The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	0	6193	4158443	protease	Bacillus_virus(100.0%)	6	NA	NA
AYY79339.1|353_1514_+	glycerate kinase	NA	NA	NA	NA	NA
AYY79340.1|1594_2002_-	aspartate 1-decarboxylase autocleavage activator PanM	NA	NA	NA	NA	NA
AYY79341.1|2013_3201_-	MFS transporter	NA	NA	NA	NA	NA
AYY79342.1|3319_3787_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYY79343.1|3840_4593_-|protease	metalloprotease	protease	NA	NA	NA	NA
AYY79344.1|5092_6193_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	32.5	1.4e-21
>prophage 2
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	20665	23026	4158443		Liberibacter_phage(100.0%)	1	NA	NA
AYY79358.1|20665_23026_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	25.8	7.2e-31
>prophage 3
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	27654	29706	4158443		Acidithiobacillus_phage(100.0%)	1	NA	NA
AYY79360.1|27654_29706_+	ATP-binding protein	NA	K4I1H4	Acidithiobacillus_phage	34.2	6.2e-31
>prophage 4
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	43257	44301	4158443		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AYY79374.1|43257_44301_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.8	3.9e-05
>prophage 5
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	58170	67028	4158443		Thermobifida_phage(20.0%)	11	NA	NA
AYY79387.1|58170_59025_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.1e-05
AYY79388.1|59103_59571_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AYY79389.1|59720_60008_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AYY79390.1|60031_61513_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
AYY79391.1|61572_62298_-	lipopolysaccharide ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.4e-22
AYY79392.1|62304_62838_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AYY79393.1|62818_63397_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AYY79394.1|63413_63971_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	77.0	7.8e-53
AYY79395.1|63998_64973_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	1.6e-37
AYY79396.1|64991_65972_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AYY79397.1|66215_67028_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	5.7e-20
>prophage 6
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	75031	77702	4158443	protease	uncultured_Mediterranean_phage(100.0%)	2	NA	NA
AYY79408.1|75031_76102_-|protease	serine endoprotease DegS	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	36.5	4.0e-13
AYY79409.1|76310_77702_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.5	1.9e-23
>prophage 7
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	82230	82740	4158443	protease	Pseudomonas_phage(100.0%)	1	NA	NA
AYY79415.1|82230_82740_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.2	6.3e-25
>prophage 8
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	92459	94796	4158443		Hokovirus(100.0%)	1	NA	NA
AYY79420.1|92459_94796_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	29.3	2.5e-44
>prophage 9
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	103534	107298	4158443		Caulobacter_phage(50.0%)	4	NA	NA
AYY79431.1|103534_104125_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	33.3	5.6e-09
AYY79432.1|104147_104528_-	YraN family protein	NA	NA	NA	NA	NA
AYY79433.1|104603_106358_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
AYY79434.1|106419_107298_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.2	6.1e-52
>prophage 10
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	124086	129113	4158443		uncultured_marine_phage(50.0%)	3	NA	NA
AYY79451.1|124086_124503_+	DoxX family protein	NA	D2X5Z2	uncultured_marine_phage	30.7	7.7e-05
AYY79452.1|124615_127414_-	insulinase family protein	NA	NA	NA	NA	NA
AYY79453.1|127403_129113_-	ABC transporter ATP-binding protein/permease	NA	F2Y2R6	Organic_Lake_phycodnavirus	25.4	6.2e-08
>prophage 11
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	134712	141346	4158443		Klosneuvirus(33.33%)	6	NA	NA
AYY79457.1|134712_136380_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	25.8	3.7e-42
AYY82942.1|136721_138641_+	murein transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	36.4	2.4e-08
AYY79458.1|138741_139053_+	trp operon repressor	NA	NA	NA	NA	NA
AYY79459.1|139157_139694_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
AYY79460.1|139745_140393_+	phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
AYY79461.1|140437_141346_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	D0R0F8	Streptococcus_phage	35.2	1.1e-08
>prophage 12
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	157975	172778	4158443	tRNA	Cyanophage(20.0%)	11	NA	NA
AYY79469.1|157975_158929_+	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	1.8e-12
AYY79470.1|159112_160096_+	hypothetical protein	NA	NA	NA	NA	NA
AYY79471.1|160319_160907_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AYY79472.1|161401_163327_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	50.0	2.5e-146
AYY79473.1|163432_164572_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	28.3	2.2e-22
AYY79474.1|164647_165493_-	EamA family transporter	NA	NA	NA	NA	NA
AYY79475.1|165943_167122_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	49.0	3.6e-84
AYY79476.1|167312_168233_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
AYY79477.1|168305_168566_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AYY79478.1|168996_169938_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AYY79479.1|169967_172778_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.6	5.5e-86
>prophage 13
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	176251	177415	4158443		Halovirus(100.0%)	1	NA	NA
AYY79484.1|176251_177415_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.5	3.4e-50
>prophage 14
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	188126	188957	4158443		Staphylococcus_phage(100.0%)	1	NA	NA
AYY79487.1|188126_188957_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.4	2.1e-62
>prophage 15
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	208250	209159	4158443		Salmonella_phage(100.0%)	1	NA	NA
AYY79506.1|208250_209159_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	55.6	2.6e-90
>prophage 16
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	217226	224417	4158443		Bacillus_phage(66.67%)	4	NA	NA
AYY79512.1|217226_220955_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	23.8	2.9e-10
AYY79513.1|220951_222184_-	exonuclease subunit SbcD	NA	NA	NA	NA	NA
AYY79514.1|222405_223095_+	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	40.7	3.6e-39
AYY79515.1|223118_224417_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	29.9	1.5e-25
>prophage 17
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	238039	244928	4158443	tRNA	uncultured_Mediterranean_phage(60.0%)	7	NA	NA
AYY79525.1|238039_239182_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.7	1.9e-93
AYY79526.1|239267_239603_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.2e-10
AYY79527.1|239635_241483_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AYY79528.1|241493_242462_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.5	5.9e-48
AYY79529.1|242578_243028_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AYY79530.1|243087_244245_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.5	1.4e-51
AYY79531.1|244457_244928_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.7	2.7e-30
>prophage 18
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	251194	252703	4158443		Staphylococcus_phage(100.0%)	1	NA	NA
AYY79539.1|251194_252703_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	1.3e-17
>prophage 19
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	269422	270796	4158443		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AYY79556.1|269422_270796_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.6	4.7e-59
>prophage 20
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	275580	280730	4158443	protease	Agrobacterium_phage(25.0%)	4	NA	NA
AYY79561.1|275580_276204_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	64.1	2.9e-64
AYY79562.1|276348_277620_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.8	6.2e-130
AYY79563.1|277879_280240_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.1	1.0e-223
AYY79564.1|280454_280730_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	61.8	7.8e-22
>prophage 21
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	284533	289427	4158443		Bacillus_phage(66.67%)	4	NA	NA
AYY79567.1|284533_285232_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	65.6	2.8e-84
AYY79568.1|285389_285851_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AYY79569.1|285907_287653_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	7.1e-52
AYY79570.1|287639_289427_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	3.4e-41
>prophage 22
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	304155	306931	4158443		Klosneuvirus(50.0%)	2	NA	NA
AYY82946.1|304155_304707_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	40.8	9.5e-27
AYY79583.1|304957_306931_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	39.2	2.3e-46
>prophage 23
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	334950	339743	4158443		Mamastrovirus(33.33%)	4	NA	NA
AYY79608.1|334950_336531_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	45.5	8.0e-18
AYY79609.1|336690_337233_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	32.7	1.8e-14
AYY79610.1|337305_337959_-	carbonate dehydratase	NA	NA	NA	NA	NA
AYY79611.1|338807_339743_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.7	7.8e-21
>prophage 24
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	345013	345565	4158443		Escherichia_phage(100.0%)	1	NA	NA
AYY79618.1|345013_345565_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	38.7	2.5e-35
>prophage 25
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	353176	353464	4158443		Morganella_phage(100.0%)	1	NA	NA
AYY79626.1|353176_353464_-	XRE family transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	39.7	1.1e-05
>prophage 26
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	365856	366897	4158443		Bacillus_virus(100.0%)	1	NA	NA
AYY79635.1|365856_366897_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.5	3.7e-32
>prophage 27
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	376885	383380	4158443	tRNA	Bacillus_virus(50.0%)	5	NA	NA
AYY79645.1|376885_378496_-	polynucleotide adenylyltransferase	NA	G3MAR3	Bacillus_virus	30.8	3.3e-27
AYY79646.1|378533_379445_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AYY79647.1|379499_379955_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
AYY79648.1|380151_380862_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AYY79649.1|380947_383380_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.9	7.1e-42
>prophage 28
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	387465	387810	4158443		Lake_Baikal_phage(100.0%)	1	NA	NA
AYY79652.1|387465_387810_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	1.6e-27
>prophage 29
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	398583	399909	4158443		Erysipelothrix_phage(100.0%)	1	NA	NA
AYY79662.1|398583_399909_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.9	1.2e-35
>prophage 30
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	404898	414071	4158443		Only_Syngen_Nebraska_virus(20.0%)	8	NA	NA
AYY79666.1|404898_406536_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.6	1.3e-151
AYY79667.1|406598_407900_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	58.5	1.2e-131
AYY79668.1|408222_409605_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
AYY79669.1|409840_411175_-	murein transglycosylase D	NA	C1KFN7	Lactobacillus_virus	38.8	2.6e-09
AYY79670.1|411250_412006_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AYY79671.1|412044_412761_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AYY79672.1|412767_413253_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.5	2.0e-49
AYY79673.1|413318_414071_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	2.3e-39
>prophage 31
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	425515	427519	4158443		Vibrio_phage(100.0%)	1	NA	NA
AYY79683.1|425515_427519_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.3	1.2e-21
>prophage 32
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	432601	435970	4158443		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
AYY79687.1|432601_433744_+	slipin family protein	NA	A0A0G2YDT0	Acanthamoeba_polyphaga_mimivirus	25.3	7.3e-13
AYY79688.1|433740_434982_+	RtcB family protein	NA	K4K356	Caulobacter_virus	63.6	1.5e-136
AYY79689.1|435409_435970_-	DNA recombinase	NA	A0A2L1IV36	Escherichia_phage	52.4	2.5e-51
>prophage 33
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	443754	444075	4158443		Morganella_phage(100.0%)	1	NA	NA
AYY79698.1|443754_444075_+	XRE family transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	37.1	9.7e-08
>prophage 34
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	452359	454099	4158443		Bacillus_phage(100.0%)	1	NA	NA
AYY79704.1|452359_454099_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.8	1.0e-29
>prophage 35
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	459091	459910	4158443		Grouper_iridovirus(100.0%)	1	NA	NA
AYY79708.1|459091_459910_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	41.3	2.9e-56
>prophage 36
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	475154	481229	4158443		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
AYY79717.1|475154_477326_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	30.9	3.1e-28
AYY79718.1|477342_478602_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYY79719.1|478901_479780_+	ParA family protein	NA	NA	NA	NA	NA
AYY79720.1|479876_481229_+	replicative DNA helicase	NA	O80281	Escherichia_phage	51.7	1.4e-119
>prophage 37
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	485678	490223	4158443		Bacillus_phage(100.0%)	1	NA	NA
AYY79724.1|485678_490223_-	DUF4150 domain-containing protein	NA	F8WPS9	Bacillus_phage	51.8	3.5e-26
>prophage 38
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	505118	507684	4158443	integrase	Salinibacter_virus(50.0%)	2	495462:495475	509411:509424
495462:495475	attL	AACAAGCATTAGAA	NA	NA	NA	NA
AYY82949.1|505118_506081_+|integrase	site-specific integrase	integrase	A0A2I6UG75	Salinibacter_virus	25.1	4.0e-12
AYY79738.1|506613_507684_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A1P8CWQ1	Bacillus_phage	36.4	1.2e-09
509411:509424	attR	AACAAGCATTAGAA	NA	NA	NA	NA
>prophage 39
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	514470	515064	4158443		Ugandan_cassava_brown_streak_virus(100.0%)	1	NA	NA
AYY79747.1|514470_515064_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	34.5	1.8e-15
>prophage 40
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	529649	530228	4158443		Caulobacter_phage(100.0%)	1	NA	NA
AYY79763.1|529649_530228_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.2	9.7e-14
>prophage 41
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	548820	551188	4158443		Streptococcus_phage(100.0%)	2	NA	NA
AYY79782.1|548820_549924_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	44.0	9.7e-63
AYY79783.1|549934_551188_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.6	7.8e-101
>prophage 42
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	555342	560955	4158443	tRNA	Pseudomonas_phage(25.0%)	4	NA	NA
AYY79787.1|555342_555849_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	45.3	1.3e-27
AYY79788.1|555956_557015_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.9	1.8e-114
AYY79789.1|557918_560546_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.9	2.9e-81
AYY79790.1|560766_560955_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	63.2	1.3e-12
>prophage 43
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	571222	572317	4158443		Klebsiella_phage(100.0%)	1	NA	NA
AYY79801.1|571222_572317_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	52.3	9.2e-90
>prophage 44
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	580568	583142	4158443		Cronobacter_phage(100.0%)	1	NA	NA
AYY79809.1|580568_583142_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.6	9.3e-125
>prophage 45
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	614567	626460	4158443		Mycobacterium_phage(22.22%)	13	NA	NA
AYY79829.1|614567_615767_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	36.6	4.2e-27
AYY79830.1|616389_617358_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.7	2.0e-136
AYY79831.1|617382_619509_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.0	1.6e-202
AYY79832.1|619514_619934_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	36.1	1.4e-09
AYY79833.1|619945_620170_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	46.4	1.7e-11
AYY79834.1|620454_620928_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
AYY79835.1|621125_621335_+	cold shock-like protein CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	4.5e-22
AYY79836.1|621435_621810_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	46.9	1.3e-22
AYY79837.1|621823_622789_-	lipoyl synthase	NA	NA	NA	NA	NA
AYY79838.1|622893_623535_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
AYY82951.1|623693_623957_-	DUF493 family protein	NA	NA	NA	NA	NA
AYY79839.1|624155_625367_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	50.7	3.6e-103
AYY79840.1|625488_626460_-	endolytic peptidoglycan transglycosylase RlpA	NA	H2BCY4	Synechococcus_phage	47.3	6.6e-07
>prophage 46
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	633723	637373	4158443	tRNA	Staphylococcus_phage(50.0%)	2	NA	NA
AYY79849.1|633723_636306_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.2	3.0e-192
AYY79850.1|636647_637373_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	5.8e-32
>prophage 47
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	643406	643910	4158443		Streptomyces_phage(100.0%)	1	NA	NA
AYY79857.1|643406_643910_+	protein disulfide oxidoreductase	NA	A0A1J0GW78	Streptomyces_phage	37.1	8.4e-06
>prophage 48
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	647105	648167	4158443		Pseudomonas_phage(100.0%)	1	NA	NA
AYY79861.1|647105_648167_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.2	7.1e-47
>prophage 49
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	651946	653059	4158443		Synechococcus_phage(100.0%)	1	NA	NA
AYY79865.1|651946_653059_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.6	4.7e-33
>prophage 50
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	660660	662328	4158443	tRNA	Escherichia_phage(100.0%)	1	NA	NA
AYY79871.1|660660_662328_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	84.2	1.1e-283
>prophage 51
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	667784	671916	4158443		Mycobacterium_phage(50.0%)	4	NA	NA
AYY79876.1|667784_668567_-	esterase	NA	W0LNB3	Mycobacterium_phage	35.4	4.1e-07
AYY79877.1|669025_669577_+	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
AYY79878.1|669651_671292_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
AYY79879.1|671433_671916_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	53.1	1.8e-37
