1|1516248_1516503_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	46.1	5.0e-07
AYW18542.1|1517052_1517415_-	antitermination protein	NA	C6ZR44	Salmonella_phage	69.2	3.4e-41
AYW18543.1|1517778_1518498_-	XRE family transcriptional regulator	NA	W6MVG5	Pseudomonas_phage	44.9	4.1e-46
AYW22238.1|1518645_1518882_+	transcriptional regulator	NA	A0A0P0ZDD7	Stx2-converting_phage	53.3	7.4e-13
AYW18544.1|1519048_1519348_+	hypothetical protein	NA	K7PKU6	Enterobacteria_phage	76.8	2.3e-35
AYW18545.1|1519372_1519516_+	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	82.6	9.0e-14
AYW18546.1|1519508_1520414_+	DNA replication protein	NA	A0A0N7C1Z7	Escherichia_phage	60.6	4.3e-93
AYW18547.1|1520403_1521813_+	helicase DnaB	NA	K7P7N4	Enterobacteria_phage	71.4	1.1e-193
AYW18548.1|1521812_1522418_+	hypothetical protein	NA	NA	NA	NA	NA
AYW18549.1|1522414_1522609_+	hypothetical protein	NA	NA	NA	NA	NA
AYW18550.1|1522605_1522857_+	hypothetical protein	NA	NA	NA	NA	NA
AYW18551.1|1523009_1523276_+	hypothetical protein	NA	A0A291LBJ5	Klebsiella_phage	66.7	3.2e-28
AYW18552.1|1523377_1523680_+	hypothetical protein	NA	M1F1F4	Cronobacter_phage	48.5	1.2e-15
AYW18553.1|1523648_1524089_+	DUF2591 domain-containing protein	NA	J7I4M3	Pseudomonas_phage	32.2	1.6e-08
AYW18554.1|1524128_1524740_+	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	48.5	3.4e-41
AYW18555.1|1524736_1524967_+	hypothetical protein	NA	NA	NA	NA	NA
AYW18556.1|1525429_1525684_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	43.9	1.7e-10
AYW18557.1|1525814_1526588_+	hypothetical protein	NA	K7P7E4	Enterobacteria_phage	40.1	1.5e-17
AYW18558.1|1526748_1526928_+	hypothetical protein	NA	NA	NA	NA	NA
AYW18559.1|1526908_1527358_+	DUF1367 family protein	NA	A0A2R2Z328	Escherichia_phage	69.1	2.0e-54
AYW18560.1|1527956_1528127_+	protein ninF	NA	NA	NA	NA	NA
AYW18561.1|1528119_1528371_+	hypothetical protein	NA	C6ZR59	Salmonella_phage	60.6	2.6e-16
AYW18562.1|1528363_1528987_+	hypothetical protein	NA	A0A2I7RAC0	Vibrio_phage	49.7	3.1e-42
AYW18563.1|1529035_1529215_+	hypothetical protein	NA	NA	NA	NA	NA
AYW18564.1|1529214_1529400_+	hypothetical protein	NA	NA	NA	NA	NA
AYW18565.1|1529746_1530568_+	antitermination protein	NA	A0A0M4RTW7	Salmonella_phage	60.1	5.5e-87
AYW18566.1|1531139_1531355_+	hypothetical protein	NA	NA	NA	NA	NA
AYW18567.1|1531790_1532087_+|holin	holin	holin	NA	NA	NA	NA
AYW18568.1|1532073_1532370_+	hypothetical protein	NA	NA	NA	NA	NA
AYW18569.1|1532377_1532920_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	72.5	4.3e-72
AYW18570.1|1532916_1533132_+	hypothetical protein	NA	NA	NA	NA	NA
AYW18571.1|1533128_1533677_+	hypothetical protein	NA	S4TP37	Salmonella_phage	35.9	1.6e-18
AYW18572.1|1533944_1534664_+	KilA-N domain-containing protein	NA	I6R9D7	Salmonella_phage	79.1	8.2e-55
AYW18573.1|1534934_1535633_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
AYW18574.1|1536202_1536388_+	hypothetical protein	NA	NA	NA	NA	NA
AYW22239.1|1536628_1537027_+	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	72.6	2.4e-40
AYW18575.1|1537019_1538312_+|terminase	PBSX family phage terminase large subunit	terminase	A0A125RNL7	Pseudomonas_phage	74.0	3.5e-181
AYW22240.1|1538493_1539858_+	DUF1073 domain-containing protein	NA	H9C0V0	Aeromonas_phage	35.3	1.4e-63
AYW22241.1|1539871_1540573_+|head	phage head morphogenesis protein	head	A0A077KGU5	Edwardsiella_phage	42.6	2.0e-45
AYW18576.1|1540574_1540673_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AYW18577.1|1540672_1540888_+	hypothetical protein	NA	NA	NA	NA	NA
AYW18578.1|1540891_1541140_+	hypothetical protein	NA	NA	NA	NA	NA
AYW18579.1|1541190_1542657_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	34.2	8.1e-49
AYW18580.1|1542693_1543158_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	30.8	9.2e-07
