The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033817	Klebsiella aerogenes strain FDAARGOS_513 chromosome, complete genome	5259024	810542	878743	5259024	capsid,holin,terminase,integrase,head,plate,tRNA,lysis,portal,tail,protease	Escherichia_phage(31.11%)	74	843863:843906	874525:874568
AYX99309.1|810542_811643_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
AYX99310.1|811695_812055_-	YijD family membrane protein	NA	NA	NA	NA	NA
AYX99311.1|812070_812706_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
AYX99312.1|812902_814303_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AYX99313.1|814285_815203_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
AYX99314.1|815454_816828_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AYX99315.1|816929_817706_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AYX99316.1|817715_818720_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AYX99317.1|818833_819985_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
AYX99318.1|820242_822894_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AYX99319.1|822940_823591_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
AYX99320.1|823737_824595_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYX99321.1|824800_825463_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	33.5	1.0e-27
AYX99322.1|825517_826621_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
AYX99323.1|826658_827573_-	DMT family transporter	NA	NA	NA	NA	NA
AYX99324.1|827724_828612_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AYX99325.1|828913_831346_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
AYX99326.1|831348_832509_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AYX99327.1|832774_833092_+	met repressor	NA	NA	NA	NA	NA
AYX99328.1|833193_833406_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
AYX99329.1|833666_835862_+	primosomal protein N'	NA	NA	NA	NA	NA
AYX99330.1|836011_837040_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
AYX99331.1|837133_838102_+	cell division protein FtsN	NA	NA	NA	NA	NA
AYX99332.1|838193_838724_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
AYX99333.1|838733_840068_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.9	2.1e-43
AYY03353.1|840135_841062_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AYX99334.1|841154_841640_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AYX99335.1|841708_842671_-	6-phosphofructokinase	NA	NA	NA	NA	NA
AYX99336.1|842874_843771_-	CDF family cation-efflux pump FieF	NA	NA	NA	NA	NA
843863:843906	attL	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
AYX99337.1|844067_844484_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	51.5	5.7e-32
AYX99338.1|844519_844738_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	97.2	6.8e-37
AYX99339.1|844816_845983_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	95.1	2.4e-205
AYX99340.1|845979_846465_-|tail	phage tail protein	tail	O80317	Escherichia_phage	93.7	1.9e-79
AYX99341.1|846479_848921_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	86.8	0.0e+00
AYX99342.1|848913_849069_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	94.1	4.8e-21
AYX99343.1|849065_849401_-|tail	phage tail assembly protein	tail	Q37846	Escherichia_phage	85.3	4.0e-44
AYX99344.1|849463_849982_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	9.4e-93
AYX99345.1|849997_851176_-|tail	phage tail sheath protein	tail	Q37844	Escherichia_phage	94.6	1.6e-212
AYX99346.1|851307_851925_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	54.6	1.1e-52
AYY03354.1|851924_852878_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	53.8	2.8e-34
AYX99347.1|853810_854419_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	93.1	1.6e-107
AYX99348.1|854411_855320_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	96.7	2.0e-154
AYX99349.1|855326_855674_-|plate	baseplate assembly protein	plate	A0A218M4K8	Erwinia_phage	94.8	7.5e-54
AYX99350.1|855670_856312_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	93.4	4.4e-108
AYX99351.1|856380_856830_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	94.6	1.4e-68
AYX99352.1|856822_857290_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	98.7	2.1e-83
AYY03355.1|857252_857516_-|holin	holin	holin	S4TNY4	Salmonella_phage	92.0	8.8e-39
AYX99353.1|857397_857811_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	93.4	6.2e-63
AYX99354.1|857807_858305_-	lysozyme	NA	S4TUB1	Salmonella_phage	93.3	3.9e-88
AYX99355.1|858291_858588_-|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	95.9	1.9e-45
AYX99356.1|858590_858794_-|tail	phage tail protein	tail	A0A0M3ULF4	Salmonella_phage	91.0	8.3e-29
AYX99357.1|858793_859303_-|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	95.3	3.1e-88
AYX99358.1|859396_860146_-|terminase	terminase	terminase	O80305	Escherichia_phage	90.8	1.0e-111