>prophage 52
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	675701	676856	4158443		Enterobacteria_phage(100.0%)	1	NA	NA
AYY79883.1|675701_676856_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	41.6	1.6e-60
>prophage 53
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	689529	691296	4158443		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AYY79892.1|689529_691296_+	succinate dehydrogenase flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	24.8	3.4e-17
>prophage 54
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	713321	715348	4158443		Vibriophage(50.0%)	2	NA	NA
AYY79913.1|713321_714050_+	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	36.0	8.4e-23
AYY79914.1|714295_715348_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.3	2.6e-81
>prophage 55
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	719106	720573	4158443		Pithovirus(100.0%)	1	NA	NA
AYY79918.1|719106_720573_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	28.1	2.3e-11
>prophage 56
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	732461	736899	4158443		Planktothrix_phage(50.0%)	4	NA	NA
AYY79926.1|732461_733526_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	32.7	1.2e-20
AYY79927.1|733603_734425_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
AYY79928.1|734574_735564_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AYY79929.1|735624_736899_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.7e-21
>prophage 57
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	744347	745286	4158443		Streptococcus_phage(100.0%)	1	NA	NA
AYY79936.1|744347_745286_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.6	5.2e-25
>prophage 58
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	751181	756465	4158443		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
AYY79944.1|751181_752951_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	7.0e-23
AYY79945.1|752963_753950_-	secretion protein HlyD	NA	NA	NA	NA	NA
AYY79946.1|753961_754660_-	transcriptional regulator	NA	NA	NA	NA	NA
AYY79947.1|755037_756465_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.2	1.1e-55
>prophage 59
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	767859	773085	4158443		Bacillus_phage(25.0%)	5	NA	NA
AYY79959.1|767859_769992_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.6	1.3e-47
AYY79960.1|770030_770537_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YTY5	Streptomyces_phage	26.3	3.4e-07
AYY79961.1|770812_771703_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AYY79962.1|772032_772611_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	37.1	1.9e-17
AYY79963.1|772620_773085_+	GNAT family N-acetyltransferase	NA	G5DEI8	Salmonella_phage	36.1	6.6e-05
>prophage 60
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	778698	779358	4158443		Vibrio_phage(100.0%)	1	NA	NA
AYY79968.1|778698_779358_+	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	56.9	2.6e-55
>prophage 61
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	785684	790539	4158443	tRNA	Catovirus(66.67%)	4	NA	NA
AYY79974.1|785684_787712_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	24.4	4.1e-27
AYY79975.1|787915_789028_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AYY79976.1|789248_789890_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.7	4.5e-36
AYY79977.1|789957_790539_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	4.3e-30
>prophage 62
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	794374	797606	4158443		Moraxella_phage(50.0%)	2	NA	NA
AYY79980.1|794374_795955_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.3	3.8e-36
AYY79981.1|796199_797606_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.6	3.0e-32
>prophage 63
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	802128	802749	4158443		Bodo_saltans_virus(100.0%)	1	NA	NA
AYY79986.1|802128_802749_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	31.2	3.8e-16
>prophage 64
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	808357	812592	4158443		Cellulophaga_phage(50.0%)	5	NA	NA
AYY79993.1|808357_809257_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	84.2	1.9e-08
AYY82954.1|809406_809454_-	his operon leader peptide	NA	NA	NA	NA	NA
AYY79994.1|809788_810610_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYY79995.1|810611_811232_-	glutathione S-transferase	NA	NA	NA	NA	NA
AYY79996.1|811389_812592_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.3	2.2e-100
>prophage 65
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	820040	826893	4158443		Vibrio_phage(25.0%)	9	NA	NA
AYY80002.1|820040_820304_-	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	71.8	2.2e-26
AYY80003.1|820475_820778_+	DUF1418 family protein	NA	NA	NA	NA	NA
AYY80004.1|820946_821462_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AYY80005.1|821492_822626_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.9	7.2e-21
AYY80006.1|822728_823928_+	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	31.0	2.6e-29
AYY80007.1|824025_824694_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AYY80008.1|824693_825398_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AYY80009.1|825415_826150_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYY80010.1|826164_826893_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.4e-31
>prophage 66
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	832663	852304	4158443	tRNA,protease	uncultured_Mediterranean_phage(20.0%)	14	NA	NA
AYY80015.1|832663_834610_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	38.6	1.1e-37
AYY80016.1|834752_834962_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.7	5.4e-15
AYY80017.1|835251_835566_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	48.9	8.1e-15
AYY80018.1|835596_837888_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	8.5e-170
AYY80019.1|838009_838228_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYY80020.1|838569_839262_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYY80021.1|839263_841015_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	24.2	6.5e-21
AYY80022.1|841017_842787_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.3	1.3e-21
AYY80023.1|842927_843887_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.8	9.9e-64
AYY80024.1|844431_844926_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
AYY80025.1|845059_848818_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.1e-89
AYY80026.1|848930_849539_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
AYY82955.1|849546_850896_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.9	1.8e-79
AYY80027.1|851014_852304_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.6	3.6e-93
>prophage 67
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	855801	858934	4158443		Tetraselmis_virus(100.0%)	2	NA	NA
AYY80030.1|855801_856542_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	6.8e-20
AYY80031.1|856651_858934_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.3	2.2e-157
>prophage 68
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	865175	866264	4158443		Streptococcus_phage(100.0%)	1	NA	NA
AYY80036.1|865175_866264_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.7	3.7e-83
>prophage 69
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	870653	875487	4158443		Bacillus_phage(100.0%)	3	NA	NA
AYY80040.1|870653_870941_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	38.9	1.4e-10
AYY80041.1|871335_873705_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
AYY80042.1|873741_875487_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.0	3.5e-59
>prophage 70
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	893503	897796	4158443	tRNA	Enterobacteria_phage(33.33%)	3	NA	NA
AYY82957.1|893503_894580_-	porin	NA	Q1MVN1	Enterobacteria_phage	51.8	1.0e-93
AYY80057.1|894923_896324_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.3	1.5e-81
AYY80058.1|896581_897796_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	32.1	1.6e-42
>prophage 71
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	906357	908289	4158443		Tupanvirus(100.0%)	1	NA	NA
AYY80064.1|906357_908289_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.9	4.8e-49
>prophage 72
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	921897	923949	4158443		Bacillus_phage(100.0%)	1	NA	NA
AYY80076.1|921897_923949_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.7	2.1e-18
>prophage 73
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	933849	934791	4158443		Indivirus(100.0%)	1	NA	NA
AYY80089.1|933849_934791_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	46.9	3.4e-08
>prophage 74
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	943381	944990	4158443		Morganella_phage(100.0%)	2	NA	NA
AYY80097.1|943381_943594_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	78.6	2.0e-25
AYY80098.1|944060_944990_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	67.1	8.9e-102
>prophage 75
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	952253	991071	4158443	head,terminase,tRNA	Pectobacterium_phage(20.51%)	53	NA	NA
AYY80103.1|952253_952487_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	90.7	1.3e-30
AYY82961.1|953064_954081_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80104.1|954080_955106_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	26.0	5.5e-12
AYY80105.1|955396_956572_-	recombinase	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	30.0	1.7e-33
AYY80106.1|956573_956786_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80107.1|956760_956958_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	46.0	7.3e-06
AYY80108.1|957399_957579_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80109.1|957626_958127_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	57.1	4.7e-41
AYY80110.1|958126_960094_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	38.3	9.3e-117
AYY80111.1|960106_960439_-	hypothetical protein	NA	H9C158	Pectobacterium_phage	39.2	1.6e-05
AYY80112.1|960696_960897_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80113.1|960893_961274_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80114.1|961601_962360_-	XRE family transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	39.0	1.5e-27
AYY80115.1|962464_962722_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYY80116.1|962762_963218_+|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	54.7	6.4e-29
AYY80117.1|963235_963460_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	2.1e-17
AYY80118.1|963461_964292_+	replication protein	NA	H9C164	Pectobacterium_phage	59.3	3.4e-36
AYY80119.1|964281_965700_+	helicase DnaB	NA	H9C165	Pectobacterium_phage	61.0	5.2e-170
AYY80120.1|965753_965930_+	palmdelphin	NA	NA	NA	NA	NA
AYY80121.1|966019_966829_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80122.1|966890_967484_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	54.2	5.6e-57
AYY80123.1|967495_967807_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	68.8	3.5e-34
AYY80124.1|967794_968325_+	DUF1133 family protein	NA	I6S672	Salmonella_phage	52.0	1.7e-36
AYY80125.1|968490_968688_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	65.4	1.1e-09
AYY82962.1|968842_969877_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	71.3	3.4e-142
AYY80126.1|970145_970415_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	46.7	2.1e-16
AYY80127.1|970414_970885_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	58.6	3.4e-49
AYY80128.1|971027_971429_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80129.1|971316_971571_+	peptidase	NA	Q8SBD8	Shigella_phage	46.9	4.4e-11
AYY80130.1|971604_971796_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	53.4	3.6e-10
AYY80131.1|971865_972885_+|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	38.6	5.5e-36
AYY80132.1|973083_974481_+|terminase	terminase	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.5	3.0e-85
AYY80133.1|974484_975987_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	44.3	2.2e-102
AYY82963.1|976024_976738_+|head	phage head morphogenesis protein	head	A0A2H5BG15	Pseudoalteromonas_phage	35.3	3.9e-33
AYY80134.1|976734_977997_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	53.1	3.6e-45
AYY80135.1|977996_978494_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80136.1|978493_979561_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	39.3	1.1e-52
AYY80137.1|979630_979972_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	32.7	6.1e-08
AYY80138.1|979974_980406_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	32.4	1.5e-11
AYY80139.1|980405_980864_+	hypothetical protein	NA	L7TME2	Rhizobium_phage	30.1	1.5e-06
AYY80140.1|980863_981235_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80141.1|981221_981737_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80142.1|981745_983233_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.3	5.6e-82
AYY80143.1|983243_983696_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.8	3.4e-22
AYY80144.1|983736_984195_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	6.7e-26
AYY80145.1|984280_986575_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	26.5	2.0e-17
AYY82964.1|986576_987104_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80146.1|987103_987421_+	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	3.3e-08
AYY80147.1|987386_988202_+	hypothetical protein	NA	A1Z005	Burkholderia_virus	26.7	6.3e-11
AYY80148.1|988204_988897_+	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	42.4	1.4e-30
AYY80149.1|988893_989238_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80150.1|989230_990418_+	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	40.6	2.6e-69
AYY80151.1|990414_991071_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.5	6.4e-38
>prophage 76
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	996520	1003524	4158443		Vibrio_phage(50.0%)	7	NA	NA
AYY80156.1|996520_997525_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.3	1.4e-84
AYY80157.1|997608_997893_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AYY80158.1|998037_999801_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.0	1.1e-95
AYY80159.1|999995_1000700_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AYY80160.1|1000737_1001922_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	26.0	2.9e-28
AYY80161.1|1002441_1002789_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80162.1|1002909_1003524_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A0A8WIF2	Clostridium_phage	33.3	2.0e-09
>prophage 77
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1008233	1010667	4158443		Proteus_phage(50.0%)	3	NA	NA
AYY80168.1|1008233_1008650_-	NUDIX domain-containing protein	NA	A0A0G2SS60	Proteus_phage	33.3	4.5e-05
AYY80169.1|1008839_1009778_+	1-phosphofructokinase	NA	NA	NA	NA	NA
AYY80170.1|1009824_1010667_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.7	5.9e-28
>prophage 78
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1016179	1019117	4158443		Bacillus_virus(50.0%)	2	NA	NA
AYY80174.1|1016179_1016962_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.3	7.7e-14
AYY80175.1|1017134_1019117_+	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	30.3	1.1e-11
>prophage 79
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1050560	1051689	4158443		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AYY80200.1|1050560_1051295_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	1.3e-15
AYY80201.1|1051452_1051689_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	50.0	1.5e-10
>prophage 80
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1055008	1055656	4158443		Erwinia_phage(100.0%)	1	NA	NA
AYY80205.1|1055008_1055656_+	dTMP kinase	NA	W8D0J5	Erwinia_phage	35.0	2.3e-19
>prophage 81
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1069466	1074485	4158443		Planktothrix_phage(33.33%)	5	NA	NA
AYY82967.1|1069466_1070177_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.6	2.8e-31
AYY80218.1|1070176_1071424_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AYY80219.1|1071508_1072366_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	31.9	4.2e-21
AYY80220.1|1072418_1073663_+	peptidase T	NA	NA	NA	NA	NA
AYY80221.1|1073762_1074485_-	VWA domain-containing protein	NA	A0A222YZL6	Streptomyces_phage	33.3	1.4e-17
>prophage 82
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1078779	1169295	4158443	portal,terminase,holin,protease,lysis,capsid,tRNA,integrase,head,tail	Proteus_phage(31.94%)	107	1160667:1160696	1170440:1170469
AYY80226.1|1078779_1080150_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.0	5.3e-111
AYY80227.1|1080181_1080811_-	lysogenization regulator HflD	NA	NA	NA	NA	NA
AYY80228.1|1080813_1081917_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AYY80229.1|1082026_1082476_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AYY80230.1|1082468_1083098_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AYY80231.1|1083236_1084490_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
AYY80232.1|1084610_1085738_-|integrase	integrase	integrase	O21925	Phage_21	60.6	2.4e-125
AYY80233.1|1085718_1085961_-	excisionase	NA	NA	NA	NA	NA
AYY80234.1|1086022_1086553_-	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	60.9	1.8e-54
AYY80235.1|1086737_1086971_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80236.1|1086948_1087173_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80237.1|1087571_1088234_-	XRE family transcriptional regulator	NA	A0A1R3Y604	Salmonella_virus	56.7	3.0e-19
AYY80238.1|1088274_1088487_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	66.7	1.0e-21
AYY80239.1|1088555_1089014_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	45.4	1.3e-26
AYY80240.1|1089102_1089282_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80241.1|1089271_1089451_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	56.9	8.1e-12
AYY80242.1|1089463_1090558_+	replication protein	NA	H2DE83	Erwinia_phage	55.3	4.1e-29
AYY80243.1|1091187_1091580_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80244.1|1091579_1091750_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80245.1|1091812_1092199_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	53.7	4.9e-30
AYY80246.1|1092217_1093021_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.3	2.2e-88
AYY80247.1|1093017_1094043_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	45.6	1.1e-84
AYY80248.1|1094070_1094454_+	antitermination protein	NA	A0A088CD47	Shigella_phage	69.8	6.1e-49
AYY80249.1|1094749_1095271_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AYY80250.1|1095516_1095969_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AYY80251.1|1096153_1096471_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	61.9	2.5e-32
AYY80252.1|1096463_1096868_+	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.8	2.0e-26
AYY80253.1|1097067_1097646_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	54.5	7.3e-54
AYY82968.1|1097688_1098141_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.2	2.3e-23
AYY80254.1|1098149_1098644_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80255.1|1098730_1099078_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	93.0	4.5e-59