AYW18581.1|1543231_1544251_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	35.7	7.1e-44
AYW18582.1|1544316_1544682_+	hypothetical protein	NA	NA	NA	NA	NA
AYW18583.1|1544681_1545095_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
AYW18584.1|1545098_1545584_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	32.1	4.6e-09
AYW18585.1|1545570_1545936_+	hypothetical protein	NA	NA	NA	NA	NA
AYW22242.1|1546050_1546503_+	hypothetical protein	NA	A6N3B1	Burkholderia_virus	32.6	4.0e-07
AYW18586.1|1546505_1547996_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	38.0	5.1e-83
AYW18587.1|1547992_1548436_+	hypothetical protein	NA	NA	NA	NA	NA
AYW18588.1|1548680_1549139_+	hypothetical protein	NA	A0A077KC08	Edwardsiella_phage	31.1	6.3e-08
AYW18589.1|1549153_1549354_+	transglycosylase	NA	NA	NA	NA	NA
AYW18590.1|1549337_1551293_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	59.5	4.9e-33
AYW18591.1|1551293_1552181_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	30.8	6.0e-23
AYW18592.1|1552180_1552486_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	45.5	1.2e-18
AYW18593.1|1552626_1553343_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	28.8	4.9e-23
AYW18594.1|1553335_1553938_+	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	34.2	1.0e-21
AYW18595.1|1554260_1554710_+	hypothetical protein	NA	NA	NA	NA	NA
AYW18596.1|1554714_1555263_-	hypothetical protein	NA	NA	NA	NA	NA
AYW18597.1|1555262_1555517_-	Arc family DNA-binding protein	NA	B9UDL4	Salmonella_phage	65.0	2.0e-19
AYW18598.1|1555602_1555764_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	90.2	2.1e-19
AYW18599.1|1555832_1556816_+	antirepressor protein Ant	NA	Q0H8C7	Salmonella_phage	75.6	9.8e-83
AYW18600.1|1556935_1557181_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AYW18601.1|1557171_1557507_+	mRNA-degrading endonuclease	NA	NA	NA	NA	NA
AYW22243.1|1557571_1557931_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	41.1	9.5e-20
AYW18602.1|1557938_1559171_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	52.6	1.4e-110
AYW18603.1|1559170_1559722_+	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	45.3	2.8e-39
AYW18604.1|1559703_1560591_+	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	35.1	2.1e-39
AYW18605.1|1560574_1561186_+	methyltransferase domain-containing protein	NA	H2BDB7	Pseudomonas_virus	45.7	2.1e-43
AYW18606.1|1561188_1561788_+	DUF2612 domain-containing protein	NA	Q2NPA3	Xanthomonas_phage	40.0	1.7e-29
AYW18607.1|1561784_1563083_+	hypothetical protein	NA	K4HZC0	Acinetobacter_phage	40.6	2.3e-10
AYW18608.1|1563159_1567476_+	hypothetical protein	NA	A0A1V0E6N8	Klebsiella_phage	30.7	1.3e-30
AYW22244.1|1567563_1567803_+	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	50.0	2.8e-15
AYW18609.1|1567802_1568120_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.5	1.6e-23
AYW18610.1|1568152_1569322_-	DUF4102 domain-containing protein	NA	I6R0M2	Salmonella_phage	88.6	4.0e-208
AYW18611.1|1569649_1570579_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	83.1	7.2e-136
>prophage 3
CP033631	Klebsiella sp. P1CD1 chromosome, complete genome	5633647	1849359	1861636	5633647		Enterobacteria_phage(22.22%)	11	NA	NA
AYW18847.1|1849359_1850766_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
AYW18848.1|1850988_1852053_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.0e-105
AYW18849.1|1852079_1852949_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	7.5e-111
AYW18850.1|1852980_1853871_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	3.7e-28
AYW18851.1|1853885_1854440_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	5.0e-52
AYW18852.1|1854621_1855788_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
AYW18853.1|1856469_1856664_-	hypothetical protein	NA	NA	NA	NA	NA
AYW18854.1|1856732_1857737_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	1.2e-30