AYX99359.1|860150_861218_-|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	97.2	1.8e-194
AYX99360.1|861294_862149_-|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	90.5	2.5e-143
AYX99361.1|862314_864084_+	oxidoreductase	NA	A0A218M4M1	Erwinia_phage	97.5	0.0e+00
AYX99362.1|864085_865132_+|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	94.3	8.3e-189
AYX99363.1|865558_866653_+	hypothetical protein	NA	Q7Y4B3	Escherichia_virus	63.6	3.2e-127
AYX99364.1|866649_867579_+	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	50.6	5.6e-96
AYX99365.1|867575_868514_-	DNA (cytosine-5-)-methyltransferase	NA	Q7Y4B5	Escherichia_virus	82.7	1.0e-158
AYX99366.1|868624_870898_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	76.2	0.0e+00
AYX99367.1|870887_871163_-	hypothetical protein	NA	M1TAP2	Escherichia_phage	74.4	7.0e-31
AYX99368.1|871159_871384_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	75.7	2.3e-24
AYX99369.1|871388_871685_-	hypothetical protein	NA	M1RZ07	Escherichia_phage	68.5	9.6e-26
AYX99370.1|871684_871909_-	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	79.7	1.5e-23
AYX99371.1|871972_872473_-	replication protein B	NA	M1SV55	Escherichia_phage	91.0	5.3e-85
AYX99372.1|872642_872915_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	83.3	1.1e-39
AYX99373.1|873062_873356_+	XRE family transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	70.1	2.1e-33
AYX99374.1|873425_874406_+|integrase	integrase	integrase	S4TP66	Salmonella_phage	95.1	2.8e-178
AYX99375.1|874591_875095_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
874525:874568	attR	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
AYX99376.1|875244_875943_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
AYX99377.1|875939_877313_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
AYX99378.1|877375_878050_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AYX99379.1|878122_878743_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.4	1.2e-62
>prophage 2
CP033817	Klebsiella aerogenes strain FDAARGOS_513 chromosome, complete genome	5259024	1536151	1544368	5259024		uncultured_Caudovirales_phage(85.71%)	10	NA	NA
AYX99979.1|1536151_1537372_+	DUF4102 domain-containing protein	NA	A0A2H4JB45	uncultured_Caudovirales_phage	69.8	3.6e-175
AYX99980.1|1537368_1538244_+	hypothetical protein	NA	NA	NA	NA	NA
AYY03378.1|1538353_1538563_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	88.4	5.5e-28
AYY03379.1|1539122_1539395_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	76.7	1.0e-34
AYX99981.1|1539387_1539612_+	aminotransferase	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	74.1	6.8e-16
AYX99982.1|1539608_1539977_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	82.8	3.1e-50
AYX99983.1|1539973_1541344_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	79.0	2.0e-203
AYX99984.1|1541580_1542048_-	hypothetical protein	NA	NA	NA	NA	NA
AYX99985.1|1542263_1542458_+	hypothetical protein	NA	NA	NA	NA	NA
AYX99986.1|1542454_1544368_+	peptidase	NA	K7PKX4	Enterobacterial_phage	57.4	2.0e-212
>prophage 3
CP033817	Klebsiella aerogenes strain FDAARGOS_513 chromosome, complete genome	5259024	2245558	2346171	5259024	capsid,holin,terminase,head,tRNA,portal,tail	Salmonella_phage(24.24%)	110	NA	NA
AYY00640.1|2245558_2247892_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	85.2	0.0e+00
AYY00641.1|2247906_2248227_-	hypothetical protein	NA	NA	NA	NA	NA
AYY00642.1|2248223_2248451_-	hypothetical protein	NA	NA	NA	NA	NA
AYY00643.1|2248447_2248999_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	72.2	4.4e-32
AYY00644.1|2249684_2250545_+|capsid	capsid protein	capsid	NA	NA	NA	NA
AYY00645.1|2250548_2250788_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	61.7	1.7e-20
AYY00646.1|2250803_2251370_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.4	2.3e-60
AYY00647.1|2251366_2251612_-	hypothetical protein	NA	NA	NA	NA	NA
AYY00648.1|2251694_2252756_+	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	37.7	1.0e-53
AYY00649.1|2252806_2254765_-	NACHT domain-containing protein	NA	X5JAK5	Clostridium_phage	33.6	3.2e-77
AYY00650.1|2254774_2255971_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	51.0	4.3e-109
AYY00651.1|2256247_2257438_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.2	2.2e-145
AYY00652.1|2257398_2257605_-	excisionase	NA	I6PBM8	Cronobacter_phage	73.8	2.4e-23
AYY00653.1|2257644_2258202_-	hypothetical protein	NA	A0A1B0V865	Salmonella_phage	37.0	1.7e-15
AYY00654.1|2258495_2258891_-	hypothetical protein	NA	K7P881	Enterobacteria_phage	55.9	4.1e-16
AYY00655.1|2258890_2259367_-	hypothetical protein	NA	NA	NA	NA	NA
AYY00656.1|2259644_2260094_-	hypothetical protein	NA	NA	NA	NA	NA
AYY00657.1|2260215_2260413_-	hypothetical protein	NA	NA	NA	NA	NA
AYY00658.1|2260412_2260940_-	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	68.6	6.7e-62