AYY80256.1|1099292_1099766_+|terminase	phage terminase small subunit P27 family	terminase	A0A1P8DTK5	Proteus_phage	96.8	4.7e-83
AYY80257.1|1099769_1101503_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	99.5	0.0e+00
AYY80258.1|1101502_1102834_+|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	99.3	1.9e-254
AYY80259.1|1102838_1103690_+|protease	Clp protease ClpP	protease	A0A1P8DTI2	Proteus_phage	100.0	5.9e-153
AYY80260.1|1103701_1104916_+|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	99.8	3.3e-221
AYY80261.1|1104959_1105196_+	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	100.0	2.4e-19
AYY80262.1|1105195_1105522_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1P8DTJ4	Proteus_phage	100.0	5.7e-56
AYY80263.1|1105530_1105854_+|head,tail	head-tail adaptor protein	head,tail	A0A1P8DTK6	Proteus_phage	97.2	1.8e-54
AYY80264.1|1105850_1106291_+	hypothetical protein	NA	A0A1P8DTH7	Proteus_phage	99.3	2.4e-73
AYY80265.1|1106287_1106623_+	hypothetical protein	NA	A0A1P8DTJ3	Proteus_phage	97.3	2.0e-56
AYY80266.1|1106687_1107155_+|tail	phage tail protein	tail	A0A1P8DTJ5	Proteus_phage	100.0	1.3e-80
AYY80267.1|1107157_1107538_+|tail	phage tail protein	tail	A0A1P8DTJ2	Proteus_phage	98.4	1.5e-63
AYY80268.1|1107561_1107846_+	DUF4035 domain-containing protein	NA	A0A1P8DTH5	Proteus_phage	95.7	3.4e-44
AYY80269.1|1107865_1111132_+|tail	phage tail tape measure protein	tail	A0A1P8DTH2	Proteus_phage	83.4	0.0e+00
AYY80270.1|1111134_1111467_+|tail	phage tail protein	tail	A0A1P8DTI9	Proteus_phage	98.2	2.1e-61
AYY80271.1|1111463_1112213_+|tail	phage minor tail protein L	tail	A0A1P8DTI3	Proteus_phage	98.8	4.4e-144
AYY82969.1|1112218_1112926_+	peptidase P60	NA	A0A1P8DTI6	Proteus_phage	97.9	4.5e-138
AYY80272.1|1113016_1113517_+	hypothetical protein	NA	A0A1P8DTJ8	Proteus_phage	99.4	7.4e-87
AYY82970.1|1113588_1114167_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	99.5	7.7e-104
AYY80273.1|1114186_1117951_+	DUF1983 domain-containing protein	NA	A0A1P8DTI4	Proteus_phage	87.9	0.0e+00
AYY80274.1|1119691_1120426_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80275.1|1120926_1121733_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80276.1|1122133_1122880_+	SIR2 family protein	NA	NA	NA	NA	NA
AYY80277.1|1122852_1125246_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80278.1|1125802_1126936_-|integrase	integrase	integrase	Q77Z04	Phage_21	72.5	2.5e-154
AYY80279.1|1126910_1127162_-	excisionase	NA	NA	NA	NA	NA
AYY80280.1|1127247_1127772_-	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	60.5	1.9e-53
AYY80281.1|1128161_1128809_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	65.1	2.9e-75
AYY80282.1|1128912_1129107_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	61.0	6.5e-15
AYY80283.1|1129144_1129621_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	61.1	7.9e-46
AYY80284.1|1129683_1129893_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80285.1|1129882_1130062_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	3.4e-10
AYY82971.1|1130589_1131135_+	hypothetical protein	NA	S5FM81	Shigella_phage	46.9	6.5e-28
AYY80286.1|1131156_1131963_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.1	5.2e-90
AYY80287.1|1131959_1132985_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	46.5	1.9e-84
AYY80288.1|1133012_1133411_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	54.3	1.6e-31
AYY80289.1|1133751_1133964_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	81.4	3.1e-26
AYY80290.1|1134295_1134754_+	heat-shock protein	NA	NA	NA	NA	NA
AYY80291.1|1135603_1136614_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
AYY80292.1|1137106_1138456_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	97.8	2.6e-259
AYY80293.1|1139167_1139590_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80294.1|1139635_1139893_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	48.7	6.0e-16
AYY80295.1|1139804_1140257_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80296.1|1140400_1140670_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	2.7e-19
AYY80297.1|1140669_1141140_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	64.5	9.5e-52
AYY80298.1|1141282_1141798_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	36.6	3.5e-23
AYY80299.1|1141966_1142398_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80300.1|1142408_1143692_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80301.1|1143929_1144268_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	69.7	4.9e-42
AYY80302.1|1144384_1144852_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	3.2e-44
AYY80303.1|1144805_1146539_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.4	1.2e-147
AYY80304.1|1146538_1147807_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.0	1.9e-200
AYY80305.1|1147824_1148493_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	64.8	4.3e-82
AYY80306.1|1148496_1149663_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.8	7.3e-170
AYY80307.1|1149701_1150001_+	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	64.3	9.7e-34
AYY80308.1|1150000_1150330_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AYY80309.1|1150319_1150793_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	31.5	1.9e-12
AYY80310.1|1150798_1151140_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AYY80311.1|1151149_1151815_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80312.1|1151879_1152296_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80313.1|1152292_1152568_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
AYY80314.1|1152609_1155897_+|tail	phage tail tape measure protein	tail	Q3HQT9	Burkholderia_phage	40.8	3.3e-50
AYY80315.1|1155897_1156494_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	2.7e-51
AYY80316.1|1156493_1157075_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	49.5	3.4e-51
AYY80317.1|1157132_1157531_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	4.6e-31
AYY80318.1|1157530_1161289_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	52.1	2.0e-200
1160667:1160696	attL	AAGCCAATGCAACGGCGAATGCGGTAAGCC	NA	NA	NA	NA
AYY80319.1|1161292_1161544_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80320.1|1161528_1161792_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80321.1|1161788_1162430_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80322.1|1162668_1163559_-	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	81.4	3.8e-142
AYY80323.1|1163558_1165133_-	hypothetical protein	NA	K7PHD1	Enterobacteria_phage	87.6	6.7e-267
AYY80324.1|1166081_1166450_-|integrase	integrase	integrase	Q77Z04	Phage_21	75.4	3.7e-51
AYY80325.1|1167091_1168087_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AYY80326.1|1168111_1168621_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	73.8	2.2e-70
AYY80327.1|1168736_1168946_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80328.1|1169109_1169295_+	hypothetical protein	NA	A0A1V0E5R8	Salmonella_phage	59.6	3.5e-10
1170440:1170469	attR	AAGCCAATGCAACGGCGAATGCGGTAAGCC	NA	NA	NA	NA
>prophage 83
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1174036	1178357	4158443		Bacillus_phage(25.0%)	4	NA	NA
AYY80333.1|1174036_1174729_-	DNA-binding response regulator HprR	NA	W8CYM9	Bacillus_phage	34.4	2.8e-28
AYY80334.1|1175246_1175537_+	hypothetical protein	NA	A0A1W6JP25	Morganella_phage	68.8	1.7e-30
AYY80335.1|1176476_1177118_-	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	47.8	4.9e-51
AYY80336.1|1177130_1178357_-	DUF3440 domain-containing protein	NA	L0P6Z6	Lactobacillus_phage	34.9	1.4e-62
>prophage 84
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1183397	1183610	4158443		Morganella_phage(100.0%)	1	NA	NA
AYY80342.1|1183397_1183610_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.0	1.2e-25
>prophage 85
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1192875	1197441	4158443		Morganella_phage(33.33%)	5	NA	NA
AYY80354.1|1192875_1193235_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	54.1	6.4e-24
AYY80355.1|1193398_1194262_+	triacylglycerol lipase	NA	NA	NA	NA	NA
AYY80356.1|1194346_1194781_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	38.7	2.1e-21
AYY80357.1|1195084_1195822_+	phosphatase	NA	NA	NA	NA	NA
AYY82973.1|1195890_1197441_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.5	4.3e-08
>prophage 86
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1200550	1204288	4158443		Morganella_phage(50.0%)	5	NA	NA
AYY80361.1|1200550_1200985_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	45.1	1.0e-23
AYY80362.1|1201652_1202156_+	non-heme ferritin	NA	NA	NA	NA	NA
AYY80363.1|1202610_1203003_+	copper resistance protein CopC	NA	NA	NA	NA	NA
AYY80364.1|1203002_1203899_+	copper resistance D family protein	NA	NA	NA	NA	NA
AYY80365.1|1203946_1204288_+	DUF2511 domain-containing protein	NA	A0A2H4JCQ9	uncultured_Caudovirales_phage	31.8	1.7e-05
>prophage 87
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1210142	1212203	4158443		Moraxella_phage(100.0%)	1	NA	NA
AYY80371.1|1210142_1212203_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.2	3.9e-81
>prophage 88
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1218502	1219069	4158443		Bacillus_phage(100.0%)	1	NA	NA
AYY80375.1|1218502_1219069_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	30.5	1.2e-05
>prophage 89
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1223701	1224589	4158443		Cedratvirus(100.0%)	1	NA	NA
AYY80381.1|1223701_1224589_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	27.9	3.9e-14
>prophage 90
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1230246	1243767	4158443	tRNA	Tupanvirus(55.56%)	12	NA	NA
AYY80389.1|1230246_1232175_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	3.9e-128
AYY80390.1|1232178_1232718_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.4	3.7e-15
AYY80391.1|1232811_1233009_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AYY80392.1|1233051_1233408_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AYY80393.1|1233735_1234719_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.7	4.9e-34
AYY80394.1|1234733_1237121_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	26.4	1.0e-08
AYY80395.1|1237125_1237422_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.2e-13
AYY80396.1|1237741_1238773_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AYY80397.1|1238774_1239521_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.5	3.2e-09
AYY80398.1|1239658_1240804_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.0	5.9e-39
AYY80399.1|1240804_1241785_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	34.1	9.6e-38
AYY80400.1|1241784_1243767_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	27.2	1.9e-21
>prophage 91
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1247227	1250567	4158443		Bacillus_phage(33.33%)	4	NA	NA
AYY80405.1|1247227_1247719_+	endopeptidase	NA	S5MM68	Bacillus_phage	43.9	3.1e-13
AYY80406.1|1247796_1248816_+	lipoate--protein ligase	NA	NA	NA	NA	NA
AYY80407.1|1248890_1249259_-	AraC family transcriptional regulator	NA	D0R0F8	Streptococcus_phage	37.4	4.6e-09
AYY80408.1|1249772_1250567_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	25.7	4.4e-09
>prophage 92
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1265536	1270165	4158443		Pandoravirus(50.0%)	3	NA	NA
AYY80420.1|1265536_1266586_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	46.0	2.6e-81
AYY80421.1|1266707_1267574_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AYY80422.1|1267792_1270165_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	38.2	2.7e-179
>prophage 93
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1276622	1281834	4158443		uncultured_virus(33.33%)	5	NA	NA
AYY80427.1|1276622_1276991_+	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	32.7	3.0e-13
AYY80428.1|1277008_1278511_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AYY80429.1|1278555_1279302_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	29.9	9.3e-09
AYY80430.1|1279276_1280584_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AYY80431.1|1280592_1281834_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	40.6	9.8e-88
>prophage 94
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1293161	1298664	4158443		Orpheovirus(25.0%)	5	NA	NA
AYY80441.1|1293161_1293821_+	riboflavin synthase subunit alpha	NA	A0A2I2L4R9	Orpheovirus	34.4	7.1e-21
AYY80442.1|1293916_1295071_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	46.6	8.0e-84
AYY80443.1|1295377_1296595_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.5	8.6e-12
AYY80444.1|1296713_1297616_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYY80445.1|1297638_1298664_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.8	4.8e-32
>prophage 95
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1301690	1302329	4158443		Acaryochloris_phage(100.0%)	1	NA	NA
AYY80450.1|1301690_1302329_-	ribonuclease T	NA	L0N5X9	Acaryochloris_phage	24.0	6.9e-05
>prophage 96
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1306955	1308230	4158443	tRNA	Pectobacterium_phage(100.0%)	1	NA	NA
AYY80457.1|1306955_1308230_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.7	8.8e-84
>prophage 97
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1312722	1314523	4158443		Planktothrix_phage(100.0%)	2	NA	NA
AYY80463.1|1312722_1313532_-	peptide ABC transporter ATP-binding protein SapF	NA	G9BWD6	Planktothrix_phage	27.4	2.1e-14
AYY80464.1|1313521_1314523_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	30.2	1.3e-05
>prophage 98
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1332157	1333081	4158443	tRNA	Escherichia_phage(100.0%)	1	NA	NA
AYY82975.1|1332157_1333081_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	88.7	2.2e-129
>prophage 99
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1336882	1337419	4158443		Salmonella_phage(100.0%)	1	NA	NA
AYY80487.1|1336882_1337419_+	attachment protein	NA	A0A1B0VBR9	Salmonella_phage	42.4	9.9e-29
>prophage 100
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1344723	1346538	4158443		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYY80498.1|1344723_1346538_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	2.9e-16
>prophage 101
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1351784	1354738	4158443		Acinetobacter_phage(100.0%)	3	NA	NA
AYY80504.1|1351784_1353140_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	4.5e-38
AYY80505.1|1353144_1354143_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	39.3	4.2e-57
AYY80506.1|1354144_1354738_-	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	37.4	3.4e-30
>prophage 102
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1362194	1367552	4158443	protease	Bodo_saltans_virus(33.33%)	4	NA	NA
AYY80513.1|1362194_1363241_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.8	8.4e-24
AYY80514.1|1363715_1363964_-	DUF2498 family protein	NA	NA	NA	NA	NA
AYY80515.1|1364271_1366869_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	35.7	1.7e-89
AYY80516.1|1367027_1367552_+	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	49.4	7.4e-37
>prophage 103
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1373697	1374297	4158443		Staphylococcus_phage(100.0%)	1	NA	NA
AYY80521.1|1373697_1374297_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.3	1.9e-41
>prophage 104
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1378643	1381323	4158443		Clostridium_phage(50.0%)	2	NA	NA
AYY80528.1|1378643_1379192_-	RNA 2'-phosphotransferase	NA	A0A0A8WJJ2	Clostridium_phage	44.4	4.2e-43
AYY80529.1|1379376_1381323_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	22.8	9.5e-05
>prophage 105
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1409436	1413732	4158443		uncultured_Caudovirales_phage(100.0%)	5	NA	NA
AYY80557.1|1409436_1409772_+	ArsR family transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.3	2.3e-20
AYY80558.1|1409819_1410191_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AYY80559.1|1410203_1411955_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AYY80560.1|1412006_1413296_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.1	1.6e-170
AYY80561.1|1413306_1413732_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	67.1	6.8e-49
>prophage 106
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1438213	1439608	4158443		Mycobacterium_phage(100.0%)	1	NA	NA
AYY80583.1|1438213_1439608_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.1	2.8e-14
>prophage 107
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1452243	1457375	4158443		Tupanvirus(50.0%)	3	NA	NA
AYY80593.1|1452243_1453842_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.9	3.6e-58
AYY80594.1|1454434_1456519_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AYY80595.1|1456592_1457375_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.4	7.2e-12
>prophage 108
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1468883	1471906	4158443		Tupanvirus(50.0%)	3	NA	NA
AYY80604.1|1468883_1470617_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	26.0	1.6e-40
AYY80605.1|1470676_1470997_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
AYY80606.1|1471057_1471906_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	53.8	8.3e-22
>prophage 109
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1475720	1476290	4158443		Enterobacteria_phage(100.0%)	1	NA	NA
AYY80611.1|1475720_1476290_-	hypothetical protein	NA	A5LH44	Enterobacteria_phage	32.4	1.9e-17
>prophage 110
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1484712	1487163	4158443		Dickeya_phage(100.0%)	1	NA	NA
AYY80617.1|1484712_1487163_+	glycogen/starch/alpha-glucan phosphorylase	NA	A0A140XAG6	Dickeya_phage	60.8	4.5e-20
>prophage 111
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1505830	1513413	4158443		Escherichia_phage(60.0%)	8	NA	NA
AYY80634.1|1505830_1506448_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	1.7e-72
AYY80635.1|1506449_1507307_+	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	33.3	1.7e-22
AYY80636.1|1507480_1508092_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	1.0e-29
AYY80637.1|1508178_1508640_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	1.5e-12
AYY80638.1|1508639_1509326_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AYY80639.1|1509554_1509638_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AYY80640.1|1509640_1511344_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AYY80641.1|1511355_1513413_+	K(+)-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	25.7	6.7e-33
>prophage 112
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1519283	1522052	4158443		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AYY80647.1|1519283_1522052_-	ABC transporter ATP-binding protein/permease	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.7	3.2e-22
>prophage 113
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1525322	1570557	4158443	portal,tail,holin,lysis,capsid,integrase,head,plate	Salmonella_phage(28.12%)	51	1535941:1535956	1578129:1578144
AYY80650.1|1525322_1526315_+|integrase	integrase	integrase	A0A1L4BKH1	Thermus_phage	28.2	2.0e-11
AYY80651.1|1526426_1527878_-	AMP nucleosidase	NA	NA	NA	NA	NA
