The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033862	Acinetobacter sp. FDAARGOS_560 chromosome, complete genome	4075289	763830	776178	4075289		Acinetobacter_phage(95.65%)	24	NA	NA
AYY16415.1|763830_764553_-	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.7e-55
AYY16416.1|764549_764957_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
AYY16417.1|764957_765209_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	6.4e-39
AYY16418.1|765210_766143_-	hypothetical protein	NA	A0A0P0I438	Acinetobacter_phage	80.0	2.2e-137
AYY16419.1|766139_767261_-	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	2.8e-211
AYY16420.1|767272_767596_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	95.3	4.8e-55
AYY16421.1|767588_767879_-	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	5.1e-48
AYY16422.1|767878_768322_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
AYY16423.1|768515_768758_+	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
AYY16424.1|768764_768968_-	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
AYY16425.1|769106_769610_-	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
AYY16426.1|769611_770619_-	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
AYY16427.1|770670_770886_-	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
AYY16428.1|770900_771653_-	LexA family transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	74.3	5.5e-102
AYY16429.1|771757_771946_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16430.1|771956_772277_+	XRE family transcriptional regulator	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
AYY16431.1|772332_772611_+	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	90.2	6.6e-37
AYY16432.1|772682_772907_+	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	97.3	3.2e-34
AYY16433.1|772899_773781_+	MarR family transcriptional regulator	NA	A0A0P0IKQ2	Acinetobacter_phage	95.2	3.3e-138
AYY16434.1|773783_774584_+	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	95.5	2.8e-144
AYY16435.1|774580_774919_+	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	56.3	1.1e-30
AYY16436.1|774911_775304_+	hypothetical protein	NA	J7HXM5	Acinetobacter_phage	57.8	1.2e-07
AYY16437.1|775303_775705_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	2.6e-66
AYY16438.1|775701_776178_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
>prophage 2
CP033862	Acinetobacter sp. FDAARGOS_560 chromosome, complete genome	4075289	780136	808810	4075289	tail,terminase,head	Acinetobacter_phage(93.75%)	38	NA	NA
AYY16445.1|780136_780592_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	2.7e-80
AYY16446.1|780652_781087_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	84.7	7.4e-67
AYY16447.1|781055_781697_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	88.7	6.3e-115
AYY16448.1|781755_782271_+	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
AYY16449.1|782230_783523_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.0	6.4e-215
AYY16450.1|783562_784903_+	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	92.2	3.4e-235
AYY16451.1|784912_786019_+|head	phage head morphogenesis protein	head	A0A0P0IR98	Acinetobacter_phage	90.2	2.1e-190
AYY16452.1|786015_786246_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16453.1|786465_786780_+	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.5	5.2e-14
AYY16454.1|786866_787658_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	74.2	2.3e-90
AYY16455.1|787671_788622_+	methyltransferase	NA	A0A0P0HSG2	Acinetobacter_phage	94.9	3.7e-172
AYY16456.1|788666_789002_+	HeH/LEM domain protein	NA	A0A0N7IRE4	Acinetobacter_phage	100.0	2.7e-53
AYY16457.1|789005_789386_+	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.9	6.9e-53
AYY16458.1|789386_789755_+	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	92.6	8.7e-61
AYY16459.1|789823_790021_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16460.1|790028_790322_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16461.1|790373_790784_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.3	7.7e-50
AYY16462.1|790755_791124_+	HK97 gp10 family phage protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.8	2.0e-52
AYY16463.1|791080_791524_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	94.6	2.0e-75
AYY16464.1|791525_791744_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
AYY16465.1|791852_792374_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYY16466.1|792470_792824_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
AYY16467.1|792823_794002_+|tail	phage tail protein	tail	A0A0D4DCQ4	Acinetobacter_phage	66.3	1.2e-103
AYY16468.1|794054_794972_+	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
AYY16469.1|795041_795557_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
AYY16470.1|795484_795814_+	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	55.1	4.5e-24
AYY16471.1|796059_796359_+	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
AYY16472.1|796367_796826_+	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
AYY16473.1|796930_797611_+	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
AYY16474.1|797612_797876_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16475.1|798003_802314_+|tail	phage tail tape measure protein	tail	A0A0D4DC37	Acinetobacter_phage	98.3	0.0e+00
AYY16476.1|802404_802992_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16477.1|803084_803483_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	4.1e-72
AYY16478.1|803482_803989_+	DUF1833 domain-containing protein	NA	J7HXQ5	Acinetobacter_phage	97.0	1.5e-90
AYY16479.1|803985_804348_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	8.1e-51
AYY16480.1|804340_807766_+	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	94.2	0.0e+00
AYY16481.1|807833_808223_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
AYY19454.1|808264_808810_+	hypothetical protein	NA	A0A0B5L5G7	Acinetobacter_phage	100.0	4.7e-103
>prophage 3
CP033862	Acinetobacter sp. FDAARGOS_560 chromosome, complete genome	4075289	860398	920261	4075289	integrase,tRNA,transposase	Escherichia_phage(43.48%)	64	867707:867766	890128:892648
AYY16518.1|860398_861103_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYY16519.1|861339_862056_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	2.4e-139
AYY16520.1|862055_862364_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AYY16521.1|862381_864064_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.0	7.4e-38
AYY16522.1|864102_864510_-	mercury transporter MerC	NA	NA	NA	NA	NA
AYY16523.1|864537_864819_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
AYY16524.1|864834_865185_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AYY16525.1|865256_865712_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AYY16526.1|865778_866867_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AYY19459.1|866856_867639_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
867707:867766	attL	GATATCGACAACCTCTCGCGCAACCAAGACATCGCGGTCGGACTGCAAGTGATCTTGAAG	NA	NA	NA	NA
AYY16527.1|867814_868315_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYY16528.1|868333_868513_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16529.1|868442_869282_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AYY16530.1|869275_869623_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AYY16531.1|870290_870995_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYY16532.1|870885_871845_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.3e-47