AYW18855.1|1858250_1858535_+	hypothetical protein	NA	NA	NA	NA	NA
AYW18856.1|1858814_1860230_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	30.6	1.2e-52
AYW18857.1|1860253_1861636_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.8	4.2e-31
>prophage 4
CP033631	Klebsiella sp. P1CD1 chromosome, complete genome	5633647	3041773	3047021	5633647		Escherichia_phage(100.0%)	6	NA	NA
AYW19906.1|3041773_3042034_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	96.5	4.6e-40
AYW19907.1|3042328_3043189_+	LEN family class A beta-lactamase	NA	A0A077SL40	Escherichia_phage	89.9	8.7e-144
AYW19908.1|3043206_3043968_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	98.8	3.6e-133
AYW19909.1|3044228_3045131_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	98.7	1.1e-157
AYW19910.1|3045142_3046408_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	97.4	3.4e-229
AYW19911.1|3046400_3047021_+	aldolase	NA	A0A077SK32	Escherichia_phage	97.6	9.7e-113
>prophage 5
CP033631	Klebsiella sp. P1CD1 chromosome, complete genome	5633647	3574902	3634243	5633647	tRNA,capsid,tail,holin,portal,terminase,head,integrase	Klebsiella_phage(45.45%)	66	3583145:3583160	3639875:3639890
AYW20383.1|3574902_3575172_-	DUF4113 domain-containing protein	NA	I6RSM4	Salmonella_phage	79.7	4.6e-27
AYW22340.1|3575105_3575339_-	hypothetical protein	NA	I6RSM4	Salmonella_phage	80.4	2.8e-20
AYW20384.1|3575868_3576021_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
AYW20385.1|3576175_3577672_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	65.1	8.9e-128
AYW20386.1|3577733_3588950_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	49.3	0.0e+00
3583145:3583160	attL	GTATCTGCCCGCTGGC	NA	NA	NA	NA
AYW22341.1|3589012_3589603_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.0	4.3e-78
AYW20387.1|3589654_3590068_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	67.9	2.9e-52
AYW20388.1|3590109_3590820_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.7	8.5e-137
AYW20389.1|3590821_3591577_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	7.9e-125
AYW20390.1|3591573_3591912_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	6.4e-58
AYW20391.1|3591911_3595247_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.7	0.0e+00
AYW20392.1|3595246_3595459_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	88.9	3.7e-32
AYW20393.1|3595479_3595845_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AYW20394.1|3595902_3596364_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AYW20395.1|3596395_3596797_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
AYW20396.1|3596793_3597183_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	85.3	2.8e-57
AYW20397.1|3597163_3597502_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
AYW20398.1|3597498_3597816_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
AYW20399.1|3597796_3598057_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	1.6e-21
AYW20400.1|3598115_3599402_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
AYW20401.1|3599479_3600400_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	1.4e-147
AYW20402.1|3600436_3601696_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	6.2e-223
AYW20403.1|3601695_3601875_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
AYW20404.1|3601868_3603590_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
AYW20405.1|3603589_3604024_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
AYW20406.1|3604272_3604704_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.3	1.8e-41
AYW20407.1|3604700_3605018_-	hypothetical protein	NA	NA	NA	NA	NA
AYW20408.1|3604969_3605332_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
AYW20409.1|3605659_3606196_+	hypothetical protein	NA	NA	NA	NA	NA
AYW20410.1|3606253_3606493_-	hypothetical protein	NA	NA	NA	NA	NA