AYY80652.1|1527944_1529228_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80653.1|1529347_1530256_-	AEC family transporter	NA	NA	NA	NA	NA
AYY82979.1|1530448_1530934_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYY80654.1|1531071_1532181_+	glycerol acyltransferase	NA	NA	NA	NA	NA
AYY80655.1|1532174_1533056_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80656.1|1533039_1535553_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	33.9	6.3e-33
AYY80657.1|1535641_1536124_-	hypothetical protein	NA	NA	NA	NA	NA
1535941:1535956	attL	AAAATTGATAATAAAA	NA	NA	NA	NA
AYY80658.1|1536374_1537016_+	type A chloramphenicol O-acetyltransferase	NA	A0A1I9LJQ7	Stx_converting_phage	50.2	2.9e-59
AYY80659.1|1537621_1538236_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80660.1|1538434_1538653_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	70.3	2.2e-19
AYY80661.1|1538705_1539803_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	54.6	3.3e-111
AYY80662.1|1539802_1540267_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	55.5	2.6e-41
AYY80663.1|1540266_1543128_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	42.8	4.6e-125
AYY82980.1|1543120_1543294_-|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	52.6	5.6e-10
AYY80664.1|1543254_1543602_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	55.7	2.3e-18
AYY80665.1|1543621_1544137_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	55.6	1.5e-53
AYY80666.1|1544140_1545313_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	69.8	5.1e-163
AYY80667.1|1545405_1545741_-	hypothetical protein	NA	B6SCW7	Bacteriophage	48.0	2.3e-12
AYY80668.1|1547355_1547967_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	68.4	3.6e-75
AYY80669.1|1547959_1548868_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	66.2	4.8e-108
AYY80670.1|1548869_1549208_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	51.4	3.8e-26
AYY80671.1|1549204_1549831_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	59.6	1.7e-56
AYY80672.1|1549896_1550532_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	40.8	1.5e-28
AYY80673.1|1550518_1550959_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	49.3	9.2e-33
AYY80674.1|1550933_1551437_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AYY80675.1|1551433_1551838_-	M15 family peptidase	NA	K4F776	Cronobacter_phage	58.1	1.3e-38
AYY80676.1|1551830_1552145_-|holin	holin	holin	NA	NA	NA	NA
AYY80677.1|1552164_1552371_-|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	55.9	8.7e-18
AYY80678.1|1552370_1552826_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.9	1.1e-28
AYY80679.1|1552900_1553572_-	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.6	3.2e-45
AYY80680.1|1553571_1554714_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	67.1	3.5e-124
AYY80681.1|1554729_1555539_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	49.8	1.6e-67
AYY80682.1|1555711_1557466_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	72.7	2.8e-258
AYY80683.1|1557465_1558494_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	68.7	1.9e-137
AYY80684.1|1559018_1560083_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80685.1|1560082_1561210_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80686.1|1561221_1561869_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80687.1|1564267_1564591_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80688.1|1564590_1565418_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	47.1	3.7e-59
AYY80689.1|1565419_1565641_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	47.2	1.9e-10
AYY80690.1|1565633_1565891_-	DUF2732 family protein	NA	NA	NA	NA	NA
AYY80691.1|1565909_1566305_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80692.1|1566508_1566784_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80693.1|1566776_1566974_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80694.1|1566945_1567146_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80695.1|1567142_1567403_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	56.3	2.4e-20
AYY80696.1|1567504_1567804_+	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	65.7	1.0e-30
AYY80697.1|1567870_1568860_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	56.0	1.1e-105
AYY80698.1|1568991_1570557_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	33.0	3.0e-41
1578129:1578144	attR	TTTTATTATCAATTTT	NA	NA	NA	NA
>prophage 114
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1581359	1581989	4158443		Escherichia_phage(100.0%)	1	NA	NA
AYY80706.1|1581359_1581989_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	54.9	1.4e-61
>prophage 115
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1593073	1596952	4158443		Catovirus(100.0%)	1	NA	NA
AYY82982.1|1593073_1596952_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	29.2	1.0e-58
>prophage 116
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1605899	1608583	4158443		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
AYY80721.1|1605899_1606904_+	2-hydroxyacid dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	42.7	6.1e-64
AYY80722.1|1606984_1608583_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.4	4.7e-10
>prophage 117
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1612186	1612837	4158443		Bacillus_virus(100.0%)	1	NA	NA
AYY80726.1|1612186_1612837_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	35.2	2.9e-22
>prophage 118
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1622376	1631555	4158443	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
AYY80736.1|1622376_1624065_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	24.8	7.2e-33
AYY80737.1|1624365_1624962_-	Slp family lipoprotein	NA	NA	NA	NA	NA
AYY80738.1|1625048_1625750_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AYY80739.1|1625842_1627786_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.3	1.2e-87
AYY80740.1|1627869_1628214_+	RidA family protein	NA	NA	NA	NA	NA
AYY80741.1|1628728_1629061_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
AYY82985.1|1629063_1629504_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
AYY80742.1|1630079_1631555_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.9	9.5e-82
>prophage 119
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1635580	1645458	4158443	tRNA	Bacillus_virus(33.33%)	11	NA	NA
AYY80746.1|1635580_1636906_-	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	38.5	1.6e-16
AYY80747.1|1636918_1637863_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AYY80748.1|1637937_1638663_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	30.8	5.6e-19
AYY80749.1|1638655_1639441_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AYY80750.1|1639539_1640019_-	hypothetical protein	NA	A0A0B4N0V6	Escherichia_phage	40.0	7.0e-18
AYY80751.1|1640056_1641067_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.0	8.1e-08
AYY80752.1|1641079_1641700_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AYY80753.1|1641803_1642325_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	30.2	1.8e-11
AYY80754.1|1642451_1643207_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYY80755.1|1643235_1643670_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AYY80756.1|1643673_1645458_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	38.4	9.3e-07
>prophage 120
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1649201	1654201	4158443	tRNA	Klosneuvirus(50.0%)	4	NA	NA
AYY80761.1|1649201_1650776_+	ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	23.9	8.2e-23
AYY80762.1|1650836_1651589_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AYY80763.1|1651743_1652298_-	VOC family protein	NA	NA	NA	NA	NA
AYY80764.1|1652470_1654201_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	2.7e-88
>prophage 121
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1666786	1673191	4158443		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
AYY80774.1|1666786_1668487_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.3	1.1e-33
AYY80775.1|1668609_1669548_-	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
AYY80776.1|1669555_1670410_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.3	1.4e-45
AYY80777.1|1670467_1671283_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
AYY80778.1|1671260_1672109_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AYY80779.1|1672108_1673191_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	3.9e-08
>prophage 122
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1676320	1677268	4158443		Tupanvirus(100.0%)	1	NA	NA
AYY80783.1|1676320_1677268_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.0e-44
>prophage 123
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1686162	1686975	4158443		Bacillus_virus(100.0%)	1	NA	NA
AYY80792.1|1686162_1686975_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	24.3	6.7e-13
>prophage 124
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1692951	1694898	4158443		Burkholderia_virus(50.0%)	2	NA	NA
AYY80798.1|1692951_1693830_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.3	2.3e-19
AYY80799.1|1694001_1694898_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	64.9	7.3e-93
>prophage 125
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1703630	1704416	4158443		Cronobacter_phage(100.0%)	1	NA	NA
AYY80810.1|1703630_1704416_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	64.8	2.2e-85
>prophage 126
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1708957	1710339	4158443		Morganella_phage(100.0%)	3	NA	NA
AYY80816.1|1708957_1709395_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	44.9	7.8e-24
AYY80817.1|1709460_1709799_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80818.1|1709910_1710339_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	43.7	1.1e-22
>prophage 127
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1714352	1714817	4158443		Rock_bream_iridovirus(100.0%)	1	NA	NA
AYY80823.1|1714352_1714817_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	35.1	1.2e-19
>prophage 128
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1718252	1729681	4158443	holin	Catovirus(20.0%)	9	NA	NA
AYY80827.1|1718252_1719932_-|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	28.7	2.4e-49
AYY80828.1|1719971_1721447_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AYY80829.1|1721472_1722075_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
AYY80830.1|1722284_1724327_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.3	2.9e-20
AYY80831.1|1724391_1725006_-	LysE family translocator	NA	NA	NA	NA	NA
AYY80832.1|1725210_1726086_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYY80833.1|1726244_1727402_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X6WGT4	Pacmanvirus	22.3	5.6e-13
AYY80834.1|1727690_1728698_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.8	2.8e-16
AYY80835.1|1728694_1729681_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.0e-15
>prophage 129
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1743935	1745475	4158443		Planktothrix_phage(100.0%)	2	NA	NA
AYY80846.1|1743935_1744772_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	6.3e-14
AYY80847.1|1744761_1745475_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.5	3.0e-25
>prophage 130
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1750626	1761771	4158443		Cronobacter_phage(20.0%)	10	NA	NA
AYY80850.1|1750626_1751223_-	thymidine kinase	NA	A0A1D3RL22	Cronobacter_phage	56.8	1.6e-56
AYY80851.1|1751732_1752137_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
AYY80852.1|1752370_1753378_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	31.0	1.0e-34
AYY80853.1|1753632_1754544_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.1	3.6e-63
AYY80854.1|1754722_1755742_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
AYY80855.1|1755891_1756365_+	YchJ family protein	NA	NA	NA	NA	NA
AYY80856.1|1756403_1757252_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	43.8	1.3e-14
AYY80857.1|1757623_1758487_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYY82988.1|1758935_1759742_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AYY80858.1|1759809_1761771_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.1	1.4e-43
>prophage 131
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1767075	1767720	4158443		Tupanvirus(100.0%)	1	NA	NA
AYY80863.1|1767075_1767720_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.5	6.3e-22
>prophage 132
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1784644	1785019	4158443		uncultured_virus(100.0%)	1	NA	NA
AYY80880.1|1784644_1785019_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	48.7	3.9e-16
>prophage 133
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1789243	1789606	4158443		Burkholderia_virus(100.0%)	1	NA	NA
AYY80884.1|1789243_1789606_-	hypothetical protein	NA	A4JWN1	Burkholderia_virus	44.7	1.5e-17
>prophage 134
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1792703	1793777	4158443		Bacillus_virus(100.0%)	1	NA	NA
AYY80887.1|1792703_1793777_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.6	2.4e-26
>prophage 135
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1804980	1805418	4158443		Morganella_phage(100.0%)	1	NA	NA
AYY80897.1|1804980_1805418_+	XRE family transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	40.7	3.0e-07
>prophage 136
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1822915	1827154	4158443		Acanthamoeba_polyphaga_mimivirus(33.33%)	6	NA	NA
AYY80911.1|1822915_1823704_+	glucose 1-dehydrogenase	NA	A0A0G2Y924	Acanthamoeba_polyphaga_mimivirus	33.3	5.4e-07
AYY80912.1|1823773_1824355_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80913.1|1824333_1824741_-	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
AYY80914.1|1825446_1825704_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80915.1|1825813_1826506_+	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	48.9	2.3e-54
AYY80916.1|1826527_1827154_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	32.0	4.1e-18
>prophage 137
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1831440	1879639	4158443	terminase,integrase,tail,holin	Salmonella_phage(19.05%)	57	1852684:1852701	1889003:1889020
AYY80922.1|1831440_1832493_-	nucleotidyltransferase	NA	I1TRN7	Cronobacter_phage	26.2	3.0e-29
AYY80923.1|1832476_1833256_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	39.6	3.4e-30
AYY80924.1|1833403_1833991_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80925.1|1834331_1834826_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80926.1|1834825_1835170_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	85.3	1.2e-43
AYY80927.1|1835172_1835445_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	38.9	1.9e-12
AYY80928.1|1835441_1835813_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	40.0	5.1e-16
AYY80929.1|1836012_1836375_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	61.5	3.4e-33
AYY80930.1|1836374_1837295_+	glycosyltransferase	NA	M1FQW5	Enterobacteria_phage	84.6	5.6e-149
AYY80931.1|1837297_1838719_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80932.1|1838789_1841342_-	hypothetical protein	NA	A0A193GYU1	Enterobacter_phage	55.9	6.5e-86
AYY80933.1|1841515_1841767_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80934.1|1841791_1842091_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80935.1|1842101_1845479_-	hypothetical protein	NA	A0A2I7RY58	Vibrio_phage	36.1	2.3e-184
AYY80936.1|1845478_1848265_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	44.7	2.3e-121
AYY80937.1|1848267_1848816_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	60.2	3.4e-45
AYY80938.1|1848815_1849304_-	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	59.9	3.5e-49
AYY80939.1|1849287_1851750_-	hypothetical protein	NA	Q858G3	Salmonella_phage	70.1	0.0e+00
AYY80940.1|1851749_1852355_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	60.7	5.1e-66
AYY80941.1|1852354_1852666_-	hypothetical protein	NA	Q858G5	Salmonella_phage	38.5	1.5e-13
1852684:1852701	attL	AAGTAGAAAATAAAAAAG	NA	NA	NA	NA
AYY80942.1|1852729_1853071_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80943.1|1853079_1853511_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	54.8	1.1e-30
AYY80944.1|1853569_1854550_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	59.4	6.5e-111
AYY82990.1|1854565_1855243_-	peptidase	NA	T1SAP9	Salmonella_phage	63.6	1.2e-42
AYY80945.1|1855272_1855587_-	hypothetical protein	NA	Q2A090	Sodalis_phage	45.5	1.2e-13
AYY80946.1|1855583_1857248_-|tail	phage tail protein	tail	A0A193GYI4	Enterobacter_phage	66.1	2.6e-200
AYY80947.1|1857257_1857467_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80948.1|1857652_1859137_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	77.8	1.2e-230
AYY80949.1|1859136_1859706_-|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	50.3	3.4e-43
AYY80950.1|1859858_1860218_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	55.7	3.3e-28
AYY80951.1|1860277_1860853_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80952.1|1860984_1861380_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.9	5.2e-35
AYY80953.1|1861376_1861790_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80954.1|1862036_1862762_-	DNA replication protein DnaC	NA	A0A1W6JP39	Morganella_phage	78.8	6.7e-105
AYY80955.1|1862761_1863604_-	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	59.7	3.8e-51
AYY80956.1|1863614_1863800_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	50.8	6.0e-10
AYY80957.1|1863938_1864217_-	hypothetical protein	NA	NA	NA	NA	NA
AYY80958.1|1864294_1864903_+	XRE family transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	35.4	1.5e-28
AYY80959.1|1865299_1867024_+	DNA breaking-rejoining protein	NA	A0A0U2I1R6	Escherichia_phage	46.7	6.1e-112
AYY80960.1|1867069_1868110_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	50.7	1.9e-100
AYY80961.1|1868153_1868411_+	AlpA family phage regulatory protein	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	35.2	3.6e-05
AYY80962.1|1868475_1868811_+	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	39.3	5.4e-25
AYY80963.1|1868847_1869129_+	hypothetical protein	NA	A0A1P8DTG9	Proteus_phage	95.7	1.0e-48
AYY80964.1|1869128_1869662_+	hypothetical protein	NA	J9Q748	Salmonella_phage	47.4	1.2e-37
AYY80965.1|1869724_1869994_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80966.1|1870104_1870824_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80967.1|1870858_1871122_+	hypothetical protein	NA	A0A1U9ZAB3	Proteus_phage	51.2	6.8e-15
AYY80968.1|1871432_1871663_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80969.1|1871655_1872054_+	DUF2591 domain-containing protein	NA	A0A2I7S0T5	Vibrio_phage	42.1	4.6e-15
AYY82991.1|1872073_1872511_+	SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	76.9	1.1e-62
AYY80970.1|1872507_1873149_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	61.1	1.7e-72
AYY80971.1|1873151_1873349_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	65.1	3.4e-19
AYY80972.1|1873348_1873537_+	hypothetical protein	NA	NA	NA	NA	NA
AYY80973.1|1873544_1874741_-|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	62.2	2.1e-140