AYY16533.1|872049_872601_+	AAC(6')-Ia family aminoglycoside 6'-N-acetyltransferase AacA16	NA	NA	NA	NA	NA
AYY16534.1|873132_873837_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYY16535.1|874570_875128_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AYY16536.1|875310_876171_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AYY16537.1|876241_876946_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYY16538.1|879969_880629_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.4e-37
AYY16539.1|880640_881345_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYY16540.1|881611_881791_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16541.1|881944_882760_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
AYY16542.1|882889_883594_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYY16543.1|884085_885099_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
AYY16544.1|885269_885734_+	AAC(3)-I family aminoglycoside 3-N-acetyltransferase	NA	NA	NA	NA	NA
AYY16545.1|885852_886365_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYY16546.1|886249_886903_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYY16547.1|886918_887224_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16548.1|887315_888107_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AYY16549.1|888270_888618_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AYY16550.1|888611_889451_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AYY16551.1|889380_889560_-	hypothetical protein	NA	NA	NA	NA	NA
AYY16552.1|889578_890079_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYY16553.1|890384_890498_-	NTP-binding protein	NA	NA	NA	NA	NA
AYY16554.1|890718_891423_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYY16555.1|891413_891608_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AYY16556.1|891733_892294_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYY16557.1|893327_894032_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
890128:892648	attR	CTTCAAGATCACTTGCAGTCCGACCGCGATGTCTTGGTTGCGCGAGAGGTTGTCGATATCCTCCACTTCCATCATCAACCCTGGATAATGCCGCCGCCGTCATCGCCGCCGACGCCCGTGCCGGGCTTTTCGGGCCTGTCAGGCTTGCTCGGCCTTCAGCCTGCCTGGGCGAGATCTCCGGCGGACGGATTAACGGCGGAGCTTCGCCGCCTTTCGTGCGTGTGAAGGCCGAAGATAGTTCTCTCAAAAACATCCGTTTATGAGAGATACCAAATGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCAGCTCCTGACAGTTCAATATCAGAAGTGATCTGCACCAATCTCGACTATGCTCAATACTCGTGTGGGCTCTGTTGCAAAAATCGTGAAGCTTGAGCATGCTTGGCGGAGATTGGACGGACGGAACGATGACGGATTTCAAGTGGCGCCATTTCCAGGGTGATGTGATCCTGTGGGCGGTGCGCTGGTATTGTCGCTATCCGATCAGCGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGGGCCGAGTACGTGGAGCATTTCTGCGGGCTGGAGTGCTATCAGCGCTTCCAGGCGCGGGCCAGCACTGCGACCGAAACCAGCGTCAAACCGGACGCTTGTGATTCGCCGCCGTCAGGTTGAGGCATACCCTAACCTGATGTCAGATGCCATGTGTAAATTGCGTCAGGATAGGATTGAATTTTGAATTTATTGACATATCTCGTTGAAGGTCATAGAGTCTTCCCTGACATTTTGCAGGGAATTCCATGACTGGACAGCGCATTGGGTATATCAGGGTCAGCACCTTCGACCAGAACCCGGAACGGCAACTGGAAGGCGTCAAGGTTGATCGCGCTTTTAGCGACAAGGCATCCGGCAAGGATGTCAAGCGTCCGCAACTGGAAGCGCTGATAAGCTTCGCCCGCACCGGCGACACCGTGGTGGTGCATAGCATGGATCGCCTGGCGCGCAATCTCGATGATTTGCGCCGGATCGTGCAAACGCTGACACAACGCGGCGTGCATATCGAATTCGTCAAGGAACACCTCAGTTTTACTGGCGAAGACTCTCCGATGGCGAACCTGATGCTCTCGGTGATGGGCGCGTTCGCCGAGTTCGAGCGCGCCCTGATCCGCGAGCGTCAGCGCGAGGGTATTGCGCTCGCCAAGCAACGCGGGGCTTACCGTGGCAGGAAGAAATCCCTGTCGTCTGAGCGTATTGCCGAACTGCGCCAACGTGTCGAGGCTGGCGAGCAAAAGACCAAGCTTGCTCGTGAATTCGGAATCAGTCGCGAAACCCTGTATCAATACTTGAGAACGGATCAGTAAATATGCCACGTCGTTCCATCCTGTCCGCCGCCGAGCGGGAAAGCCTGCTGGCGTTGCCGGACTCCAAGGACGACCTGATCCGACATTACACATTCAACGATACCGACCTCTCGATCATCCGACAGCGGCGCGGGCCAGCCAATCGGCTGGGCTTCGCGGTGCAGCTCTGTTACCTGCGCTTTCCCGGCGTCATCCTGGGCGTCGATGAACTACCGTTCCCGCCCTTGTTGAAGCTGGTCGCCGACCAGCTCAAGGTCGGCGTCGAAAGCTGGAACGAGTACGGCCAGCGGGAGCAGACCCGGCGCGAGCACCTGAGCGAGCTGCAAACCGTGTTCGGTTTCCGGCCCTTCACCA	NA	NA	NA	NA
AYY16558.1|894864_895698_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYY16559.1|895760_896720_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYY16560.1|897244_897868_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYY16561.1|897932_898655_-	pirin family protein	NA	NA	NA	NA	NA
AYY16562.1|899165_900128_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYY16563.1|900193_901024_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYY16564.1|901047_902598_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AYY16565.1|902966_903194_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16566.1|903516_904836_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	7.8e-59
AYY16567.1|904947_905946_+	adenosine deaminase	NA	NA	NA	NA	NA
AYY16568.1|905989_906547_-	cytochrome b	NA	NA	NA	NA	NA
AYY16569.1|906785_907175_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16570.1|907240_907807_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	1.8e-25
AYY16571.1|907876_908131_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
AYY16572.1|908377_909658_-	aspartate kinase	NA	NA	NA	NA	NA
AYY16573.1|909723_912360_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.8e-75
AYY16574.1|912629_913655_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYY16575.1|913930_915097_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
AYY16576.1|915161_916481_+	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.0	4.8e-69
AYY16577.1|916603_916921_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16578.1|917031_917817_+	M48 family peptidase	NA	NA	NA	NA	NA
AYY16579.1|917876_918926_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AYY16580.1|919170_920261_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
>prophage 4
CP033862	Acinetobacter sp. FDAARGOS_560 chromosome, complete genome	4075289	968141	1028271	4075289	integrase,tail,transposase,head,tRNA,terminase	Acinetobacter_phage(29.73%)	68	981659:981714	1023108:1023163
AYY16625.1|968141_968375_+|transposase	transposase	transposase	NA	NA	NA	NA
AYY16626.1|968526_969198_-	LexA family transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	55.2	3.1e-64
AYY16627.1|969433_969631_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16628.1|969798_970188_+	hypothetical protein	NA	A0A0P0IVR6	Acinetobacter_phage	74.4	1.1e-48
AYY16629.1|970225_970771_+	hypothetical protein	NA	A0A0N7IRF5	Acinetobacter_phage	72.9	7.8e-74
AYY16630.1|970837_971455_-	LysE family translocator	NA	NA	NA	NA	NA
AYY16631.1|971974_972190_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	65.0	7.7e-17
AYY16632.1|972393_972618_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16633.1|972897_973713_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AYY16634.1|973869_973989_-	hypothetical protein	NA	NA	NA	NA	NA
AYY16635.1|974473_974932_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.8	3.5e-27
AYY16636.1|975223_975568_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16637.1|975665_976772_+|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	66.9	4.5e-145
AYY16638.1|976766_977981_-	MFS transporter	NA	NA	NA	NA	NA
AYY16639.1|978092_978539_+	transcriptional regulator	NA	NA	NA	NA	NA
AYY19460.1|978688_978955_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16640.1|978968_979115_+	peptidoglycan-binding protein	NA	A0A0B5KTG2	Acinetobacter_phage	100.0	3.4e-08