AYW22342.1|3606559_3607042_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AYW20411.1|3607074_3607605_-	lysozyme	NA	G9L6J6	Escherichia_phage	83.2	3.6e-84
AYW20412.1|3607582_3607819_-|holin	holin	holin	A5LH82	Enterobacteria_phage	82.6	4.0e-27
AYW20413.1|3608572_3608803_-	hypothetical protein	NA	Q8SBE1	Shigella_phage	68.8	1.3e-06
AYW20414.1|3608871_3610254_-	ATP-binding protein	NA	NA	NA	NA	NA
AYW20415.1|3610585_3611188_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	3.8e-77
AYW20416.1|3611204_3612236_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.3	1.1e-95
AYW20417.1|3612235_3612439_-	hypothetical protein	NA	NA	NA	NA	NA
AYW20418.1|3612435_3612828_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
AYW20419.1|3612868_3613159_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	60.9	1.4e-16
AYW20420.1|3613170_3613404_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	6.4e-25
AYW20421.1|3613805_3614102_-	hypothetical protein	NA	NA	NA	NA	NA
AYW20422.1|3614170_3615502_-	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.7	1.8e-42
AYW20423.1|3615836_3616481_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
AYW20424.1|3616646_3617141_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYW20425.1|3617460_3618915_-	glycosyl hydrolase family protein	NA	A0A0B5JD41	Pandoravirus	25.8	4.1e-29
AYW22343.1|3618917_3620255_-	PTS EIIC subunit	NA	NA	NA	NA	NA
AYW20426.1|3620356_3621103_-	transcriptional regulator, RpiR family protein	NA	NA	NA	NA	NA
AYW20427.1|3621083_3622049_-	C4-dicarboxylate transporter	NA	NA	NA	NA	NA
AYW20428.1|3622102_3623605_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AYW20429.1|3623801_3624242_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AYW20430.1|3624255_3624720_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	70.2	1.2e-62
AYW20431.1|3624712_3625696_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	57.1	1.9e-46
AYW20432.1|3625747_3626302_-	hypothetical protein	NA	NA	NA	NA	NA
AYW20433.1|3626304_3626520_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
AYW20434.1|3626621_3627011_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
AYW20435.1|3627625_3627844_+	hypothetical protein	NA	NA	NA	NA	NA
AYW20436.1|3627853_3628048_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYW20437.1|3628090_3628435_+	transcriptional regulator	NA	NA	NA	NA	NA
AYW20438.1|3628661_3628940_+	3'-5' exoribonuclease	NA	A0A2I7RDR9	Vibrio_phage	59.2	1.2e-22
AYW20439.1|3628992_3629238_+	excisionase	NA	NA	NA	NA	NA
AYW20440.1|3629218_3630346_+|integrase	integrase	integrase	O21925	Phage_21	58.4	9.7e-119
AYW20441.1|3630463_3631714_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
AYW20442.1|3631954_3632605_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AYW20443.1|3632621_3633080_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AYW22344.1|3633136_3634243_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
3639875:3639890	attR	GCCAGCGGGCAGATAC	NA	NA	NA	NA
>prophage 6
CP033631	Klebsiella sp. P1CD1 chromosome, complete genome	5633647	3876754	3886202	5633647	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
AYW20650.1|3876754_3878476_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.0	4.5e-14
AYW20651.1|3878515_3879220_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYW20652.1|3879571_3879790_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYW20653.1|3879908_3882188_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	3.7e-165
AYW20654.1|3882218_3882536_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AYW20655.1|3882861_3883083_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AYW20656.1|3883149_3885090_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	1.7e-38
AYW20657.1|3885086_3886202_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