AYY80974.1|1874959_1876537_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
AYY80975.1|1876620_1878087_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	6.1e-89
AYY80976.1|1878256_1879639_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.5	1.2e-38
1889003:1889020	attR	CTTTTTTATTTTCTACTT	NA	NA	NA	NA
>prophage 138
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1897074	1899319	4158443		Streptococcus_phage(50.0%)	3	NA	NA
AYY80992.1|1897074_1897773_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	25.1	6.6e-09
AYY80993.1|1897851_1898463_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AYY80994.1|1898605_1899319_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	36.6	1.2e-37
>prophage 139
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1906730	1907087	4158443		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYY81002.1|1906730_1907087_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	42.1	9.5e-12
>prophage 140
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1911631	1915592	4158443		Prochlorococcus_phage(66.67%)	4	NA	NA
AYY81004.1|1911631_1912933_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.9	4.1e-60
AYY81005.1|1913049_1913676_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AYY81006.1|1913908_1914949_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	47.3	8.8e-74
AYY81007.1|1914962_1915592_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.6	6.1e-30
>prophage 141
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1924265	1925732	4158443		Acinetobacter_phage(100.0%)	1	NA	NA
AYY81014.1|1924265_1925732_-	dipeptide/tripeptide permease DtpA	NA	A0A0P0IY73	Acinetobacter_phage	29.9	7.1e-53
>prophage 142
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1933737	1937345	4158443		Bacillus_phage(50.0%)	3	NA	NA
AYY81018.1|1933737_1935114_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	30.3	1.6e-35
AYY81019.1|1935137_1935845_+	two-component system response regulator BaeR	NA	NA	NA	NA	NA
AYY81020.1|1935965_1937345_+	U32 family peptidase	NA	Q6DW11	Phage_TP	81.9	3.0e-178
>prophage 143
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1947562	1953812	4158443		Agrobacterium_phage(33.33%)	6	NA	NA
AYY81029.1|1947562_1948402_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	31.2	2.9e-11
AYY81030.1|1948502_1949975_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
AYY81031.1|1951312_1951546_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	68.9	6.0e-15
AYY81032.1|1951645_1952035_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81033.1|1952131_1952314_-	YoaH family protein	NA	NA	NA	NA	NA
AYY81034.1|1952432_1953812_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	36.7	1.1e-36
>prophage 144
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1958896	1960976	4158443		Morganella_phage(100.0%)	3	NA	NA
AYY81040.1|1958896_1959343_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	34.0	4.2e-09
AYY81041.1|1959530_1960349_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYY81042.1|1960541_1960976_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	50.0	6.1e-29
>prophage 145
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1984883	1985114	4158443		Proteus_phage(100.0%)	1	NA	NA
AYY81062.1|1984883_1985114_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	96.1	3.7e-33
>prophage 146
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	1991725	2029142	4158443	terminase,protease,holin,lysis,tail	Cronobacter_phage(20.51%)	58	NA	NA
AYY81067.1|1991725_1992313_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	59.4	5.5e-57
AYY81068.1|1992309_1993020_-	peptidase P60	NA	F1C573	Cronobacter_phage	65.2	3.1e-86
AYY81069.1|1993016_1993760_-|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	59.0	1.0e-87
AYY81070.1|1993756_1994098_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	49.1	4.5e-27
AYY81071.1|1994241_1994442_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81072.1|1994461_1994752_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81073.1|1994763_1997562_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	31.4	8.6e-100
AYY81074.1|1997628_1997862_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81075.1|1997985_2000007_-	ATP-binding protein	NA	NA	NA	NA	NA
AYY81076.1|2000184_2000919_-	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	56.8	3.6e-66
AYY81077.1|2001962_2002760_+	helix-turn-helix domain-containing protein	NA	A0A1V0E8B5	Vibrio_phage	34.8	7.8e-22
AYY81078.1|2002784_2003135_+	hypothetical protein	NA	NA	NA	NA	NA
AYY82995.1|2003210_2003693_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
AYY81079.1|2003702_2003882_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81080.1|2004272_2004674_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81081.1|2004799_2005786_-|protease	serine protease	protease	A0A2H4JE36	uncultured_Caudovirales_phage	38.6	4.8e-29
AYY81082.1|2005848_2006043_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81083.1|2006157_2006364_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81084.1|2006389_2006668_-	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	1.9e-12
AYY81085.1|2006694_2007000_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	56.4	6.0e-23
AYY81086.1|2007052_2007709_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	56.7	5.6e-58
AYY81087.1|2007754_2008156_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81088.1|2008152_2008605_-	hypothetical protein	NA	I6PCW1	Cronobacter_phage	53.4	3.2e-36
AYY81089.1|2008606_2008960_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	43.0	8.5e-21
AYY81090.1|2008962_2009442_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	8.5e-32
AYY81091.1|2009479_2009593_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81092.1|2009766_2010720_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.6	1.1e-126
AYY81093.1|2010733_2011507_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	3.8e-66
AYY81094.1|2011604_2011850_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81095.1|2011918_2013040_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	50.7	7.0e-101
AYY81096.1|2013036_2014407_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.7	1.3e-122
AYY81097.1|2014406_2015894_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	87.8	1.9e-263
AYY81098.1|2015896_2016499_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	78.5	2.1e-75
AYY81099.1|2016563_2017115_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81100.1|2017186_2017378_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	73.3	3.9e-20
AYY81101.1|2017383_2017572_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81102.1|2018740_2019193_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	78.5	4.1e-52
AYY81103.1|2019189_2019594_-	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.8	2.0e-26
AYY81104.1|2019586_2019874_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AYY81105.1|2019870_2020260_-	hypothetical protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
AYY81106.1|2020571_2021327_-	antitermination protein	NA	G0ZNC6	Cronobacter_phage	45.8	3.8e-50
AYY82996.1|2021323_2021539_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81107.1|2021528_2021894_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	63.2	3.0e-37
AYY81108.1|2021890_2022181_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	80.0	5.7e-39
AYY81109.1|2022292_2022580_-	hypothetical protein	NA	A0A1X9Y877	Proteus_phage	64.8	4.6e-25
AYY81110.1|2022576_2022945_-	hypothetical protein	NA	A0A1P8DTF9	Proteus_phage	39.3	1.8e-10
AYY81111.1|2022941_2023148_-	hypothetical protein	NA	L0AQP4	Klebsiella_phage	79.4	2.9e-21
AYY81112.1|2023140_2023590_-	hypothetical protein	NA	A0A2I7R8L6	Vibrio_phage	34.8	4.9e-13
AYY81113.1|2023603_2023831_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81114.1|2023817_2024087_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81115.1|2024106_2024961_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	59.6	1.7e-86
AYY81116.1|2024964_2025780_-	hypothetical protein	NA	G8C7U5	Escherichia_phage	57.5	9.3e-79
AYY81117.1|2025757_2026471_-	GIY-YIG nuclease family protein	NA	A0A088F856	Sulfitobacter_phage	50.7	9.5e-11
AYY81118.1|2026563_2026899_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	99.1	1.0e-52
AYY81119.1|2027041_2027269_-	helix-turn-helix domain-containing protein	NA	E5AGE7	Erwinia_phage	67.6	6.0e-20
AYY82997.1|2027373_2028099_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	42.6	1.6e-45
AYY81120.1|2028198_2028486_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	58.9	1.8e-29
AYY81121.1|2028482_2029142_+	hypothetical protein	NA	A0A0P0ZCT8	Stx2-converting_phage	66.4	4.6e-44
>prophage 147
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2032204	2100613	4158443	terminase,protease,holin,lysis,integrase,tail	Proteus_phage(23.94%)	109	2030909:2030941	2092423:2092455
2030909:2030941	attL	TTGATTAATAGATAGGAGATAGAGATGGAAATT	NA	NA	NA	NA
AYY81128.1|2032204_2033131_+	recombinase RecT	NA	F1C5B8	Cronobacter_phage	66.2	3.4e-109
AYY81129.1|2033127_2033826_+	exonuclease	NA	A0A2R2Z325	Escherichia_phage	57.8	7.0e-75
AYY81130.1|2033815_2034307_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	64.2	1.0e-56
AYY81131.1|2034339_2034543_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81132.1|2034581_2034917_+	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	39.9	1.1e-25
AYY81133.1|2034953_2035235_+	hypothetical protein	NA	A0A1P8DTG9	Proteus_phage	91.4	8.5e-48
AYY81134.1|2035231_2035411_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81135.1|2035420_2035708_+	hypothetical protein	NA	A0A1B0UY37	Roseobacter_phage	43.2	7.4e-15
AYY81136.1|2035707_2035977_+	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	55.1	1.8e-15
AYY81137.1|2036287_2037250_+	DNA (cytosine-5-)-methyltransferase	NA	A0A2I7R868	Vibrio_phage	45.0	8.4e-87
AYY81138.1|2037508_2037850_+	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	43.0	9.7e-14
AYY81139.1|2037836_2038439_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	56.7	5.4e-60
AYY81140.1|2038448_2038643_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	92.2	1.2e-29
AYY81141.1|2038635_2038854_+	hypothetical protein	NA	A0A1P8DTI1	Proteus_phage	100.0	1.8e-34
AYY81142.1|2039055_2040102_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	36.5	1.2e-59
AYY81143.1|2040934_2042047_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
AYY81144.1|2042434_2043853_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
AYY81145.1|2043872_2044271_+	flagella export chaperone FliS	NA	NA	NA	NA	NA
AYY81146.1|2044289_2044643_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
AYY81147.1|2044776_2045232_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYY81148.1|2045381_2046515_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81149.1|2046872_2047088_-	hypothetical protein	NA	NA	NA	NA	NA
AYY82998.1|2047192_2047423_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81150.1|2047477_2047819_-	GlpM family protein	NA	NA	NA	NA	NA
AYY81151.1|2047891_2048143_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81152.1|2048709_2048940_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	96.1	3.7e-33
AYY81153.1|2049133_2049700_+	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
AYY81154.1|2049696_2050104_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81155.1|2050235_2051696_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	60.3	1.7e-139
AYY81156.1|2055589_2056177_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	59.4	5.5e-57
AYY81157.1|2056173_2056884_-	peptidase P60	NA	F1C573	Cronobacter_phage	64.3	1.2e-85
AYY81158.1|2056880_2057624_-|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	59.0	1.0e-87
AYY81159.1|2057620_2057962_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	49.1	4.5e-27
AYY81160.1|2058105_2058306_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81161.1|2058325_2058616_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81162.1|2058627_2061447_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	31.9	8.4e-103
AYY81163.1|2061508_2061820_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81164.1|2061881_2062763_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81165.1|2062875_2063655_-	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	47.7	1.4e-47
AYY81166.1|2063731_2064304_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	54.0	3.6e-29
AYY81167.1|2064375_2064549_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AYY81168.1|2064704_2065025_+	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	71.4	2.2e-15
AYY82999.1|2065101_2065584_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
AYY81169.1|2065593_2065773_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81170.1|2066163_2066565_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81171.1|2066690_2067677_-|protease	serine protease	protease	A0A2H4JE36	uncultured_Caudovirales_phage	38.6	4.8e-29
AYY81172.1|2067739_2067934_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81173.1|2068048_2068255_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81174.1|2068280_2068559_-	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	1.9e-12
AYY81175.1|2068585_2068891_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	56.4	6.0e-23
AYY81176.1|2068943_2069600_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	56.7	5.6e-58
AYY81177.1|2069645_2070047_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81178.1|2070043_2070496_-	hypothetical protein	NA	I6PCW1	Cronobacter_phage	53.4	3.2e-36
AYY81179.1|2070497_2070851_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	43.0	8.5e-21
AYY81180.1|2070853_2071333_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	8.5e-32
AYY81181.1|2071370_2071484_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81182.1|2071657_2072611_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.6	1.1e-126
AYY81183.1|2072624_2073398_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	3.8e-66
AYY81184.1|2073495_2073741_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81185.1|2073809_2074931_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	50.7	7.0e-101
AYY81186.1|2074927_2076298_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.7	1.3e-122
AYY81187.1|2076297_2077785_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	87.8	1.9e-263
AYY81188.1|2077787_2078390_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	78.5	2.1e-75
AYY81189.1|2078454_2079006_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81190.1|2079077_2079269_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	73.3	3.9e-20
AYY81191.1|2079274_2079463_-	hypothetical protein	NA	NA	NA	NA	NA
AYY83000.1|2079547_2080087_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	73.6	9.2e-75
AYY81192.1|2080632_2081085_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	78.5	4.1e-52
AYY81193.1|2081081_2081486_-	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.8	2.0e-26
AYY81194.1|2081478_2081766_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AYY81195.1|2081762_2082152_-	hypothetical protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
AYY81196.1|2082463_2083219_-	antitermination protein	NA	G0ZNC6	Cronobacter_phage	45.8	3.8e-50
AYY83001.1|2083215_2083431_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81197.1|2083420_2083786_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	63.2	3.0e-37
AYY81198.1|2083782_2084073_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	80.0	5.7e-39
AYY81199.1|2084184_2084472_-	hypothetical protein	NA	A0A1X9Y877	Proteus_phage	64.8	4.6e-25
AYY81200.1|2084468_2084837_-	hypothetical protein	NA	A0A1P8DTF9	Proteus_phage	39.3	1.8e-10
AYY81201.1|2084833_2085040_-	hypothetical protein	NA	L0AQP4	Klebsiella_phage	79.4	2.9e-21
AYY81202.1|2085032_2085482_-	hypothetical protein	NA	A0A2I7R8L6	Vibrio_phage	34.8	4.9e-13
AYY81203.1|2085495_2085723_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81204.1|2085709_2085979_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81205.1|2085989_2086193_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81206.1|2086212_2087589_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	58.8	1.1e-156
AYY81207.1|2087588_2088683_-	DNA replication protein	NA	E5AGE9	Erwinia_phage	40.9	3.0e-72
AYY81208.1|2088939_2089281_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	93.7	9.3e-49
AYY81209.1|2089444_2089654_-	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	83.3	1.2e-25
AYY81210.1|2089759_2090404_+	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	64.2	1.5e-76
AYY81211.1|2090609_2090963_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81212.1|2091599_2091920_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	51.4	4.7e-18
AYY81213.1|2091922_2092228_+	hypothetical protein	NA	A0A2H4JDX9	uncultured_Caudovirales_phage	43.0	4.2e-16
AYY81214.1|2092446_2092716_+	hypothetical protein	NA	A0A2I7RQ39	Vibrio_phage	50.0	5.0e-13
2092423:2092455	attR	TTGATTAATAGATAGGAGATAGAGATGGAAATT	NA	NA	NA	NA
AYY81215.1|2092745_2093030_+	hypothetical protein	NA	NA	NA	NA	NA
AYY83002.1|2093093_2093273_+	hypothetical protein	NA	A0A1P8DTG4	Proteus_phage	48.4	5.1e-06
AYY81216.1|2093274_2093604_+	hypothetical protein	NA	A0A249XWT3	Proteus_phage	52.3	3.7e-18
AYY81217.1|2093686_2093869_+	hypothetical protein	NA	A0A1P8DTH8	Proteus_phage	78.3	2.0e-18
AYY81218.1|2094145_2094463_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81219.1|2094464_2095079_+	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	77.9	5.9e-86
AYY81220.1|2095078_2095555_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.0	1.3e-53
AYY81221.1|2095613_2095907_+	hypothetical protein	NA	A0A2I7R567	Vibrio_phage	54.4	2.5e-10
AYY81222.1|2095903_2096188_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81223.1|2096187_2096475_+	hypothetical protein	NA	A0A1B0UY37	Roseobacter_phage	43.2	7.4e-15
AYY81224.1|2096474_2096696_+	hypothetical protein	NA	A0A1U9ZAB3	Proteus_phage	61.6	2.7e-17
AYY81225.1|2096918_2097881_+	DNA (cytosine-5-)-methyltransferase	NA	A0A2I7R868	Vibrio_phage	45.4	4.4e-88
AYY81226.1|2097780_2097987_+	hypothetical protein	NA	A0A1P8DTI7	Proteus_phage	47.6	8.5e-05
AYY81227.1|2098150_2098342_+	hypothetical protein	NA	E9NIE1	Enterobacter_phage	67.8	6.2e-18
AYY81228.1|2098347_2098902_+	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	59.9	2.2e-55
AYY81229.1|2098877_2099078_+	hypothetical protein	NA	A0A1P8DTI1	Proteus_phage	81.8	4.6e-24
AYY81230.1|2099070_2099307_+	excisionase	NA	S4TND0	Salmonella_phage	63.6	1.5e-26
AYY81231.1|2099311_2100613_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	46.7	8.1e-109
>prophage 148
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2115468	2116455	4158443		Clostridium_phage(100.0%)	1	NA	NA
AYY81248.1|2115468_2116455_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A0A7RUS8	Clostridium_phage	38.3	1.0e-15
>prophage 149
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2129662	2135467	4158443		Bacillus_thuringiensis_phage(50.0%)	5	NA	NA
AYY81263.1|2129662_2130052_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	7.0e-08
AYY81264.1|2130111_2131164_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	35.2	2.7e-06