AYY16641.1|979694_980288_+	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
AYY16642.1|980672_981302_+	hypothetical protein	NA	NA	NA	NA	NA
981659:981714	attL	AATTTTGGAGCGGGAAACGAGACTCGAACTCGCGACCCCAACCTTGGCAAGGTTAT	NA	NA	NA	NA
AYY16643.1|981858_982116_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16644.1|982139_982436_-	hypothetical protein	NA	NA	NA	NA	NA
AYY16645.1|982497_983895_-	DEAD/DEAH box helicase	NA	Q774Z8	Bordetella_phage	69.9	9.3e-196
AYY16646.1|983891_984182_-	hypothetical protein	NA	NA	NA	NA	NA
AYY16647.1|984174_984444_-	VRR-NUC domain-containing protein	NA	Q775A2	Bordetella_phage	70.9	1.0e-26
AYY16648.1|984443_985268_-	hypothetical protein	NA	A0A2I7RWZ3	Vibrio_phage	51.0	1.1e-68
AYY16649.1|985272_987348_-	DNA polymerase I	NA	Q775A3	Bordetella_phage	65.6	1.6e-263
AYY16650.1|987446_988295_-	DUF2303 family protein	NA	I3PUY7	Vibrio_phage	27.1	1.4e-21
AYY16651.1|988331_988658_-	hypothetical protein	NA	NA	NA	NA	NA
AYY16652.1|988832_989390_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	60.2	5.4e-62
AYY16653.1|989395_990688_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	44.8	6.6e-95
AYY16654.1|990843_991314_-	hypothetical protein	NA	NA	NA	NA	NA
AYY16655.1|991459_992125_-	XRE family transcriptional regulator	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	66.2	3.5e-52
AYY16656.1|992276_992528_+	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	46.3	4.0e-09
AYY16657.1|992524_992890_+	hypothetical protein	NA	A0A2P9HY19	Yersinia_phage	54.5	4.4e-20
AYY16658.1|992891_993110_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16659.1|993111_993519_+	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	35.8	6.8e-06
AYY16660.1|993515_996116_+	DNA primase	NA	Q775B5	Bordetella_phage	55.8	1.8e-280
AYY16661.1|996325_996535_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16662.1|996534_997272_+|terminase	terminase small subunit	terminase	A0A1Y0SUQ3	Pseudomonas_phage	48.6	4.8e-50
AYY16663.1|997264_997474_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16664.1|997806_999429_+|terminase	terminase	terminase	Q775B9	Bordetella_phage	60.8	3.1e-190
AYY16665.1|999506_999791_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16666.1|999792_1001484_+|head,tail	phage head-tail adapter protein	head,tail	G9L6C2	Escherichia_phage	31.2	1.6e-69
AYY16667.1|1001480_1001813_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16668.1|1001778_1002444_+	hypothetical protein	NA	A0A2I7RHR0	Vibrio_phage	35.6	1.0e-11
AYY16669.1|1002455_1003478_+	hypothetical protein	NA	Q775C7	Bordetella_phage	50.3	1.2e-88
AYY16670.1|1003491_1003896_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16671.1|1003910_1004096_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16672.1|1004160_1004526_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	53.3	2.6e-25
AYY16673.1|1004540_1005095_+	hypothetical protein	NA	W6MVD9	Pseudomonas_phage	26.2	2.4e-06
AYY16674.1|1005095_1007111_+	hypothetical protein	NA	Q775D1	Bordetella_phage	38.8	7.5e-130
AYY16675.1|1007107_1007578_+	DUF2833 domain-containing protein	NA	NA	NA	NA	NA
AYY16676.1|1007574_1008246_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16677.1|1008246_1010496_+	transglycosylase	NA	NA	NA	NA	NA
AYY16678.1|1010495_1010909_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16679.1|1010992_1017811_+	N-acetyltransferase	NA	Q775D4	Bordetella_phage	24.2	2.0e-102
AYY19461.1|1017904_1020190_+|tail	phage tail protein	tail	A0A0P0IRG3	Acinetobacter_phage	94.1	0.0e+00
AYY16680.1|1020191_1020416_+	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	83.6	1.3e-27
AYY16681.1|1020521_1020893_+	hypothetical protein	NA	A0A2H4JFC0	uncultured_Caudovirales_phage	62.6	2.0e-36
AYY16682.1|1020903_1021521_+	lysozyme	NA	A0A075DXC6	Acinetobacter_phage	63.5	3.9e-69
AYY16683.1|1021658_1021856_+	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	71.1	6.8e-12
AYY16684.1|1021884_1022898_-|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	40.3	2.9e-66
AYY16685.1|1023251_1024673_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.6	3.3e-55
1023108:1023163	attR	AATTTTGGAGCGGGAAACGAGACTCGAACTCGCGACCCCAACCTTGGCAAGGTTAT	NA	NA	NA	NA
AYY16686.1|1024886_1025864_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	9.5e-38
AYY16687.1|1025867_1026407_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
AYY16688.1|1026444_1026993_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AYY16689.1|1026976_1027525_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
AYY16690.1|1027524_1028271_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.1e-20
>prophage 5
CP033862	Acinetobacter sp. FDAARGOS_560 chromosome, complete genome	4075289	1348616	1420794	4075289	integrase,tail,protease,holin,capsid,portal,head,tRNA,terminase	Acinetobacter_phage(33.33%)	87	1348456:1348474	1386271:1386289
1348456:1348474	attL	AAACGCACCATTTGGTGCG	NA	NA	NA	NA
AYY16971.1|1348616_1349576_+|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	37.8	2.9e-47
AYY16972.1|1349541_1349793_-	hypothetical protein	NA	NA	NA	NA	NA
AYY16973.1|1349789_1350077_-	hypothetical protein	NA	NA	NA	NA	NA
AYY16974.1|1350079_1350841_-	phage antirepressor protein	NA	A0A0P0IDX3	Acinetobacter_phage	57.3	8.7e-71
AYY16975.1|1350840_1351230_-	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	85.9	2.7e-28
AYY16976.1|1351231_1351708_-	hypothetical protein	NA	NA	NA	NA	NA
AYY16977.1|1351710_1351947_-	hypothetical protein	NA	NA	NA	NA	NA
AYY16978.1|1351930_1352401_-	hypothetical protein	NA	NA	NA	NA	NA
AYY16979.1|1352403_1352694_-	hypothetical protein	NA	NA	NA	NA	NA
AYY16980.1|1352940_1353645_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PKV4	Moraxella_phage	45.1	1.2e-53
AYY16981.1|1353772_1354006_+	hypothetical protein	NA	A0A2H4J114	uncultured_Caudovirales_phage	50.0	3.8e-09
AYY16982.1|1354066_1354363_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16983.1|1354362_1355247_+	DUF1376 domain-containing protein	NA	A0A2I7RGZ2	Vibrio_phage	63.4	4.6e-31
AYY16984.1|1355246_1356578_+	DNA helicase	NA	A0A0P0IVX0	Acinetobacter_phage	54.9	1.0e-127
AYY16985.1|1356574_1356853_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16986.1|1356849_1357467_+	hypothetical protein	NA	A0A068CBJ8	Acinetobacter_phage	45.1	1.1e-07
AYY16987.1|1357459_1357741_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16988.1|1357737_1358232_+	hypothetical protein	NA	A0A0P0I4C3	Acinetobacter_phage	35.5	2.2e-19
AYY16989.1|1358297_1359194_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16990.1|1359430_1359658_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16991.1|1360029_1360416_+	hypothetical protein	NA	A0A172Q0N8	Acinetobacter_phage	65.6	1.4e-40
AYY16992.1|1360453_1360984_+	hypothetical protein	NA	A0A2H4JB76	uncultured_Caudovirales_phage	43.4	7.4e-37
AYY16993.1|1360973_1361198_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16994.1|1361203_1361491_+	hypothetical protein	NA	NA	NA	NA	NA
AYY16995.1|1361423_1361753_+	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	53.8	7.4e-27
AYY16996.1|1361886_1362369_+|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	48.4	4.6e-25
AYY16997.1|1362558_1364259_+|terminase	terminase large subunit	terminase	A0A2H4J559	uncultured_Caudovirales_phage	61.8	1.5e-195