AYY00659.1|2261071_2261902_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	82.7	3.2e-127
AYY00660.1|2261954_2262326_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	81.3	3.7e-51
AYY00661.1|2263235_2263469_-	hypothetical protein	NA	Q56BD7	Escherichia_virus	38.2	7.3e-05
AYY00662.1|2263655_2264300_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.2	5.3e-37
AYY00663.1|2264394_2264604_+	cell division protein	NA	NA	NA	NA	NA
AYY00664.1|2264632_2265190_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	68.7	4.3e-67
AYY00665.1|2265186_2265384_+	hypothetical protein	NA	NA	NA	NA	NA
AYY03400.1|2265388_2266084_+	phage regulatory protein/antirepressor Ant	NA	A0A2I7RHG4	Vibrio_phage	51.4	5.5e-48
AYY00666.1|2266085_2266265_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AYY00667.1|2266261_2267158_+	GntR family transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	55.3	2.6e-34
AYY00668.1|2267154_2268045_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	72.4	1.6e-124
AYY00669.1|2268037_2270005_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	56.4	8.5e-211
AYY00670.1|2270001_2271054_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	56.2	3.1e-111
AYY00671.1|2271072_2271903_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	47.2	2.3e-56
AYY00672.1|2272113_2272308_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	81.5	1.1e-22
AYY00673.1|2272456_2273506_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	75.5	2.9e-165
AYY00674.1|2273958_2274381_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	78.5	2.2e-52
AYY00675.1|2274377_2274533_+	DUF3927 domain-containing protein	NA	A0A0A0YRI9	Escherichia_phage	70.8	1.9e-09
AYY00676.1|2274639_2275026_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	93.8	1.2e-57
AYY00677.1|2275012_2275294_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	51.6	8.0e-22
AYY00678.1|2275293_2275923_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	75.8	9.3e-87
AYY00679.1|2275925_2276201_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	64.4	6.4e-24
AYY00680.1|2276190_2276340_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	88.1	3.8e-15
AYY00681.1|2276506_2276800_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	71.1	2.2e-30
AYY00682.1|2276864_2277110_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	93.8	2.3e-33
AYY00683.1|2277181_2277403_+	hypothetical protein	NA	NA	NA	NA	NA
AYY00684.1|2277873_2279331_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	71.8	2.8e-211
AYY00685.1|2279312_2279906_+	hypothetical protein	NA	S4TR53	Salmonella_phage	71.6	8.8e-79
AYY00686.1|2279898_2280267_+	HNH endonuclease	NA	S4TTG9	Salmonella_phage	81.7	5.7e-52
AYY00687.1|2280446_2280956_+|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	68.0	1.3e-51
AYY00688.1|2280959_2282618_+|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	72.8	4.0e-238
AYY00689.1|2282675_2284610_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	94.9	0.0e+00
AYY00690.1|2284815_2286171_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	87.1	7.8e-232
AYY00691.1|2286167_2287211_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TNN1	Salmonella_phage	80.4	7.4e-105
AYY00692.1|2287207_2287534_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	59.3	2.8e-26
AYY00693.1|2287604_2287802_+	hypothetical protein	NA	K7PGR0	Enterobacteria_phage	78.5	1.3e-18
AYY00694.1|2287803_2288136_+|head,tail	head-tail adaptor protein	head,tail	K7PH08	Enterobacteria_phage	82.7	2.7e-45
AYY00695.1|2288128_2288668_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	81.9	1.8e-78
AYY00696.1|2288664_2289030_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	81.0	4.6e-54
AYY00697.1|2289088_2289571_+|tail	phage tail protein	tail	Q9MCU9	Escherichia_phage	58.6	7.5e-52
AYY00698.1|2289613_2289967_+|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	85.5	8.4e-53
AYY00699.1|2289999_2290263_+|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	88.5	1.0e-39
AYY00700.1|2290279_2290690_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	74.0	1.8e-51
AYY00701.1|2290751_2293184_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	81.8	0.0e+00
AYY00702.1|2293183_2293663_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.5	3.0e-61
AYY00703.1|2293649_2294132_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	73.8	2.7e-62
AYY00704.1|2294141_2294522_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	78.6	5.5e-58
AYY03401.1|2295007_2297554_+	kinase	NA	A0A286S259	Klebsiella_phage	70.2	0.0e+00
AYY00705.1|2299552_2300305_+	hypothetical protein	NA	A0A286S1R5	Klebsiella_phage	44.5	3.9e-47
AYY00706.1|2300772_2301063_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	43.5	1.7e-11
AYY00707.1|2301062_2301968_+	DUF4113 domain-containing protein	NA	I6RSM4	Salmonella_phage	61.1	2.2e-137