AYY81265.1|2131156_2132047_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AYY81266.1|2132053_2133700_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.7	4.1e-09
AYY81267.1|2133760_2135467_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.1	6.0e-11
>prophage 150
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2145179	2146797	4158443		Bacillus_virus(50.0%)	3	NA	NA
AYY81274.1|2145179_2145878_-	MgtC family protein	NA	G3MA03	Bacillus_virus	45.3	4.3e-16
AYY81275.1|2146279_2146474_-	protein DsrB	NA	NA	NA	NA	NA
AYY81276.1|2146584_2146797_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	78.6	9.9e-25
>prophage 151
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2153693	2156774	4158443		Escherichia_phage(100.0%)	1	NA	NA
AYY81283.1|2153693_2156774_-	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	25.6	1.7e-08
>prophage 152
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2161163	2167003	4158443		Morganella_phage(33.33%)	5	NA	NA
AYY81288.1|2161163_2162105_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	44.8	4.0e-65
AYY81289.1|2162378_2163587_+	multidrug transporter MdtG	NA	NA	NA	NA	NA
AYY81290.1|2164007_2165543_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	56.3	7.7e-159
AYY81291.1|2165706_2166486_+	PhzF family phenazine biosynthesis isomerase	NA	NA	NA	NA	NA
AYY81292.1|2166592_2167003_+	acyl-CoA thioesterase	NA	A0A292GK23	Xanthomonas_phage	37.7	1.0e-09
>prophage 153
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2186072	2193183	4158443	lysis,holin	Escherichia_phage(42.86%)	10	NA	NA
AYY81307.1|2186072_2186690_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	9.8e-89
AYY81308.1|2186693_2187470_+	diguanylate cyclase	NA	A0A077SK59	Escherichia_phage	39.8	7.3e-41
AYY81309.1|2187541_2188084_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.1e-19
AYY81310.1|2188781_2188961_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
AYY81311.1|2189403_2189709_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81312.1|2189870_2190320_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AYY81313.1|2190316_2190721_-	structural protein	NA	A0A0A0RQM4	Escherichia_phage	46.4	1.1e-24
AYY81314.1|2190713_2191022_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	54.5	5.3e-27
AYY81315.1|2191388_2192204_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	44.4	5.0e-56
AYY81316.1|2192445_2193183_+	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	45.9	6.2e-58
>prophage 154
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2197798	2212535	4158443		Pseudomonas_phage(33.33%)	10	NA	NA
AYY81319.1|2197798_2200633_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	24.8	2.8e-37
AYY81320.1|2200825_2203453_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	30.2	9.2e-104
AYY81321.1|2203625_2204363_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
AYY81322.1|2204712_2207004_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	69.1	3.2e-310
AYY81323.1|2207015_2208146_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	2.0e-172
AYY81324.1|2208171_2208450_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	63.6	9.0e-18
AYY81325.1|2208539_2208773_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
AYY81326.1|2208952_2210164_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
AYY83004.1|2210255_2210798_-	porin	NA	NA	NA	NA	NA
AYY81327.1|2211080_2212535_+	catalase	NA	A0A2K9L0T1	Tupanvirus	38.8	2.0e-100
>prophage 155
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2245423	2247253	4158443		Oenococcus_phage(100.0%)	1	NA	NA
AYY81352.1|2245423_2247253_-	SLC13 family permease	NA	Q6A201	Oenococcus_phage	31.6	9.5e-15
>prophage 156
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2261529	2263047	4158443		Mollivirus(100.0%)	1	NA	NA
AYY81368.1|2261529_2263047_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	2.0e-90
>prophage 157
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2280561	2281647	4158443		Pandoravirus(100.0%)	1	NA	NA
AYY81385.1|2280561_2281647_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	1.1e-90
>prophage 158
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2299420	2299723	4158443		Morganella_phage(100.0%)	1	NA	NA
AYY81399.1|2299420_2299723_-	XRE family transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	34.2	2.0e-07
>prophage 159
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2307940	2323125	4158443		Streptococcus_phage(33.33%)	14	NA	NA
AYY81405.1|2307940_2309968_-	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	49.0	1.7e-142
AYY81406.1|2310025_2311054_-	cell division protein ZipA	NA	NA	NA	NA	NA
AYY81407.1|2311277_2312048_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
AYY81408.1|2312162_2312693_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81409.1|2312929_2313883_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	50.2	4.9e-71
AYY81410.1|2314215_2314473_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AYY81411.1|2314611_2316339_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.4	4.3e-17
AYY81412.1|2316388_2316898_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AYY81413.1|2317114_2317999_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	42.8	2.0e-58
AYY81414.1|2318177_2319266_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	31.7	1.8e-24
AYY81415.1|2319296_2320139_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
AYY81416.1|2320138_2320972_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
AYY81417.1|2320971_2321991_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYY81418.1|2322228_2323125_-	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	33.3	5.5e-24
>prophage 160
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2329951	2331235	4158443	tRNA	Tupanvirus(100.0%)	1	NA	NA
AYY81424.1|2329951_2331235_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.1	2.4e-25
>prophage 161
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2335430	2335856	4158443		Powai_lake_megavirus(100.0%)	1	NA	NA
AYY81429.1|2335430_2335856_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	40.9	3.9e-20
>prophage 162
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2344412	2349768	4158443		Mycoplasma_phage(25.0%)	7	NA	NA
AYY81433.1|2344412_2345708_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.0	1.2e-35
AYY81434.1|2345988_2346183_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
AYY81435.1|2346198_2346534_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AYY81436.1|2346536_2348387_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.4	7.7e-105
AYY81437.1|2348398_2348920_-	co-chaperone HscB	NA	NA	NA	NA	NA
AYY81438.1|2348968_2349292_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	8.3e-23
AYY81439.1|2349381_2349768_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	1.6e-52
>prophage 163
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2354861	2369128	4158443		Bacillus_phage(40.0%)	9	NA	NA
AYY81445.1|2354861_2356115_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.6	3.0e-100
AYY81446.1|2356481_2357678_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AYY81447.1|2357787_2358435_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81448.1|2358704_2359043_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AYY81449.1|2359058_2360675_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.6	2.7e-98
AYY81450.1|2360748_2362086_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	6.7e-10
AYY83011.1|2362097_2363012_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AYY83012.1|2363098_2364538_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.5	1.7e-14
AYY81451.1|2365237_2369128_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.8	8.0e-128
>prophage 164
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2377358	2428385	4158443	portal,terminase,holin,capsid,tRNA,head,integrase,tail	Cronobacter_phage(55.56%)	62	2399160:2399207	2428545:2428592
AYY81458.1|2377358_2377889_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYZ2	Pandoravirus	36.4	8.9e-06
AYY81459.1|2377996_2378632_-	LysE family translocator	NA	NA	NA	NA	NA
AYY81460.1|2379198_2379459_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	47.7	6.0e-16
AYY81461.1|2379501_2379882_-	holo-ACP synthase	NA	NA	NA	NA	NA
AYY81462.1|2379881_2380613_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AYY81463.1|2380682_2381423_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AYY81464.1|2381432_2382341_-	GTPase Era	NA	NA	NA	NA	NA
AYY81465.1|2382337_2383018_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	45.3	3.7e-20
AYY81466.1|2383213_2384185_-	signal peptidase I	NA	NA	NA	NA	NA
AYY81467.1|2384199_2385996_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.2	2.7e-22
AYY81468.1|2386298_2386763_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
AYY81469.1|2386775_2387744_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AYY81470.1|2387793_2388456_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AYY81471.1|2388458_2389037_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
AYY81472.1|2389332_2390088_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AYY81473.1|2390353_2391718_+	ATP-dependent RNA helicase SrmB	NA	A0A1V0SIR5	Klosneuvirus	33.3	4.0e-50
AYY81474.1|2391859_2392243_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	67.0	1.5e-31
AYY81475.1|2392254_2392440_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81476.1|2392577_2393258_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	50.5	4.4e-58
AYY81477.1|2393376_2393988_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYY81478.1|2394088_2394988_+	NAD(+) kinase	NA	NA	NA	NA	NA
AYY81479.1|2395075_2396737_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AYY81480.1|2396850_2397213_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYY81481.1|2397419_2397713_-	RnfH family protein	NA	NA	NA	NA	NA
AYY81482.1|2397705_2398140_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AYY81483.1|2398295_2398778_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	49.4	7.3e-31
2399160:2399207	attL	ATGTAGAAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAAT	NA	NA	NA	NA
AYY81484.1|2399367_2399730_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81485.1|2399776_2400544_-	reverse transcriptase	NA	NA	NA	NA	NA
AYY81486.1|2400512_2400701_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81487.1|2401421_2403068_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	54.5	4.2e-147
AYY81488.1|2403071_2403656_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	51.1	3.2e-41
AYY81489.1|2403627_2404350_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	32.3	4.3e-35
AYY81490.1|2404346_2404988_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	30.5	1.3e-06
AYY81491.1|2404966_2407348_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	58.8	8.6e-109
AYY81492.1|2407357_2407906_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	63.5	3.0e-65
AYY81493.1|2407898_2409083_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	64.8	1.9e-149
AYY81494.1|2409072_2409408_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.0	2.9e-31
AYY81495.1|2409419_2411936_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	44.3	5.5e-130
AYY81496.1|2412123_2412393_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	49.4	9.6e-17
AYY81497.1|2412501_2412876_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	52.3	2.1e-22
AYY81498.1|2412875_2413208_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	71.3	3.9e-36
AYY81499.1|2413204_2413498_-|holin	holin	holin	C7BGD7	Burkholderia_phage	52.9	1.1e-16
AYY81500.1|2413516_2413969_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	62.6	1.2e-48
AYY81501.1|2413968_2415015_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	66.2	1.2e-102
AYY81502.1|2415011_2415464_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	53.3	3.2e-36
AYY81503.1|2415563_2416268_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.5	8.6e-65
AYY81504.1|2416267_2417299_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	72.9	3.8e-138
AYY81505.1|2417325_2418120_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	36.6	1.0e-29
AYY81506.1|2418285_2420079_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	64.9	5.3e-220
AYY81507.1|2420079_2421105_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	63.7	1.6e-128
AYY81508.1|2421101_2421410_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	60.4	2.1e-28
AYY81509.1|2421411_2421594_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81510.1|2421707_2421920_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81511.1|2421912_2424105_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	57.0	1.2e-208
AYY81512.1|2424106_2424358_-	DUF2732 family protein	NA	NA	NA	NA	NA
AYY81513.1|2424434_2424782_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	40.9	1.6e-16
AYY81514.1|2424793_2425126_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81515.1|2425284_2425794_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	50.3	4.5e-39
AYY81516.1|2425855_2426056_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81517.1|2426168_2426753_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	40.2	1.5e-30
AYY81518.1|2426782_2427367_+	phage repressor protein	NA	F1BUS8	Erwinia_phage	40.9	2.0e-30
AYY81519.1|2427368_2428385_+|integrase	site-specific integrase	integrase	F1BUN9	Cronobacter_phage	82.5	1.0e-167
2428545:2428592	attR	ATGTAGAAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAAT	NA	NA	NA	NA
>prophage 165
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2436228	2436681	4158443		Proteus_phage(100.0%)	1	NA	NA
AYY81526.1|2436228_2436681_-	DUF1983 domain-containing protein	NA	A0A1P8DTI4	Proteus_phage	70.2	3.6e-40
>prophage 166
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2442236	2442554	4158443		Morganella_phage(100.0%)	1	NA	NA
AYY83013.1|2442236_2442554_-	XRE family transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	43.7	1.4e-06
>prophage 167
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2451282	2453870	4158443		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
AYY81538.1|2451282_2451870_-	histidine phosphatase family protein	NA	M1HFB0	Paramecium_bursaria_Chlorella_virus	42.7	1.7e-34
AYY81539.1|2452319_2453870_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	4.4e-13
>prophage 168
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2468558	2472489	4158443		Acinetobacter_phage(50.0%)	2	NA	NA
AYY81551.1|2468558_2470598_-	IreA family TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	29.2	1.3e-12
AYY81552.1|2470854_2472489_-	sodium/glucose cotransporter	NA	A0A240F3J2	Aeromonas_phage	39.8	1.5e-88
>prophage 169
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2477472	2478489	4158443		Tupanvirus(100.0%)	1	NA	NA
AYY81557.1|2477472_2478489_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.0	3.7e-85
>prophage 170
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2483509	2483767	4158443		Salmonella_phage(100.0%)	1	NA	NA
AYY81564.1|2483509_2483767_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	39.5	7.6e-11
>prophage 171
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2492204	2492753	4158443		Lactobacillus_phage(100.0%)	1	NA	NA
AYY81572.1|2492204_2492753_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	33.6	8.3e-15
>prophage 172
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2497594	2503810	4158443	tRNA	Tupanvirus(25.0%)	5	NA	NA
AYY81575.1|2497594_2499109_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.4	1.8e-88
AYY81576.1|2499117_2500216_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.3	4.1e-05
AYY81577.1|2500387_2502121_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.8	7.8e-67
AYY81578.1|2502130_2502838_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AYY81579.1|2502871_2503810_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.4	3.5e-29
>prophage 173
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2507571	2510448	4158443		Prochlorococcus_phage(100.0%)	1	NA	NA
AYY81583.1|2507571_2510448_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.1	3.3e-264
>prophage 174
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2518764	2525649	4158443		Bacillus_phage(66.67%)	4	NA	NA
AYY81592.1|2518764_2520825_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.0	4.5e-45
AYY81593.1|2520827_2522189_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYY81594.1|2522207_2524328_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.1	3.2e-38
AYY81595.1|2524398_2525649_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.4	4.4e-104
>prophage 175
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2534713	2536141	4158443		Erysipelothrix_phage(100.0%)	1	NA	NA
AYY81604.1|2534713_2536141_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.3	6.5e-43
>prophage 176
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2582282	2587964	4158443		Catovirus(50.0%)	3	NA	NA
AYY81641.1|2582282_2584088_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.1	8.2e-43
AYY81642.1|2584591_2585536_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
AYY81643.1|2586404_2587964_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	25.0	4.3e-08
>prophage 177
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2599175	2600330	4158443		Staphylococcus_phage(100.0%)	1	NA	NA
AYY81652.1|2599175_2600330_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.5	7.6e-127
>prophage 178
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2631088	2631838	4158443		Proteus_phage(100.0%)	1	NA	NA
AYY81677.1|2631088_2631838_+	hemagglutinin	NA	A0A249XWN1	Proteus_phage	33.3	1.6e-08
>prophage 179
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2645621	2646377	4158443		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AYY81685.1|2645621_2646377_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.4e-15
>prophage 180
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2663469	2664201	4158443		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AYY83020.1|2663469_2664201_+	ankyrin repeat domain-containing protein	NA	A0A0G2Y7V3	Acanthamoeba_polyphaga_mimivirus	34.6	1.7e-07
>prophage 181
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2671113	2735063	4158443	transposase,protease,tRNA,plate	Cronobacter_phage(16.67%)	51	NA	NA
AYY81706.1|2671113_2671551_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AYY81707.1|2671552_2673337_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYY81708.1|2673300_2674350_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYY81709.1|2674355_2675597_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AYY81710.1|2675598_2676153_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AYY81711.1|2676155_2677514_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AYY81712.1|2677506_2678262_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AYY81713.1|2678271_2680908_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.6	1.8e-83
AYY81714.1|2680904_2681702_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AYY81715.1|2681698_2682349_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AYY81716.1|2682354_2683818_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AYY81717.1|2683820_2687369_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AYY81718.1|2687408_2688740_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81719.1|2688788_2690525_+	type VI secretion protein	NA	NA	NA	NA	NA