AYY16998.1|1364255_1365482_+|portal	phage portal protein	portal	A0A2H4J6S3	uncultured_Caudovirales_phage	75.4	2.2e-180
AYY16999.1|1365474_1366137_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	62.3	6.2e-73
AYY17000.1|1366129_1367302_+|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	47.2	9.2e-88
AYY17001.1|1367522_1367810_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	46.5	2.5e-18
AYY17002.1|1367811_1368168_+|head,tail	head-tail adaptor protein	head,tail	A0A1J0GUY4	Halomonas_phage	50.0	1.2e-19
AYY17003.1|1368171_1368657_+	hypothetical protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	44.7	2.2e-27
AYY17004.1|1368656_1369028_+	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	47.9	1.1e-21
AYY17005.1|1369103_1369577_+	structural protein 3 family protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	61.1	7.8e-54
AYY17006.1|1369576_1370092_+	hypothetical protein	NA	NA	NA	NA	NA
AYY17007.1|1370127_1370343_+	hypothetical protein	NA	NA	NA	NA	NA
AYY17008.1|1370419_1370749_+	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	43.1	2.9e-15
AYY17009.1|1370814_1374489_+	replication protein	NA	A0A0U4JEA4	Pseudomonas_phage	40.4	6.1e-45
AYY17010.1|1374565_1374907_+|tail	phage tail protein	tail	NA	NA	NA	NA
AYY17011.1|1374960_1376103_+|tail	phage tail protein	tail	A0A0N7IRE5	Acinetobacter_phage	93.7	1.9e-130
AYY17012.1|1376089_1376899_+|tail	phage minor tail protein L	tail	A0A0R6PIJ5	Moraxella_phage	63.6	1.2e-91
AYY17013.1|1376905_1377661_+|tail	phage tail protein	tail	A0A0R6PIM4	Moraxella_phage	56.6	1.2e-85
AYY17014.1|1377644_1378310_+|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	47.7	3.9e-43
AYY17015.1|1378366_1384348_+|tail	phage tail protein	tail	A0A0R6PIC9	Moraxella_phage	64.6	0.0e+00
AYY17016.1|1384347_1384527_+	hypothetical protein	NA	NA	NA	NA	NA
AYY17017.1|1384593_1384869_+|holin	holin	holin	NA	NA	NA	NA
AYY17018.1|1384852_1385362_+	lysozyme	NA	A0A0B5L5F7	Acinetobacter_phage	58.6	5.8e-47
AYY17019.1|1385361_1385730_+	hypothetical protein	NA	NA	NA	NA	NA
AYY17020.1|1385680_1385869_+	hypothetical protein	NA	NA	NA	NA	NA
AYY17021.1|1385965_1386163_+	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	58.9	3.6e-13
AYY17022.1|1386299_1387049_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
1386271:1386289	attR	AAACGCACCATTTGGTGCG	NA	NA	NA	NA
AYY17023.1|1387211_1387757_-	acyltransferase	NA	NA	NA	NA	NA
AYY17024.1|1387942_1388503_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYY17025.1|1388777_1389641_+	hypothetical protein	NA	NA	NA	NA	NA
AYY17026.1|1390072_1391305_+	DUF4102 domain-containing protein	NA	A0A0R6PHM8	Moraxella_phage	43.3	6.5e-84
AYY17027.1|1391889_1392789_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYY17028.1|1392878_1393316_+	PACE efflux transporter	NA	NA	NA	NA	NA
AYY17029.1|1393373_1394789_-	cytosine permease	NA	NA	NA	NA	NA
AYY17030.1|1395041_1395506_-	hypothetical protein	NA	NA	NA	NA	NA
AYY19476.1|1395618_1396536_-	DMT family transporter	NA	NA	NA	NA	NA
AYY17031.1|1396642_1397494_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYY17032.1|1397533_1397713_-	hypothetical protein	NA	NA	NA	NA	NA
AYY17033.1|1398289_1399309_-	fimbrial protein	NA	NA	NA	NA	NA
AYY17034.1|1399305_1401735_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AYY17035.1|1401894_1402635_-	molecular chaperone	NA	NA	NA	NA	NA
AYY17036.1|1402705_1403242_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYY17037.1|1403687_1404038_+	hypothetical protein	NA	NA	NA	NA	NA
AYY17038.1|1404101_1404314_+	hypothetical protein	NA	NA	NA	NA	NA
AYY17039.1|1404360_1405350_-	biotin synthase	NA	NA	NA	NA	NA
AYY17040.1|1405449_1406538_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AYY17041.1|1406566_1408027_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AYY17042.1|1408038_1408584_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
AYY17043.1|1408813_1409407_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYY17044.1|1409403_1409949_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYY17045.1|1410017_1410842_-	OXA-51 family carbapenem-hydrolyzing class D beta-lactamase OXA-66	NA	NA	NA	NA	NA
AYY17046.1|1411240_1411801_+	FxsA family protein	NA	NA	NA	NA	NA
AYY17047.1|1411864_1412050_-	hypothetical protein	NA	NA	NA	NA	NA
AYY17048.1|1412308_1412557_+	hypothetical protein	NA	NA	NA	NA	NA
AYY17049.1|1412680_1413847_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	61.6	1.4e-125
AYY17050.1|1414370_1416359_+	transketolase	NA	NA	NA	NA	NA
AYY17051.1|1416413_1416821_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AYY17052.1|1417035_1417626_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AYY17053.1|1417671_1418262_-|holin	phosphatidylcholine--retinol O-acyltransferase	holin	NA	NA	NA	NA
AYY17054.1|1418447_1419194_+	hypothetical protein	NA	NA	NA	NA	NA
AYY17055.1|1419229_1419460_-	hypothetical protein	NA	NA	NA	NA	NA
AYY17056.1|1419708_1420794_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
>prophage 6
CP033862	Acinetobacter sp. FDAARGOS_560 chromosome, complete genome	4075289	2021720	2060842	4075289	transposase,plate,terminase,head	Acinetobacter_phage(98.25%)	57	NA	NA
AYY17594.1|2021720_2022293_-	hypothetical protein	NA	A0A0P0HSM0	Acinetobacter_phage	99.5	1.6e-98
AYY17595.1|2022319_2022967_-	hypothetical protein	NA	J7I4R4	Acinetobacter_phage	100.0	3.6e-118
AYY17596.1|2023845_2024391_-	hypothetical protein	NA	A0A0N7IRF5	Acinetobacter_phage	100.0	1.8e-102
AYY17597.1|2024433_2024823_-	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	100.0	1.1e-66
AYY17598.1|2024900_2025128_-	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	100.0	3.0e-35
AYY17599.1|2025129_2027184_-	hypothetical protein	NA	A0A0P0IRG3	Acinetobacter_phage	100.0	0.0e+00
AYY17600.1|2027247_2027856_-	hypothetical protein	NA	A0A0P0IE19	Acinetobacter_phage	100.0	6.2e-112
AYY17601.1|2027848_2028439_-	DUF2612 domain-containing protein	NA	A0A0P0IKZ0	Acinetobacter_phage	100.0	8.7e-111
AYY17602.1|2028438_2029623_-|plate	phage baseplate protein	plate	A0A0P0I499	Acinetobacter_phage	100.0	7.1e-221
AYY17603.1|2029625_2029979_-	hypothetical protein	NA	A0A0P0IVU6	Acinetobacter_phage	100.0	1.4e-63
AYY17604.1|2030013_2030676_-	hypothetical protein	NA	A0A0N7IRF4	Acinetobacter_phage	100.0	5.1e-128
AYY17605.1|2030678_2031638_-	hypothetical protein	NA	A0A0P0HSL6	Acinetobacter_phage	100.0	3.1e-182
AYY17606.1|2031634_2031931_-	hypothetical protein	NA	A0A0P0J0D9	Acinetobacter_phage	100.0	7.3e-50
AYY17607.1|2031933_2032530_-	hypothetical protein	NA	A0A0P0IKS1	Acinetobacter_phage	100.0	7.9e-104
AYY17608.1|2032696_2032885_-	hypothetical protein	NA	A0A0P0IYB4	Acinetobacter_phage	100.0	6.5e-28
AYY17609.1|2032889_2033117_+	hypothetical protein	NA	A0A0P0I8G2	Acinetobacter_phage	100.0	1.5e-31
AYY17610.1|2033116_2033473_+	DUF1311 domain-containing protein	NA	A0A0P0IRF2	Acinetobacter_phage	100.0	4.5e-62
AYY17611.1|2033469_2035494_-	hypothetical protein	NA	A0A0P0IE11	Acinetobacter_phage	100.0	0.0e+00
AYY19500.1|2035501_2035714_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	46.9	1.3e-05
AYY17612.1|2035689_2036151_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	100.0	1.2e-78
AYY17613.1|2036150_2036594_-	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	100.0	3.3e-78
AYY17614.1|2036608_2038084_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	100.0	3.7e-275