AYY00708.1|2301960_2302377_-	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	54.7	7.9e-42
AYY00709.1|2302817_2303792_-	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	52.3	4.2e-70
AYY03402.1|2304405_2304813_-	hypothetical protein	NA	NA	NA	NA	NA
AYY00710.1|2305525_2306008_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	5.2e-29
AYY00711.1|2306122_2306599_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AYY00712.1|2306588_2306879_+	RnfH family protein	NA	NA	NA	NA	NA
AYY00713.1|2306942_2307281_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYY00714.1|2307428_2309090_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AYY00715.1|2309176_2310055_-	NAD(+) kinase	NA	NA	NA	NA	NA
AYY00716.1|2310178_2310769_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYY00717.1|2310870_2312157_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AYY00718.1|2312174_2312966_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYY00719.1|2313132_2314497_+	signal recognition particle protein	NA	NA	NA	NA	NA
AYY00720.1|2314828_2315077_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYY00721.1|2315095_2315644_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYY00722.1|2315675_2316443_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AYY00723.1|2316482_2316830_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AYY00724.1|2316950_2317400_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AYY00725.1|2317456_2318827_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
AYY00726.1|2318832_2319312_-	OmpA family protein	NA	NA	NA	NA	NA
AYY00727.1|2319324_2320548_-	diguanylate cyclase	NA	NA	NA	NA	NA
AYY00728.1|2320540_2321227_-	YfiR family protein	NA	NA	NA	NA	NA
AYY00729.1|2321393_2322464_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	2.0e-89
AYY00730.1|2322473_2323595_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AYY00731.1|2323663_2324536_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AYY00732.1|2324532_2325693_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AYY03403.1|2325794_2325842_-	hypothetical protein	NA	NA	NA	NA	NA
AYY00733.1|2325956_2326292_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AYY00734.1|2326564_2327302_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AYY00735.1|2327433_2328414_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AYY00736.1|2328410_2329142_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AYY00737.1|2329271_2331845_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	2.0e-127
AYY00738.1|2337360_2337558_-	hypothetical protein	NA	NA	NA	NA	NA
AYY00739.1|2337872_2339171_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.2	1.5e-43
AYY00740.1|2339173_2339497_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
AYY00741.1|2339539_2340895_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AYY00742.1|2340991_2343667_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AYY00743.1|2343702_2344401_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AYY00744.1|2344470_2344896_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.0	3.5e-13
AYY00745.1|2345100_2346171_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 4
CP033817	Klebsiella aerogenes strain FDAARGOS_513 chromosome, complete genome	5259024	2412546	2480352	5259024	holin,terminase,tail,protease	Salmonella_phage(38.78%)	73	NA	NA
AYY00808.1|2412546_2414013_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	8.8e-88
AYY00809.1|2414082_2415660_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
AYY00810.1|2415852_2417103_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	81.4	2.2e-196
AYY00811.1|2417119_2417428_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	53.9	1.6e-23
AYY00812.1|2417427_2417730_-	hypothetical protein	NA	NA	NA	NA	NA
AYY00813.1|2417726_2418317_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.8	4.0e-108
AYY00814.1|2418309_2418606_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	69.7	5.2e-32
AYY00815.1|2418715_2418964_-	AlpA family phage regulatory protein	NA	A0A193GYW1	Enterobacter_phage	85.4	8.5e-36
AYY00816.1|2419014_2419896_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	86.3	1.3e-139
AYY00817.1|2419892_2420714_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	93.4	7.5e-153
AYY03405.1|2420925_2421225_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	49.5	6.1e-20
AYY00818.1|2421527_2422115_-	helix-turn-helix domain-containing protein	NA	G9L6A6	Escherichia_phage	61.0	6.3e-61
AYY00819.1|2422269_2422500_+	hypothetical protein	NA	A0A193GYK6	Enterobacter_phage	90.8	3.0e-35
AYY00820.1|2422648_2422858_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	81.2	8.0e-27
AYY00821.1|2422857_2423625_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	88.6	7.0e-137
AYY00822.1|2423621_2424407_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	89.3	1.4e-137