AYY81720.1|2691057_2691384_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYY81721.1|2692118_2693012_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81722.1|2693296_2694439_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYY81723.1|2694612_2694807_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81724.1|2695118_2695991_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.8	4.8e-33
AYY81725.1|2695994_2696207_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AYY81726.1|2696859_2697801_+	1-phosphofructokinase	NA	NA	NA	NA	NA
AYY81727.1|2698037_2698481_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81728.1|2698578_2699970_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.2	8.0e-38
AYY81729.1|2700345_2700840_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
AYY81730.1|2700852_2701575_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AYY81731.1|2701709_2702231_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AYY81732.1|2702227_2703295_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AYY81733.1|2703418_2704678_+	MFS transporter	NA	NA	NA	NA	NA
AYY81734.1|2704747_2705773_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AYY81735.1|2705949_2708112_+	ornithine decarboxylase	NA	NA	NA	NA	NA
AYY81736.1|2708200_2710642_-	ABC transporter permease	NA	NA	NA	NA	NA
AYY81737.1|2710638_2711325_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	5.5e-32
AYY81738.1|2711295_2711925_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
AYY81739.1|2711975_2712761_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYY81740.1|2712845_2713703_+	co-chaperone YbbN	NA	NA	NA	NA	NA
AYY81741.1|2713742_2714669_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AYY83022.1|2714668_2715160_+	NfeD family protein	NA	NA	NA	NA	NA
AYY81742.1|2715119_2715524_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AYY81743.1|2715658_2718601_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.0	1.8e-111
AYY81744.1|2718982_2720329_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81745.1|2720438_2721248_+	polysaccharide biosynthesis protein GumN	NA	NA	NA	NA	NA
AYY81746.1|2721282_2721762_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
AYY81747.1|2721882_2723547_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
AYY81748.1|2723808_2725044_+	MFS transporter	NA	NA	NA	NA	NA
AYY81749.1|2725282_2727043_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
AYY83023.1|2727162_2728473_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
AYY81750.1|2728576_2729695_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AYY81751.1|2729858_2730839_-	ferrochelatase	NA	NA	NA	NA	NA
AYY81752.1|2731236_2732244_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYY81753.1|2732353_2732998_-	adenylate kinase	NA	NA	NA	NA	NA
AYY81754.1|2733179_2735063_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.9	1.1e-109
>prophage 182
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2771394	2785958	4158443	tRNA	uncultured_Mediterranean_phage(28.57%)	13	NA	NA
AYY81785.1|2771394_2773959_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.4	2.8e-28
AYY81786.1|2774073_2775228_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81787.1|2775224_2776484_-	hypothetical protein	NA	NA	NA	NA	NA
AYY81788.1|2776654_2777638_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.5	3.2e-33
AYY81789.1|2778322_2779435_-	murein hydrolase activator NlpD	NA	A0A292GJG6	Xanthomonas_phage	45.8	1.2e-12
AYY81790.1|2779588_2780215_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.9	3.8e-32
AYY81791.1|2780208_2780973_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.4	7.1e-65
AYY81792.1|2780950_2782003_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
AYY81793.1|2781999_2782485_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AYY81794.1|2782486_2783236_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYY81795.1|2783275_2783596_-	cell division protein FtsB	NA	NA	NA	NA	NA
AYY81796.1|2783898_2784504_-	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	39.7	1.2e-27
AYY81797.1|2784506_2785958_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.7	2.8e-33
>prophage 183
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2793534	2794206	4158443		Halovirus(100.0%)	1	NA	NA
AYY81804.1|2793534_2794206_-	7-carboxy-7-deazaguanine synthase QueE	NA	R4THA3	Halovirus	28.9	4.6e-15
>prophage 184
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2806457	2807489	4158443		Planktothrix_phage(100.0%)	1	NA	NA
AYY81811.1|2806457_2807489_+	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	3.2e-36
>prophage 185
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2815069	2821122	4158443		Mollivirus(33.33%)	4	NA	NA
AYY81820.1|2815069_2815813_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.7	3.9e-15
AYY81821.1|2816055_2817015_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AYY81822.1|2817027_2820510_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.2	1.6e-204
AYY81823.1|2820531_2821122_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	43.6	5.6e-25
>prophage 186
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2829101	2830725	4158443		Tupanvirus(50.0%)	2	NA	NA
AYY81831.1|2829101_2829965_-	phosphatidate cytidylyltransferase	NA	A0A2K9L268	Tupanvirus	34.0	1.7e-06
AYY81832.1|2829966_2830725_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	42.2	3.8e-26
>prophage 187
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2847450	2850544	4158443		Vibrio_phage(50.0%)	3	NA	NA
AYY81846.1|2847450_2848296_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	1.6e-41
AYY81847.1|2848387_2849755_+	LOG family protein	NA	NA	NA	NA	NA
AYY83028.1|2849761_2850544_+	flap endonuclease Xni	NA	B6V2K6	Bacillus_phage	28.3	2.0e-14
>prophage 188
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2853762	2869818	4158443	tRNA	environmental_halophage(16.67%)	9	NA	NA
AYY81851.1|2853762_2854974_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	34.2	4.6e-66
AYY83029.1|2854979_2855429_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AYY83030.1|2855594_2856407_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	30.8	1.2e-14
AYY81852.1|2856516_2857611_-	murein transglycosylase A	NA	NA	NA	NA	NA
AYY81853.1|2858486_2859749_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.0	5.6e-14
AYY81854.1|2859989_2861324_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AYY81855.1|2861399_2863310_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	25.0	4.0e-24
AYY81856.1|2863306_2866933_-	exodeoxyribonuclease V subunit beta	NA	A0A068EQC7	Bacillus_phage	24.1	1.4e-12
AYY81857.1|2866929_2869818_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	24.4	5.8e-67
>prophage 189
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2875377	2879492	4158443		Vibrio_phage(50.0%)	3	NA	NA
AYY81862.1|2875377_2876229_-	thymidylate synthase	NA	H9EB68	Vibrio_phage	73.1	4.7e-126
AYY81863.1|2876275_2877166_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AYY81864.1|2877245_2879492_-	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	27.7	9.6e-09
>prophage 190
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2882886	2889118	4158443		Planktothrix_phage(33.33%)	3	NA	NA
AYY81868.1|2882886_2883588_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	38.1	5.1e-25
AYY81869.1|2883675_2886030_+	DNA polymerase II	NA	A0A0N7KVW0	Yellowstone_lake_phycodnavirus	24.8	1.7e-27
AYY81870.1|2886214_2889118_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	32.5	6.8e-23
>prophage 191
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2898516	2899002	4158443		Bacillus_phage(100.0%)	1	NA	NA
AYY81878.1|2898516_2899002_-	type 3 dihydrofolate reductase	NA	A0A1I9S5V6	Bacillus_phage	43.8	6.6e-32
>prophage 192
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2907252	2920151	4158443		Bacillus_virus(33.33%)	10	NA	NA
AYY81884.1|2907252_2910210_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.3	2.3e-82
AYY81885.1|2910242_2912138_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.8	3.9e-96
AYY81886.1|2912261_2912837_-	esterase YqiA	NA	NA	NA	NA	NA
AYY81887.1|2912840_2913680_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
AYY81888.1|2913906_2914542_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	35.6	3.9e-24
AYY81889.1|2914756_2916154_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
AYY81890.1|2916484_2917213_+	DUF1190 family protein	NA	A0A060ACJ9	Cronobacter_phage	35.7	4.5e-24
AYY81891.1|2917221_2918385_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	45.3	7.5e-90
AYY81892.1|2918536_2919322_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
AYY81893.1|2919497_2920151_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.8	9.2e-45
>prophage 193
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2925110	2926535	4158443		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AYY81898.1|2925110_2926535_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.2	1.0e-40
>prophage 194
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2931288	2955556	4158443	tRNA	Caulobacter_phage(30.77%)	22	NA	NA
AYY81902.1|2931288_2932527_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.4	1.4e-94
AYY81903.1|2932527_2932878_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AYY81904.1|2932982_2933639_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
AYY81905.1|2933709_2934732_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	7.7e-107
AYY81906.1|2935074_2935290_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AYY83033.1|2935402_2937151_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.3	2.5e-73
AYY81907.1|2937344_2939198_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.2	2.7e-33
AYY81908.1|2940204_2940564_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81909.1|2940652_2941369_+	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	38.7	3.9e-12
AYY81910.1|2941747_2943277_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.4	1.7e-12
AYY81911.1|2943884_2945414_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.7	3.5e-10
AYY81912.1|2945837_2946518_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AYY81913.1|2946583_2947159_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.3	3.1e-28
AYY81914.1|2947238_2947817_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.5	2.1e-32
AYY81915.1|2947870_2948911_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	49.0	2.2e-77
AYY81916.1|2948945_2949401_-	Tellurium resistance protein TerB	NA	NA	NA	NA	NA
AYY81917.1|2949426_2950587_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AYY81918.1|2950586_2951171_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.7	4.0e-15
AYY81919.1|2951495_2952563_+	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AYY81920.1|2952565_2953714_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	29.0	2.2e-33
AYY81921.1|2953706_2954477_+	hypothetical protein	NA	NA	NA	NA	NA
AYY81922.1|2954479_2955556_+	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	34.3	3.1e-37
>prophage 195
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2964676	2970399	4158443		Powai_lake_megavirus(33.33%)	6	NA	NA
AYY81932.1|2964676_2965645_+	acetyl esterase	NA	A0A167RJ59	Powai_lake_megavirus	27.6	2.0e-16
AYY81933.1|2965659_2966373_-	NUDIX domain-containing protein	NA	G3MA14	Bacillus_virus	28.1	1.4e-17
AYY81934.1|2966527_2967547_+	NrtR-regulated NrtX	NA	NA	NA	NA	NA
AYY81935.1|2967546_2968491_+	sugar kinase	NA	NA	NA	NA	NA
AYY81936.1|2968493_2969117_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYY81937.1|2969208_2970399_+	Tet(H)/Tet(J) family tetracycline efflux MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	24.9	2.3e-09
>prophage 196
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2977501	2977762	4158443		Cronobacter_phage(100.0%)	1	NA	NA
AYY81943.1|2977501_2977762_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	63.1	1.7e-26
>prophage 197
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2985240	2987616	4158443		Hokovirus(100.0%)	1	NA	NA
AYY81950.1|2985240_2987616_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	28.6	2.0e-12
>prophage 198
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	2996783	2997050	4158443		Acinetobacter_phage(100.0%)	1	NA	NA
AYY81956.1|2996783_2997050_+	DksA/TraR family C4-type zinc finger protein	NA	E5EYQ9	Acinetobacter_phage	43.8	5.4e-12
>prophage 199
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3003829	3005152	4158443		Geobacillus_virus(100.0%)	1	NA	NA
AYY81962.1|3003829_3005152_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.3	5.7e-78
>prophage 200
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3010978	3012568	4158443		Streptococcus_phage(100.0%)	1	NA	NA
AYY81968.1|3010978_3012568_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.7	5.7e-32
>prophage 201
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3023497	3024742	4158443		Enterococcus_phage(100.0%)	1	NA	NA
AYY81977.1|3023497_3024742_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.3	1.3e-87
>prophage 202
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3035054	3035858	4158443		Brazilian_cedratvirus(100.0%)	1	NA	NA
AYY81984.1|3035054_3035858_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	1.4e-10
>prophage 203
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3057556	3059576	4158443		Vibrio_phage(50.0%)	2	NA	NA
AYY82003.1|3057556_3059203_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	67.5	5.5e-187
AYY83040.1|3059255_3059576_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	34.7	1.0e-09
>prophage 204
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3077313	3078951	4158443		Tupanvirus(100.0%)	1	NA	NA
AYY82018.1|3077313_3078951_-	acyl-CoA synthase	NA	A0A2K9L3I8	Tupanvirus	25.4	2.4e-09
>prophage 205
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3084785	3094468	4158443		Vibrio_phage(25.0%)	9	NA	NA
AYY82024.1|3084785_3086300_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	23.6	7.6e-10
AYY82025.1|3086341_3087484_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AYY82026.1|3087551_3088772_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
AYY82027.1|3088846_3090403_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.9e-35
AYY82028.1|3090479_3091265_+	crotonobetainyl-CoA hydratase	NA	NA	NA	NA	NA
AYY82029.1|3091304_3091898_+	carnitine operon protein CaiE	NA	NA	NA	NA	NA
AYY82030.1|3091962_3092355_-	carnitine metabolism transcriptional regulator CaiF	NA	NA	NA	NA	NA
AYY82031.1|3092902_3093565_-	fructose-6-phosphate aldolase	NA	A0A0E3F5V4	Synechococcus_phage	32.2	2.5e-29
AYY82032.1|3093856_3094468_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	33.6	2.7e-22
>prophage 206
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3098245	3098949	4158443	holin	Proteus_phage(50.0%)	2	NA	NA
AYY82035.1|3098245_3098635_-	M15 family peptidase	NA	A0A0G2SSJ3	Proteus_phage	64.2	2.6e-39
AYY82036.1|3098631_3098949_-|holin	holin	holin	R9W0A1	Serratia_phage	48.3	1.9e-19
>prophage 207
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3116910	3118329	4158443		Pseudomonas_phage(100.0%)	1	NA	NA
AYY82045.1|3116910_3118329_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	32.3	3.9e-48
>prophage 208
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3127340	3128135	4158443		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AYY82054.1|3127340_3128135_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	32.0	1.7e-16
>prophage 209
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3157496	3235815	4158443	portal,terminase,protease,holin,lysis,capsid,tRNA,head,integrase,tail	Morganella_phage(34.0%)	90	3191926:3191949	3230629:3230652
AYY82085.1|3157496_3160574_+	MexW/MexI family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.4	1.7e-56
AYY82086.1|3160805_3161132_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
AYY82087.1|3161199_3161616_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
AYY82088.1|3161651_3162356_-	hypothetical protein	NA	NA	NA	NA	NA
AYY82089.1|3162373_3163018_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
AYY82090.1|3163017_3163521_-	BMC domain-containing protein	NA	NA	NA	NA	NA
AYY82091.1|3163534_3164485_-|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
AYY82092.1|3164585_3168014_-|holin	choline trimethylamine-lyase	holin	NA	NA	NA	NA
AYY82093.1|3168070_3169219_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
AYY82094.1|3169226_3169490_-	ethanolamine utilization protein EutN	NA	NA	NA	NA	NA
AYY82095.1|3169516_3171184_-	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
AYY82096.1|3171257_3171536_-	BMC domain-containing protein	NA	NA	NA	NA	NA
AYY82097.1|3171550_3171835_-	BMC domain-containing protein	NA	NA	NA	NA	NA
AYY82098.1|3171855_3172134_-	BMC domain-containing protein	NA	NA	NA	NA	NA
AYY82099.1|3172873_3173392_-	hypothetical protein	NA	NA	NA	NA	NA
AYY82100.1|3173391_3174246_-	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
AYY82101.1|3174272_3174860_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYY82102.1|3175231_3175816_-	hypothetical protein	NA	NA	NA	NA	NA
AYY83042.1|3175944_3177219_-	bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	28.6	3.1e-20
AYY82103.1|3177448_3178363_-	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
AYY82104.1|3179240_3179801_+	fimbrial protein	NA	NA	NA	NA	NA
AYY82105.1|3179898_3180579_+	type 1 fimbrial chaperone protein	NA	NA	NA	NA	NA
AYY82106.1|3180615_3183135_+	fimbrial protein FimD	NA	NA	NA	NA	NA
AYY82107.1|3183134_3183653_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYY82108.1|3183652_3184726_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYY82109.1|3184751_3185063_+	XRE family transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	41.0	9.5e-08
AYY82110.1|3185191_3186235_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
AYY82111.1|3186349_3187129_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
AYY82112.1|3187125_3187986_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.3	5.7e-10
AYY82113.1|3187969_3189085_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.4	4.4e-31
AYY82114.1|3189630_3190926_-|protease	serine protease	protease	Q2A0D0	Sodalis_phage	32.8	2.0e-30
AYY82115.1|3191086_3191677_-	CbrC family protein	NA	NA	NA	NA	NA
3191926:3191949	attL	TTTTCTGTTGCGCCGATGTTGGAT	NA	NA	NA	NA
AYY82116.1|3192128_3192695_+	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
AYY82117.1|3192691_3193099_+	hypothetical protein	NA	NA	NA	NA	NA
AYY82118.1|3193230_3194691_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	61.2	2.0e-140
AYY82119.1|3194708_3198047_-	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	48.8	5.3e-189
AYY82120.1|3198047_3198446_-	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	49.2	7.6e-34
AYY82121.1|3198499_3198775_-	hypothetical protein	NA	NA	NA	NA	NA
AYY82122.1|3198788_3199370_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	1.1e-49
AYY82123.1|3199366_3199966_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	56.5	4.7e-56