AYY17615.1|2038087_2038627_-	hypothetical protein	NA	A0A0P0IVT9	Acinetobacter_phage	100.0	3.3e-101
AYY17616.1|2038629_2038998_-	hypothetical protein	NA	A0A0P0HSK8	Acinetobacter_phage	100.0	5.9e-65
AYY17617.1|2038984_2039545_-	hypothetical protein	NA	A0A0P0J0D1	Acinetobacter_phage	100.0	5.2e-97
AYY17618.1|2039541_2039928_-	DUF4054 domain-containing protein	NA	A0A0P0IKR4	Acinetobacter_phage	100.0	2.3e-67
AYY17619.1|2039931_2040363_-	hypothetical protein	NA	A0A0P0IYA6	Acinetobacter_phage	100.0	8.1e-58
AYY17620.1|2040372_2041398_-	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	100.0	1.7e-194
AYY17621.1|2041462_2041939_-	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	100.0	3.0e-85
AYY17622.1|2041942_2043259_-	DUF2213 domain-containing protein	NA	A0A0P0IRE1	Acinetobacter_phage	100.0	3.5e-213
AYY17623.1|2043547_2044183_-|head	phage head morphogenesis protein	head	A0A0P0IKX5	Acinetobacter_phage	100.0	7.1e-119
AYY17624.1|2044205_2045618_-	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	100.0	4.6e-259
AYY17625.1|2045628_2047287_-|terminase	terminase	terminase	A0A0P0IVT4	Acinetobacter_phage	100.0	0.0e+00
AYY17626.1|2047283_2047793_-	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	100.0	1.2e-89
AYY17627.1|2047840_2048488_-|transposase	transposase	transposase	A0A0N7IRF1	Acinetobacter_phage	100.0	5.0e-128
AYY17628.1|2048582_2049341_-	hypothetical protein	NA	A0A0P0J0C5	Acinetobacter_phage	100.0	2.9e-143
AYY17629.1|2049602_2050253_-	hypothetical protein	NA	A0A0P0IKQ5	Acinetobacter_phage	99.5	2.1e-94
AYY17630.1|2050448_2050949_-	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	100.0	3.1e-93
AYY17631.1|2050945_2051341_-	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	100.0	1.6e-68
AYY17632.1|2051966_2052389_-	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	100.0	2.9e-76
AYY17633.1|2052385_2053135_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	100.0	9.6e-139
AYY17634.1|2053127_2054057_-	DUF1376 domain-containing protein	NA	A0A0P0I481	Acinetobacter_phage	100.0	4.3e-173
AYY17635.1|2054056_2054413_-	hypothetical protein	NA	A0A0P0IVS7	Acinetobacter_phage	100.0	1.5e-57
AYY17636.1|2054409_2054706_-	hypothetical protein	NA	A0A0P0HSJ2	Acinetobacter_phage	100.0	1.1e-48
AYY17637.1|2054702_2054975_-	hypothetical protein	NA	A0A0P0J0B9	Acinetobacter_phage	100.0	4.6e-43
AYY17638.1|2055037_2055394_-	hypothetical protein	NA	A0A0P0IKQ0	Acinetobacter_phage	100.0	2.2e-61
AYY17639.1|2055404_2055620_-	hypothetical protein	NA	A0A0P0IY81	Acinetobacter_phage	100.0	1.3e-35
AYY17640.1|2055720_2056476_+	helix-turn-helix transcriptional regulator	NA	A0A0P0I8E0	Acinetobacter_phage	100.0	1.5e-144
AYY17641.1|2056673_2057114_+	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	100.0	4.0e-76
AYY17642.1|2057116_2057440_+	hypothetical protein	NA	A0A0P0IRC4	Acinetobacter_phage	100.0	3.9e-57
AYY17643.1|2057451_2058573_+	ATP-binding protein	NA	A0A0P0IDZ3	Acinetobacter_phage	100.0	3.0e-213
AYY17644.1|2058569_2059571_+	hypothetical protein	NA	A0A0P0IKV7	Acinetobacter_phage	100.0	1.6e-189
AYY17645.1|2059572_2059830_+	hypothetical protein	NA	A0A0P0I475	Acinetobacter_phage	100.0	2.0e-43
AYY17646.1|2059820_2060030_+	hypothetical protein	NA	A0A0P0IVS1	Acinetobacter_phage	100.0	7.4e-33
AYY17647.1|2060026_2060311_+	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	100.0	2.3e-45
AYY17648.1|2060314_2060572_+	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	100.0	5.9e-48
AYY17649.1|2060572_2060842_+	DNA-binding protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
>prophage 7
CP033862	Acinetobacter sp. FDAARGOS_560 chromosome, complete genome	4075289	2399954	2466816	4075289	tail,transposase,capsid,head,terminase	Acinetobacter_phage(100.0%)	86	NA	NA
AYY17946.1|2399954_2401496_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	100.0	3.9e-288
AYY17947.1|2401492_2403295_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	100.0	0.0e+00
AYY17948.1|2403782_2404979_+	DUF4102 domain-containing protein	NA	A0A0D4DBR3	Acinetobacter_phage	100.0	2.5e-226
AYY17949.1|2404975_2405170_-	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	100.0	3.8e-31
AYY17950.1|2405603_2406146_-	hypothetical protein	NA	A0A0B5KTG8	Acinetobacter_phage	100.0	2.0e-101
AYY17951.1|2406188_2406578_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	100.0	2.5e-66
AYY17952.1|2406645_2410092_-	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	98.9	0.0e+00
AYY17953.1|2410084_2410447_-	hypothetical protein	NA	J7I4R1	Acinetobacter_phage	100.0	5.2e-66
AYY17954.1|2410433_2410949_-	hypothetical protein	NA	J7HXQ5	Acinetobacter_phage	100.0	1.0e-91
AYY17955.1|2410948_2411347_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	100.0	1.3e-73
AYY17956.1|2411411_2411804_-	hypothetical protein	NA	NA	NA	NA	NA
AYY17957.1|2411807_2412560_-	hypothetical protein	NA	J7HXF9	Acinetobacter_phage	34.4	1.2e-32
AYY17958.1|2412634_2417434_-|tail	phage tail protein	tail	J7I4Q7	Acinetobacter_phage	84.7	0.0e+00
AYY17959.1|2417494_2417842_-	hypothetical protein	NA	A0A0N7IRG4	Acinetobacter_phage	94.8	2.5e-57
AYY17960.1|2417988_2418504_-	Rha family transcriptional regulator	NA	A0A0P0HSR5	Acinetobacter_phage	100.0	6.4e-94
AYY17961.1|2418844_2419780_-	ORF6N domain-containing protein	NA	A0A0P0J0J1	Acinetobacter_phage	96.8	5.8e-101
AYY17962.1|2419929_2420196_+	hypothetical protein	NA	A0A0P0IKW9	Acinetobacter_phage	52.8	1.5e-17
AYY17963.1|2420238_2420730_-	DUF4468 domain-containing protein	NA	NA	NA	NA	NA
AYY17964.1|2420815_2421562_-	hypothetical protein	NA	A0A0N7IRG5	Acinetobacter_phage	86.3	2.7e-117
AYY17965.1|2421623_2422007_-	hypothetical protein	NA	A0A0D4DBP2	Acinetobacter_phage	67.7	2.2e-46
AYY17966.1|2422071_2422596_-	DUF4468 domain-containing protein	NA	A0A0P0I8L3	Acinetobacter_phage	97.7	2.7e-95
AYY17967.1|2422695_2423100_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	100.0	3.9e-70
AYY17968.1|2423192_2423375_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
AYY17969.1|2423443_2423722_-	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	62.2	1.1e-26
AYY19510.1|2423700_2424216_-	hypothetical protein	NA	J7I4Q2	Acinetobacter_phage	100.0	2.8e-73
AYY17970.1|2424286_2425204_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	97.7	7.8e-167
AYY17971.1|2425256_2426612_-|tail	phage tail protein	tail	A0A0N7IRE5	Acinetobacter_phage	99.3	6.5e-202
AYY17972.1|2426611_2426965_-	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
AYY17973.1|2427060_2427582_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYY17974.1|2427690_2427909_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
AYY17975.1|2427910_2428354_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	87.8	3.1e-68
AYY17976.1|2428310_2428679_-	HK97 gp10 family phage protein	NA	A0A0D4DBN1	Acinetobacter_phage	80.3	2.6e-52
AYY19511.1|2428650_2429055_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	91.7	2.2e-65
AYY17977.1|2429063_2429432_-	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	95.1	1.2e-62
AYY17978.1|2429433_2429823_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	7.3e-66
AYY17979.1|2429827_2430493_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	96.4	6.3e-110
AYY17980.1|2430558_2431515_-|capsid	phage capsid protein	capsid	A0A0D4DBM4	Acinetobacter_phage	99.7	1.3e-177