AYY00823.1|2424526_2424871_+	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	86.0	2.4e-52
AYY00824.1|2425060_2425642_+	hypothetical protein	NA	NA	NA	NA	NA
AYY00825.1|2425638_2425902_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	2.2e-29
AYY00826.1|2428112_2428343_+	hypothetical protein	NA	A0A2P1MXF0	Escherichia_phage	54.7	1.3e-17
AYY00827.1|2428342_2428681_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	85.5	1.6e-48
AYY03406.1|2428756_2429086_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	60.7	1.0e-28
AYY00828.1|2429143_2429728_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	84.5	1.2e-85
AYY00829.1|2429724_2431194_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	94.1	2.0e-281
AYY00830.1|2431229_2431505_-	hypothetical protein	NA	NA	NA	NA	NA
AYY00831.1|2432163_2432370_+	hypothetical protein	NA	T1SA67	Salmonella_phage	79.4	1.0e-05
AYY00832.1|2432384_2434064_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	81.2	2.4e-262
AYY00833.1|2434060_2434357_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	72.4	8.6e-35
AYY00834.1|2434362_2434632_+	hypothetical protein	NA	V5KSC6	Escherichia_phage	83.8	3.1e-23
AYY00835.1|2434642_2435341_+	peptidase	NA	G9L6C4	Escherichia_phage	86.2	4.8e-76
AYY00836.1|2435355_2436342_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.6	5.2e-177
AYY00837.1|2436395_2436833_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	93.1	1.8e-68
AYY00838.1|2436843_2437191_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	68.7	4.1e-36
AYY00839.1|2437241_2437565_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	86.0	3.1e-46
AYY00840.1|2437564_2438170_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	78.0	8.1e-88
AYY00841.1|2438169_2440647_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.6	0.0e+00
AYY00842.1|2440646_2441111_+	hypothetical protein	NA	T1SA73	Salmonella_phage	81.8	9.6e-73
AYY00843.1|2441110_2441653_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	66.1	5.3e-54
AYY00844.1|2441664_2444199_+	hypothetical protein	NA	Q858G0	Salmonella_phage	82.5	0.0e+00
AYY00845.1|2444198_2445764_+	hypothetical protein	NA	Q858F9	Salmonella_phage	66.9	6.1e-220
AYY00846.1|2445763_2448529_+	hypothetical protein	NA	Q858F8	Salmonella_phage	94.9	0.0e+00
AYY00847.1|2448665_2449055_+	hypothetical protein	NA	NA	NA	NA	NA
AYY03407.1|2449074_2449386_+	hypothetical protein	NA	NA	NA	NA	NA
AYY00848.1|2449410_2449950_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
AYY00849.1|2450229_2450910_-	BRO-like protein	NA	A0A193GYJ9	Enterobacter_phage	62.7	8.6e-78
AYY00850.1|2451227_2451488_-	hypothetical protein	NA	T1SA06	Salmonella_phage	82.4	1.9e-33
AYY00851.1|2451681_2454069_+|tail	phage tail protein	tail	R9TMK5	Aeromonas_phage	37.5	7.6e-89
AYY00852.1|2454072_2454333_+	hypothetical protein	NA	L0ARW5	Klebsiella_phage	56.6	6.2e-21
AYY00853.1|2454422_2454827_+	hypothetical protein	NA	T1SA79	Salmonella_phage	83.6	3.2e-56
AYY00854.1|2454813_2455119_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	6.0e-39
AYY00855.1|2455108_2455738_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	84.7	4.8e-99
AYY00856.1|2455734_2456235_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	5.9e-60
AYY00857.1|2456469_2456703_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AYY00858.1|2456733_2457066_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYY00859.1|2457100_2458309_-	MFS transporter	NA	NA	NA	NA	NA
AYY00860.1|2458407_2459301_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYY00861.1|2459304_2459514_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	76.7	2.5e-20
AYY00862.1|2459866_2462098_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AYY00863.1|2462146_2463673_-	exopolyphosphatase	NA	NA	NA	NA	NA
AYY00864.1|2463676_2465737_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
AYY03408.1|2465914_2467573_+	hypothetical protein	NA	NA	NA	NA	NA
AYY00865.1|2467578_2468676_-	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
AYY00866.1|2468650_2470102_-	MFS transporter	NA	NA	NA	NA	NA
AYY00867.1|2470522_2471863_+	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
AYY00868.1|2471916_2472558_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.8	1.9e-31
AYY00869.1|2472554_2473592_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	1.1e-71
AYY00870.1|2473699_2473819_+	hypothetical protein	NA	NA	NA	NA	NA
AYY00871.1|2473841_2475272_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AYY00872.1|2475468_2476095_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AYY00873.1|2476191_2477478_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	8.3e-66
AYY00874.1|2477576_2478278_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
AYY00875.1|2478519_2478879_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
AYY00876.1|2478888_2480352_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