AYY17981.1|2431542_2432310_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	99.6	1.7e-119
AYY17982.1|2432423_2432615_-	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
AYY17983.1|2432832_2433075_-	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	100.0	3.6e-39
AYY17984.1|2433173_2433602_-	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	100.0	5.2e-73
AYY17985.1|2433610_2434714_-|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	100.0	2.7e-206
AYY17986.1|2434715_2436167_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	100.0	1.0e-285
AYY17987.1|2436163_2437591_-|terminase	terminase	terminase	J7I460	Acinetobacter_phage	100.0	7.6e-270
AYY17988.1|2437580_2438051_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
AYY17989.1|2438108_2438750_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	100.0	9.4e-127
AYY17990.1|2438718_2439153_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	97.2	3.2e-78
AYY17991.1|2439164_2439356_-	hypothetical protein	NA	J7I0V8	Acinetobacter_phage	87.1	1.3e-23
AYY17992.1|2439477_2439774_-	hypothetical protein	NA	J7I457	Acinetobacter_phage	100.0	5.6e-58
AYY17993.1|2439896_2440631_-	hypothetical protein	NA	J7HXD9	Acinetobacter_phage	97.5	4.1e-134
AYY17994.1|2440641_2441043_-	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	97.0	1.8e-67
AYY17995.1|2441042_2441267_-	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
AYY19512.1|2441259_2441622_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	1.0e-69
AYY17996.1|2441671_2442094_-	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
AYY17997.1|2442080_2442215_-	putative phage replication protein	NA	A0A0D4DCC7	Acinetobacter_phage	100.0	5.6e-18
AYY17998.1|2442211_2442982_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	99.2	3.4e-147
AYY17999.1|2442978_2443866_-	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	98.0	1.6e-156
AYY18000.1|2443924_2444281_-	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	99.2	3.3e-57
AYY18001.1|2444277_2444574_-	hypothetical protein	NA	J7HXM0	Acinetobacter_phage	99.0	2.3e-48
AYY19513.1|2444570_2444846_-	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	96.7	6.3e-40
AYY18002.1|2444901_2445258_-	transcriptional regulator	NA	J7I452	Acinetobacter_phage	98.3	8.8e-58
AYY18003.1|2445267_2445453_-	hypothetical protein	NA	J7HXD2	Acinetobacter_phage	98.4	1.4e-27
AYY18004.1|2445530_2446295_+	LexA family transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	98.4	1.0e-140
AYY18005.1|2446309_2446525_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
AYY18006.1|2447584_2448088_+	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
AYY18007.1|2448226_2448430_+	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
AYY18008.1|2448436_2448679_-	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
AYY18009.1|2448865_2449306_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	5.9e-72
AYY18010.1|2449308_2449632_+	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	90.7	1.4e-49
AYY18011.1|2449643_2450765_+	ATP-binding protein	NA	A0A0D4DBX7	Acinetobacter_phage	99.7	1.3e-211
AYY18012.1|2450761_2451838_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	75.4	4.6e-142
AYY18013.1|2451839_2452085_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.5e-40
AYY18014.1|2452088_2452538_+	DUF551 domain-containing protein	NA	A0A0P0HSE1	Acinetobacter_phage	93.1	6.0e-80
AYY18015.1|2452534_2452744_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	92.8	4.1e-31
AYY18016.1|2452740_2452953_+	hypothetical protein	NA	NA	NA	NA	NA
AYY18017.1|2452949_2453432_+	class I SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	72.3	1.5e-68
AYY18018.1|2453432_2453702_+	hypothetical protein	NA	A0A0P0J067	Acinetobacter_phage	100.0	8.7e-42
AYY18019.1|2453816_2454401_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	1.7e-111
AYY18020.1|2454849_2455940_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AYY18021.1|2455973_2458385_-	M1 family peptidase	NA	A0A0P0IY26	Acinetobacter_phage	100.0	0.0e+00
AYY18022.1|2458464_2461197_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	99.9	0.0e+00
AYY19514.1|2461552_2462602_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
AYY18023.1|2462611_2463418_+	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	100.0	7.9e-147
AYY18024.1|2463427_2464123_+	DNA mismatch repair protein MutS	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
AYY18025.1|2464133_2465117_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	100.0	2.0e-189
AYY18026.1|2465725_2466816_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
>prophage 8
CP033862	Acinetobacter sp. FDAARGOS_560 chromosome, complete genome	4075289	2634198	2680708	4075289	integrase,tail,terminase,head,tRNA,lysis	Acinetobacter_phage(66.67%)	55	2625470:2625484	2651015:2651029
2625470:2625484	attL	TTTAATAATATTGAT	NA	NA	NA	NA
AYY18156.1|2634198_2635245_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AYY18157.1|2635348_2636953_+|integrase	site-specific integrase	integrase	A0A2H4J8L8	uncultured_Caudovirales_phage	46.1	1.4e-91
AYY18158.1|2636955_2637147_-	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	83.9	4.4e-24
AYY18159.1|2637208_2637799_+	hypothetical protein	NA	NA	NA	NA	NA
AYY18160.1|2638046_2638376_+	hypothetical protein	NA	NA	NA	NA	NA
AYY19521.1|2638396_2638627_+	hypothetical protein	NA	NA	NA	NA	NA
AYY18161.1|2638798_2639116_-	anaerobic dehydrogenase	NA	A0A1W5PUJ8	Salmonella_phage	58.5	9.6e-24
AYY18162.1|2639116_2639662_-	hypothetical protein	NA	A0A0B5KTG8	Acinetobacter_phage	89.4	1.1e-91
AYY18163.1|2639720_2639945_-	hypothetical protein	NA	NA	NA	NA	NA
AYY18164.1|2639925_2640219_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AYY18165.1|2640287_2641013_-	hypothetical protein	NA	NA	NA	NA	NA
AYY18166.1|2641012_2641336_-	hypothetical protein	NA	NA	NA	NA	NA
AYY18167.1|2641336_2651356_-|tail	phage tail protein	tail	A0A0R6PIC9	Moraxella_phage	37.2	1.6e-10
2651015:2651029	attR	ATCAATATTATTAAA	NA	NA	NA	NA
AYY18168.1|2651422_2652094_-|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	46.8	1.2e-39
AYY18169.1|2652077_2652833_-|tail	phage tail protein	tail	A0A0R6PIM4	Moraxella_phage	57.4	4.5e-88
AYY18170.1|2652839_2653538_-|tail	phage minor tail protein L	tail	A0A0R6PIG8	Moraxella_phage	68.1	4.8e-92
AYY18171.1|2653547_2653898_-	hypothetical protein	NA	NA	NA	NA	NA
AYY18172.1|2653952_2654294_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYY18173.1|2654411_2658377_-	replication protein	NA	A0A0D4DC37	Acinetobacter_phage	44.7	3.7e-165
AYY18174.1|2658437_2658839_-	hypothetical protein	NA	NA	NA	NA	NA
AYY18175.1|2658919_2659324_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	88.8	1.0e-62
AYY18176.1|2659388_2659571_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
AYY18177.1|2659902_2660436_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	59.9	6.3e-44
AYY18178.1|2660480_2661410_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	40.8	5.3e-54
AYY18179.1|2661517_2661730_-	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	75.4	1.3e-21
AYY18180.1|2661731_2662130_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	71.2	4.0e-51
AYY18181.1|2662131_2662500_-	HK97 gp10 family phage protein	NA	A0A0D4DBN1	Acinetobacter_phage	80.3	4.8e-51
AYY18182.1|2662471_2662876_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	92.5	4.9e-65
AYY18183.1|2662884_2663298_-	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	76.6	5.6e-56
AYY18184.1|2663254_2663644_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	9.5e-66
AYY18185.1|2663648_2664314_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	67.4	5.2e-72
AYY18186.1|2664378_2665335_-	Ig domain-containing protein	NA	A0A0D4DBM4	Acinetobacter_phage	93.7	5.6e-168
AYY18187.1|2665362_2666130_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	94.1	8.1e-117
AYY18188.1|2666243_2666558_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	48.5	3.4e-13
AYY18189.1|2666626_2667139_-	hypothetical protein	NA	NA	NA	NA	NA
AYY18190.1|2667431_2668535_-|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	83.4	5.9e-177
AYY18191.1|2668536_2669988_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	90.2	1.2e-259
AYY18192.1|2669984_2671412_-|terminase	terminase	terminase	A0A0D4DCE6	Acinetobacter_phage	88.4	1.2e-251
AYY18193.1|2671401_2671872_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	89.7	2.6e-73
AYY18194.1|2671930_2672572_-	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	97.2	4.4e-124
AYY18195.1|2672540_2673008_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	76.8	4.4e-65
AYY18196.1|2673180_2673384_-	hypothetical protein	NA	NA	NA	NA	NA
AYY18197.1|2673485_2674256_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	60.8	1.4e-89
AYY18198.1|2674441_2674672_-	hypothetical protein	NA	NA	NA	NA	NA
AYY18199.1|2674852_2675416_-	hypothetical protein	NA	A0A1B1P9I8	Acinetobacter_phage	52.5	3.2e-46
AYY18200.1|2675437_2675722_-	hypothetical protein	NA	NA	NA	NA	NA
AYY18201.1|2675731_2676139_-	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	51.8	4.0e-22
AYY18202.1|2676135_2676537_-	hypothetical protein	NA	NA	NA	NA	NA
AYY18203.1|2676523_2676706_-	hypothetical protein	NA	NA	NA	NA	NA
AYY18204.1|2676702_2677101_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	48.5	1.5e-26
AYY18205.1|2677112_2677979_-	hypothetical protein	NA	A0A2H4J5Y9	uncultured_Caudovirales_phage	43.7	1.4e-72
AYY18206.1|2677975_2678434_-	hypothetical protein	NA	NA	NA	NA	NA
AYY18207.1|2678430_2679534_-	hypothetical protein	NA	A0A0P0IKQ2	Acinetobacter_phage	56.1	1.4e-29
AYY18208.1|2679530_2680385_-	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
AYY18209.1|2680381_2680708_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	36.0	3.2e-06
>prophage 9
CP033862	Acinetobacter sp. FDAARGOS_560 chromosome, complete genome	4075289	3170149	3224483	4075289	tail,protease,capsid,head,terminase	Acinetobacter_phage(96.83%)	75	NA	NA
AYY18603.1|3170149_3170743_-	hypothetical protein	NA	A0A0P0HSM0	Acinetobacter_phage	100.0	5.1e-103
AYY18604.1|3170749_3171397_-	hypothetical protein	NA	J7I4R4	Acinetobacter_phage	100.0	3.6e-118
AYY18605.1|3172276_3172822_-	hypothetical protein	NA	J7I0Y1	Acinetobacter_phage	98.9	2.6e-101
AYY18606.1|3173160_3174060_-	alpha/beta hydrolase	NA	A0A0P0J0J7	Acinetobacter_phage	85.4	4.2e-149
AYY18607.1|3174225_3174486_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AYY18608.1|3174505_3174997_-	hypothetical protein	NA	NA	NA	NA	NA
AYY18609.1|3175053_3175380_-	hypothetical protein	NA	NA	NA	NA	NA
AYY18610.1|3175383_3175725_-	hypothetical protein	NA	NA	NA	NA	NA
AYY18611.1|3175923_3176313_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	100.0	2.5e-66
AYY18612.1|3176380_3179827_-	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	100.0	0.0e+00
AYY18613.1|3179819_3180182_-	hypothetical protein	NA	J7I4R1	Acinetobacter_phage	100.0	5.2e-66
AYY18614.1|3180178_3180685_-	hypothetical protein	NA	J7HXQ5	Acinetobacter_phage	100.0	1.2e-92
AYY18615.1|3180684_3181083_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	100.0	1.3e-73
AYY18616.1|3181147_3181540_-	hypothetical protein	NA	NA	NA	NA	NA
AYY18617.1|3181543_3182296_-	hypothetical protein	NA	J7HXF9	Acinetobacter_phage	34.4	1.2e-32
AYY18618.1|3182370_3186705_-|tail	phage tail tape measure protein	tail	A0A0D4DC37	Acinetobacter_phage	70.2	0.0e+00
AYY18619.1|3186832_3187096_-	hypothetical protein	NA	NA	NA	NA	NA
AYY18620.1|3187097_3187778_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
AYY18621.1|3187876_3188281_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	100.0	3.9e-70
AYY18622.1|3188373_3188556_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
AYY18623.1|3188624_3188903_-	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	62.2	1.1e-26
AYY19548.1|3188881_3189397_-	hypothetical protein	NA	J7I4Q2	Acinetobacter_phage	100.0	2.8e-73
AYY18624.1|3189467_3190385_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	97.7	7.8e-167
AYY18625.1|3190437_3191793_-|tail	phage tail protein	tail	A0A0N7IRE5	Acinetobacter_phage	99.3	6.5e-202
AYY18626.1|3191792_3192146_-	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
AYY18627.1|3192871_3193090_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
AYY18628.1|3193091_3193535_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	87.8	3.1e-68
AYY18629.1|3193491_3193860_-	HK97 gp10 family phage protein	NA	A0A0D4DBN1	Acinetobacter_phage	80.3	2.6e-52
AYY19549.1|3193831_3194236_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	91.7	2.2e-65
AYY18630.1|3194244_3194613_-	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	95.1	1.2e-62
AYY18631.1|3194614_3195004_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	7.3e-66
AYY18632.1|3195008_3195674_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	96.8	2.6e-111
AYY18633.1|3195739_3196696_-|capsid	phage capsid protein	capsid	A0A0D4DBM4	Acinetobacter_phage	97.5	4.8e-175
AYY18634.1|3196723_3197491_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
AYY18635.1|3197604_3197796_-	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
AYY19550.1|3198353_3198632_-	hypothetical protein	NA	A0A0P0I8B5	Acinetobacter_phage	100.0	1.5e-44
AYY18636.1|3198789_3199893_-|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	100.0	2.7e-206
AYY18637.1|3201341_3202769_-|terminase	terminase	terminase	J7I460	Acinetobacter_phage	100.0	7.6e-270
AYY18638.1|3202758_3203229_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
AYY18639.1|3203287_3203929_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	98.1	6.7e-125
AYY18640.1|3203897_3204332_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	100.0	3.4e-80
AYY18641.1|3204393_3204849_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	100.0	3.1e-84
AYY18642.1|3205270_3206023_-	hypothetical protein	NA	A0A0P0J081	Acinetobacter_phage	100.0	8.7e-140
AYY18643.1|3206033_3206435_-	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	100.0	1.9e-69
AYY18644.1|3206434_3206659_-	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
AYY19551.1|3206651_3207014_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	1.0e-69
AYY18645.1|3207063_3207486_-	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
AYY18646.1|3207472_3207607_-	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	100.0	1.1e-18
AYY18647.1|3207603_3208404_-	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	100.0	2.0e-150
AYY18648.1|3208406_3209288_-	MarR family transcriptional regulator	NA	A0A0P0IKQ2	Acinetobacter_phage	100.0	9.8e-143
AYY19552.1|3209280_3209505_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	98.6	6.5e-35
AYY18649.1|3209576_3209852_-	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	100.0	8.9e-42
AYY18650.1|3209907_3210228_-	XRE family transcriptional regulator	NA	A0A0P0HSE9	Acinetobacter_phage	100.0	4.6e-50
AYY18651.1|3210238_3210490_-	hypothetical protein	NA	A0A0N7IRE1	Acinetobacter_phage	100.0	8.9e-41
AYY18652.1|3210598_3211363_+	LexA family transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	100.0	2.8e-146
AYY18653.1|3211377_3211593_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	100.0	8.5e-32
AYY18654.1|3211644_3212652_+	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
AYY18655.1|3212653_3213157_+	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
AYY18656.1|3213365_3213806_+	hypothetical protein	NA	A0A0P0IR91	Acinetobacter_phage	100.0	5.7e-75
AYY18657.1|3213805_3214096_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	100.0	5.5e-50
AYY18658.1|3214088_3214412_+	hypothetical protein	NA	A0A0P0IKP4	Acinetobacter_phage	100.0	5.1e-57
AYY18659.1|3214423_3215545_+	ATP-binding protein	NA	A0A0P0IDZ3	Acinetobacter_phage	100.0	3.0e-213
AYY18660.1|3216543_3216801_+	hypothetical protein	NA	A0A0P0I475	Acinetobacter_phage	100.0	2.0e-43
AYY18661.1|3216791_3217001_+	hypothetical protein	NA	A0A0P0IVS1	Acinetobacter_phage	100.0	7.4e-33
AYY18662.1|3216997_3217282_+	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	100.0	2.3e-45
AYY18663.1|3217285_3217543_+	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	100.0	5.9e-48
AYY18664.1|3217543_3217813_+	DNA-binding protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
AYY18665.1|3217818_3219081_-	DUF4102 domain-containing protein	NA	A0A0P0IKP2	Acinetobacter_phage	100.0	3.8e-249
AYY18666.1|3219564_3220404_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
AYY18667.1|3220404_3221217_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
AYY18668.1|3221240_3222224_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AYY18669.1|3222396_3222825_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AYY18670.1|3222837_3223224_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AYY18671.1|3223394_3224048_+	starvation protein A	NA	NA	NA	NA	NA
AYY18672.1|3224054_3224483_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	50.0	2.9e-31
>prophage 10
CP033862	Acinetobacter sp. FDAARGOS_560 chromosome, complete genome	4075289	3969427	3980652	4075289	transposase	Vibriophage(100.0%)	9	NA	NA
AYY19323.1|3969427_3971338_+|transposase	transposase	transposase	NA	NA	NA	NA
AYY19324.1|3972941_3973757_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
AYY19325.1|3973843_3974146_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AYY19326.1|3974039_3974333_-	hypothetical protein	NA	NA	NA	NA	NA
AYY19327.1|3974537_3975248_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
AYY19328.1|3975248_3977159_+|transposase	transposase	transposase	NA	NA	NA	NA
AYY19329.1|3977163_3978084_+|transposase	transposase	transposase	NA	NA	NA	NA
AYY19330.1|3978113_3979229_+|transposase	transposase	transposase	NA	NA	NA	NA
AYY19331.1|3979221_3980652_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
CP033863	Acinetobacter sp. FDAARGOS_560 plasmid unnamed1	23171	0	14603	23171	terminase,capsid	Pseudomonas_phage(35.71%)	21	NA	NA
AYY19591.1|0_326_+	chromosome partitioning protein ParB	NA	L7TL04	Rhizobium_phage	40.4	3.5e-13
AYY19592.1|354_957_+	hypothetical protein	NA	NA	NA	NA	NA
AYY19593.1|953_1604_+	chromosome partitioning protein ParB	NA	L7TMF9	Rhizobium_phage	41.9	3.8e-35
AYY19594.1|1603_2260_+	ATP-binding cassette domain-containing protein	NA	L7TNS9	Rhizobium_phage	54.8	5.9e-60
AYY19595.1|2256_2679_+	thioredoxin	NA	NA	NA	NA	NA
AYY19596.1|2717_3671_+	hypothetical protein	NA	A0A2H4P6X5	Pseudomonas_phage	42.1	4.6e-61
AYY19597.1|3661_3985_+	hypothetical protein	NA	NA	NA	NA	NA
AYY19598.1|3953_4448_+	hypothetical protein	NA	A0A0D4DBK8	Acinetobacter_phage	33.9	5.4e-05
AYY19599.1|4559_4961_+	hypothetical protein	NA	NA	NA	NA	NA
AYY19600.1|5113_5719_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	34.3	4.0e-18
AYY19601.1|5728_6973_+|terminase	terminase	terminase	A0A2H4P6Z9	Pseudomonas_phage	62.4	1.3e-151
AYY19602.1|7018_8689_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	51.9	8.1e-146
AYY19603.1|8732_9611_+	hypothetical protein	NA	A0A2H4P6Z8	Pseudomonas_phage	29.4	7.3e-13
AYY19604.1|9746_10649_+|capsid	phage major capsid protein	capsid	A0A2H4P701	Pseudomonas_phage	58.3	6.9e-91
AYY19605.1|10787_11282_+	hypothetical protein	NA	L7TKJ9	Rhizobium_phage	28.7	6.8e-08
AYY19606.1|11288_12059_+	hypothetical protein	NA	NA	NA	NA	NA
AYY19607.1|12117_12756_+	hypothetical protein	NA	NA	NA	NA	NA
AYY19608.1|12742_13093_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	35.1	2.5e-09
AYY19609.1|13089_13476_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	32.8	1.6e-12
AYY19610.1|13475_13973_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
AYY19611.1|14057_14603_+	hypothetical protein	NA	A0A2H4P707	Pseudomonas_phage	52.2	6.3e-39
>prophage 1
CP033864	Acinetobacter sp. FDAARGOS_560 plasmid unnamed2	68135	29509	56379	68135		Pseudomonas_phage(50.0%)	27	NA	NA
AYY19645.1|29509_31432_+	cobalamin biosynthesis protein CobT	NA	A0A2H4P735	Pseudomonas_phage	43.9	3.9e-75
AYY19646.1|31576_32821_+	porphyrin biosynthesis protein	NA	L7TKP0	Rhizobium_phage	41.7	2.4e-86
AYY19647.1|32845_33511_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYY19648.1|33561_34242_+	hypothetical protein	NA	NA	NA	NA	NA
AYY19649.1|34287_36645_+	DNA polymerase III subunit alpha	NA	L7TNG6	Rhizobium_phage	43.4	4.3e-177
AYY19650.1|36693_37269_+	hypothetical protein	NA	A0A2D1GG92	Gordonia_phage	44.4	2.1e-24
AYY19651.1|37265_38531_+	hypothetical protein	NA	A0A2H4P750	Pseudomonas_phage	38.1	5.9e-72
AYY19652.1|38620_39709_+	hypothetical protein	NA	A0A2H4P749	Pseudomonas_phage	35.3	5.0e-11
AYY19653.1|39851_40712_+	hypothetical protein	NA	A0A2H4P7I7	Pseudomonas_phage	31.5	1.9e-29
AYY19654.1|40774_41812_+	5'-3' exonuclease	NA	J9Q7S6	Salmonella_phage	36.6	8.8e-50
AYY19655.1|41814_44013_+	recombinase RecA	NA	J9Q736	Salmonella_phage	50.7	3.6e-53
AYY19656.1|44100_44460_+	hypothetical protein	NA	NA	NA	NA	NA
AYY19657.1|44456_44918_+	hypothetical protein	NA	NA	NA	NA	NA
AYY19658.1|44917_45298_+	hypothetical protein	NA	NA	NA	NA	NA
AYY19659.1|45385_45607_+	hypothetical protein	NA	NA	NA	NA	NA
AYY19660.1|45640_46756_+	serine/threonine protein phosphatase	NA	A0A2H4P756	Pseudomonas_phage	38.1	1.3e-59
AYY19661.1|46755_48696_+	recombinase RecF	NA	L7TNH6	Rhizobium_phage	42.8	6.4e-118
AYY19662.1|48788_49625_+	hypothetical protein	NA	NA	NA	NA	NA
AYY19663.1|49756_50359_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	42.8	1.1e-31
AYY19664.1|50432_50813_+	hypothetical protein	NA	NA	NA	NA	NA
AYY19665.1|50834_53207_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	50.7	3.1e-207
AYY19666.1|53304_54294_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P762	Pseudomonas_phage	38.4	2.5e-54
AYY19667.1|54306_55218_+	hypothetical protein	NA	A0A0K2FHE7	Achromobacter_phage	44.4	7.7e-66
AYY19668.1|55221_55506_+	hypothetical protein	NA	NA	NA	NA	NA
AYY19669.1|55505_55733_+	hypothetical protein	NA	NA	NA	NA	NA
AYY19670.1|55763_56021_+	hypothetical protein	NA	NA	NA	NA	NA
AYY19671.1|56013_56379_+	nucleotide pyrophosphohydrolase	NA	A0A0S0NAG1	Pseudomonas_phage	63.6	2.8e-35