AYY83043.1|3199966_3203077_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	38.8	7.2e-148
AYY82124.1|3203282_3203492_-|tail	tail assembly chaperone	tail	NA	NA	NA	NA
AYY82125.1|3203536_3203887_-|tail	phage tail protein	tail	Q7Y401	Yersinia_phage	41.4	1.4e-15
AYY82126.1|3203886_3204360_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	70.1	8.1e-59
AYY82127.1|3204371_3204776_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	58.8	8.5e-33
AYY82128.1|3204772_3205162_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	49.2	1.4e-29
AYY82129.1|3205148_3205475_-|head,tail	head-tail adaptor protein	head,tail	Q7Y406	Yersinia_phage	45.0	6.9e-17
AYY83044.1|3205481_3205784_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	68.0	3.7e-33
AYY83045.1|3205872_3207096_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	82.1	1.7e-185
AYY82130.1|3207111_3207717_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JP53	Morganella_phage	79.0	6.9e-87
AYY82131.1|3207706_3208936_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	88.0	7.4e-213
AYY82132.1|3209083_3210814_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	81.4	2.9e-287
AYY82133.1|3210810_3211305_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	75.0	3.4e-68
AYY82134.1|3211487_3211835_-	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	94.7	6.3e-61
AYY82135.1|3211921_3212341_-	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	71.9	9.7e-48
AYY82136.1|3212330_3212642_-	hypothetical protein	NA	NA	NA	NA	NA
AYY82137.1|3213152_3213614_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	53.0	1.4e-26
AYY82138.1|3213756_3214227_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	59.2	4.4e-49
AYY82139.1|3214226_3214496_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.7	5.7e-17
AYY82140.1|3214836_3215085_-	hypothetical protein	NA	NA	NA	NA	NA
AYY82141.1|3215186_3215858_-	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	49.1	3.9e-51
AYY82142.1|3215885_3216911_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	46.5	2.0e-86
AYY82143.1|3216907_3217711_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	61.9	4.8e-88
AYY82144.1|3217729_3218113_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	53.7	1.7e-27
AYY82145.1|3218342_3218738_-	hypothetical protein	NA	NA	NA	NA	NA
AYY82146.1|3218734_3219373_-	phage N-6-adenine-methyltransferase	NA	K7PGU4	Enterobacteria_phage	65.2	2.4e-82
AYY82147.1|3219369_3220491_-	replication protein 15	NA	K7PLZ7	Enterobacterial_phage	57.2	6.8e-48
AYY82148.1|3220500_3220680_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	58.6	6.2e-12
AYY82149.1|3220669_3220879_-	hypothetical protein	NA	NA	NA	NA	NA
AYY82150.1|3220967_3221426_-	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	44.7	1.8e-26
AYY82151.1|3221477_3221741_-	cytoplasmic chaperone TorD	NA	A0A0M4QX15	Salmonella_phage	42.9	1.0e-07
AYY82152.1|3221865_3222549_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	44.3	2.3e-46
AYY82153.1|3222531_3223419_-	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
AYY82154.1|3223561_3223765_+	hypothetical protein	NA	NA	NA	NA	NA
AYY82155.1|3223990_3224485_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	31.0	1.1e-13
AYY82156.1|3224891_3225788_+	hypothetical protein	NA	A0A1W6JP69	Morganella_phage	60.1	8.9e-99
AYY82157.1|3225869_3226403_+	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	60.2	1.4e-54
AYY82158.1|3226395_3226893_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	58.9	1.0e-48
AYY82159.1|3226901_3227357_+	hypothetical protein	NA	A0A248SL53	Klebsiella_phage	39.2	4.3e-25
AYY82160.1|3227358_3227994_+	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	42.7	1.9e-39
AYY82161.1|3227996_3228218_+	hypothetical protein	NA	NA	NA	NA	NA
AYY83046.1|3228237_3228678_+	SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	76.9	1.1e-62
AYY82162.1|3228738_3228984_+	pyocin activator protein PrtN	NA	A0A1W6JP35	Morganella_phage	70.7	6.7e-25
AYY82163.1|3229027_3229327_-	DinI family protein	NA	A0A1W6JP10	Morganella_phage	31.8	1.2e-07
AYY82164.1|3229368_3230451_-|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	79.4	3.1e-170
AYY82165.1|3230547_3231582_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
3230629:3230652	attR	TTTTCTGTTGCGCCGATGTTGGAT	NA	NA	NA	NA
AYY82166.1|3231626_3231947_-	hypothetical protein	NA	NA	NA	NA	NA
AYY82167.1|3232136_3233120_-	NADPH:quinone reductase	NA	NA	NA	NA	NA
AYY82168.1|3233273_3234683_+	replicative DNA helicase DnaB	NA	A0A1B0VG30	Salmonella_phage	75.4	1.7e-192
AYY82169.1|3234723_3235815_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.3	2.2e-27
>prophage 210
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3240577	3245719	4158443		uncultured_Mediterranean_phage(33.33%)	4	NA	NA
AYY82173.1|3240577_3243412_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.7	0.0e+00
AYY83047.1|3243664_3244192_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	86.2	1.0e-54
AYY82174.1|3244467_3244998_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
AYY82175.1|3245107_3245719_-	repressor LexA	NA	U5P451	Shigella_phage	45.6	2.5e-12
>prophage 211
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3255092	3258770	4158443		Dickeya_phage(100.0%)	1	NA	NA
AYY82183.1|3255092_3258770_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	83.3	1.5e-22
>prophage 212
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3277906	3283326	4158443		Prochlorococcus_phage(33.33%)	6	NA	NA
AYY82192.1|3277906_3279496_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.1	7.1e-67
AYY82193.1|3279508_3280798_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AYY82194.1|3280822_3281515_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
AYY82195.1|3281529_3281802_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	56.7	8.0e-19
AYY82196.1|3281992_3282583_-	DUF416 family protein	NA	NA	NA	NA	NA
AYY82197.1|3282657_3283326_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	31.5	1.2e-20
>prophage 213
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3292451	3313195	4158443	transposase	Sodalis_phage(14.29%)	17	NA	NA
AYY82206.1|3292451_3293492_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	38.9	3.8e-45
AYY82207.1|3293682_3295038_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AYY82208.1|3295118_3299345_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	2.2e-67
AYY82209.1|3299467_3303496_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.2	1.4e-21
AYY82210.1|3303846_3304212_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
AYY82211.1|3304275_3304773_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
AYY82212.1|3305099_3305801_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
AYY82213.1|3305805_3306234_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
AYY82214.1|3306380_3306926_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	4.5e-13
AYY82215.1|3306933_3307311_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
AYY82216.1|3307584_3308769_-	elongation factor Tu	NA	A0A1V0SC62	Catovirus	27.7	1.1e-06
AYY82217.1|3308837_3310952_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.1	1.6e-58
AYY82218.1|3311034_3311505_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
AYY82219.1|3311604_3311979_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
AYY82220.1|3312106_3312400_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
AYY82221.1|3312431_3312800_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
AYY82222.1|3312799_3313195_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.4	1.4e-16
>prophage 214
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3320381	3328233	4158443		Tupanvirus(33.33%)	4	NA	NA
AYY82231.1|3320381_3322313_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	32.5	1.6e-73
AYY82232.1|3322644_3324327_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.4	1.0e-07
AYY82233.1|3324857_3326600_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
AYY82234.1|3326688_3328233_-	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	51.1	3.1e-35
>prophage 215
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3334341	3342580	4158443		Klosneuvirus(20.0%)	7	NA	NA
AYY82242.1|3334341_3335559_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.9	6.5e-28
AYY82243.1|3335676_3336252_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	8.9e-68
AYY82244.1|3336626_3337196_-	peptidylprolyl isomerase A	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	33.1	8.9e-12
AYY82245.1|3337466_3338099_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AYY82246.1|3338581_3339100_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.8	2.9e-17
AYY82247.1|3339269_3339728_+	hypothetical protein	NA	NA	NA	NA	NA
AYY83051.1|3339781_3342580_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.4	2.6e-72
>prophage 216
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3361222	3363200	4158443		Bacillus_virus(50.0%)	2	NA	NA
AYY82263.1|3361222_3362224_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	2.5e-17
AYY82264.1|3362216_3363200_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	2.5e-17
>prophage 217
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3378847	3381957	4158443		Abalone_herpesvirus(50.0%)	3	NA	NA
AYY82277.1|3378847_3379471_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	39.9	3.6e-22
AYY82278.1|3379525_3379801_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AYY82279.1|3379830_3381957_+	guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	36.5	2.0e-11
>prophage 218
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3386380	3387772	4158443		environmental_Halophage(100.0%)	1	NA	NA
AYY82283.1|3386380_3387772_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	82.6	1.8e-53
>prophage 219
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3394471	3399310	4158443		Tupanvirus(50.0%)	3	NA	NA
AYY82291.1|3394471_3396307_-	translational GTPase TypA	NA	A0A2K9L2P9	Tupanvirus	40.7	1.6e-22
AYY82292.1|3396666_3398076_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
AYY82293.1|3398263_3399310_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.9	9.9e-09
>prophage 220
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3408318	3416180	4158443		Bacillus_phage(60.0%)	8	NA	NA
AYY82301.1|3408318_3409041_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.1	8.3e-31
AYY82302.1|3409037_3410378_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	22.5	3.4e-09
AYY82303.1|3410586_3411627_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	35.4	5.7e-49
AYY82304.1|3411704_3412664_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
AYY82305.1|3412665_3413568_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
AYY82306.1|3413598_3414375_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.1	1.2e-14
AYY82307.1|3414389_3415124_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
AYY82308.1|3415340_3416180_+	amino acid ABC transporter substrate-binding protein	NA	A0A140XBD5	Dickeya_phage	68.6	3.7e-06
>prophage 221
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3419854	3421213	4158443		Moraxella_phage(100.0%)	1	NA	NA
AYY82315.1|3419854_3421213_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	38.5	7.0e-63
>prophage 222
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3448975	3450568	4158443		Bodo_saltans_virus(50.0%)	2	NA	NA
AYY82343.1|3448975_3449728_-	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	25.3	1.8e-07
AYY82344.1|3449752_3450568_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	4.0e-13
>prophage 223
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3467527	3473007	4158443		Planktothrix_phage(33.33%)	6	NA	NA
AYY82355.1|3467527_3468220_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	8.0e-15
AYY82356.1|3468200_3469436_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
AYY82357.1|3469425_3470982_+	hypothetical protein	NA	A0A075BUR2	Microcystis_phage	28.9	2.7e-10
AYY82358.1|3471006_3471690_+	hypothetical protein	NA	NA	NA	NA	NA
AYY82359.1|3471707_3472196_+	hypothetical protein	NA	NA	NA	NA	NA
AYY82360.1|3472455_3473007_+	hypothetical protein	NA	A0A291AWV3	Escherichia_phage	29.7	7.8e-13
>prophage 224
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3480479	3483193	4158443		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
AYY82369.1|3480479_3481442_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	37.3	1.6e-50
AYY82370.1|3481428_3482436_+	enterobactin ABC transporter permease	NA	NA	NA	NA	NA
AYY82371.1|3482437_3483193_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.7e-16
>prophage 225
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3486684	3491288	4158443		Escherichia_phage(100.0%)	4	NA	NA
AYY82374.1|3486684_3489105_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	36.2	1.4e-135
AYY82375.1|3489101_3489743_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	56.0	3.3e-63
AYY82376.1|3489739_3490639_+	reductase	NA	NA	NA	NA	NA
AYY82377.1|3490718_3491288_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	31.9	1.6e-21
>prophage 226
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3501111	3507324	4158443		Oenococcus_phage(50.0%)	5	NA	NA
AYY82385.1|3501111_3501825_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.2	3.0e-17
AYY82386.1|3501911_3503234_-	NgoFVII family restriction endonuclease	NA	V5US45	Oenococcus_phage	33.7	2.0e-59
AYY82387.1|3503283_3504066_-	hypothetical protein	NA	NA	NA	NA	NA
AYY83056.1|3504267_3505221_+	DNA cytosine methyltransferase	NA	V5URQ5	Oenococcus_phage	58.7	7.2e-99
AYY83057.1|3505344_3507324_-	acyltransferase	NA	C6ZR20	Salmonella_phage	28.0	4.0e-51
>prophage 227
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3510983	3512474	4158443		Aeromonas_phage(100.0%)	1	NA	NA
AYY82392.1|3510983_3512474_-	acetylneuraminate ABC transporter	NA	A0A240F3J2	Aeromonas_phage	25.9	2.9e-22
>prophage 228
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3520986	3529258	4158443		Bodo_saltans_virus(50.0%)	8	NA	NA
AYY82398.1|3520986_3522357_-	adenylosuccinate lyase family protein	NA	A0A2H4UUU6	Bodo_saltans_virus	25.1	1.6e-06
AYY82399.1|3522368_3523925_-	PTS trehalose transporter subunit IIC	NA	A0A2I7SAJ6	Vibrio_phage	33.3	2.8e-07
AYY82400.1|3524254_3524995_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AYY82401.1|3525193_3525439_-	DUF2543 family protein	NA	NA	NA	NA	NA
AYY82402.1|3525561_3526269_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.6	6.7e-09
AYY82403.1|3526278_3526761_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
AYY82404.1|3527580_3527928_+	HNH nuclease family protein	NA	NA	NA	NA	NA
AYY82405.1|3528076_3529258_+	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.0	2.6e-21
>prophage 229
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3542403	3544023	4158443		Staphylococcus_phage(100.0%)	1	NA	NA
AYY82415.1|3542403_3544023_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.9	1.3e-140
>prophage 230
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3553272	3554346	4158443		Enterobacteria_phage(100.0%)	1	NA	NA
AYY83059.1|3553272_3554346_+	type IV pilus secretin PilQ	NA	D0U174	Enterobacteria_phage	24.3	1.7e-11
>prophage 231
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3557789	3558605	4158443		Vibrio_phage(100.0%)	1	NA	NA
AYY82426.1|3557789_3558605_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	46.6	2.4e-66
>prophage 232
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3561911	3564866	4158443		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
AYY82431.1|3561911_3562535_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.0	5.4e-63
AYY82432.1|3562907_3564866_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.5	2.2e-89
>prophage 233
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3584574	3585567	4158443		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AYY82444.1|3584574_3585567_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.2	2.6e-51
>prophage 234
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3597323	3600683	4158443		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
AYY82458.1|3597323_3598697_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	32.3	3.0e-29
AYY82459.1|3598856_3600683_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HTS9	Paramecium_bursaria_Chlorella_virus	44.9	4.3e-132
>prophage 235
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3608282	3611915	4158443	protease	Stx_converting_phage(50.0%)	5	NA	NA
AYY82466.1|3608282_3608675_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	45.4	2.2e-22
AYY82467.1|3609036_3609600_+	acetate uptake transporter	NA	NA	NA	NA	NA
AYY82468.1|3609623_3610208_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AYY82469.1|3610295_3611207_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AYY82470.1|3611363_3611915_-	NADAR family protein	NA	A0A288TYC1	Enterococcus_phage	47.5	6.8e-33
>prophage 236
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3628287	3630150	4158443	tRNA	Tupanvirus(100.0%)	1	NA	NA
AYY82480.1|3628287_3630150_-|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	23.6	2.0e-12
>prophage 237
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3656194	3663724	4158443		Staphylococcus_phage(33.33%)	7	NA	NA
AYY82500.1|3656194_3656455_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.3	3.5e-16
AYY82501.1|3656418_3656778_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AYY82502.1|3656795_3656939_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AYY82503.1|3657680_3659081_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AYY82504.1|3659085_3660189_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.6	1.3e-51
AYY82505.1|3660200_3661289_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AYY82506.1|3661309_3663724_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	33.9	1.4e-111
>prophage 238
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3676745	3679366	4158443		Xanthomonas_phage(33.33%)	3	NA	NA
AYY82518.1|3676745_3677204_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	1.3e-50
AYY82519.1|3677187_3678399_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.4	6.2e-47
AYY82520.1|3678694_3679366_+	JAB domain-containing protein	NA	A0A1B2LRS6	Wolbachia_phage	27.2	5.2e-19
>prophage 239
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3686217	3687524	4158443		Bacillus_phage(50.0%)	2	NA	NA
AYY83062.1|3686217_3687042_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	33.2	3.6e-22
AYY82527.1|3687038_3687524_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	38.2	8.6e-24
>prophage 240
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3698919	3704669	4158443		Synechococcus_phage(25.0%)	5	NA	NA
AYY82538.1|3698919_3699858_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	35.3	1.4e-30
AYY82539.1|3700123_3701323_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.1	2.9e-36
AYY82540.1|3701332_3702358_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	6.1e-19
AYY82541.1|3702408_3703374_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AYY82542.1|3703376_3704669_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	35.8	1.7e-10
>prophage 241
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3710650	3711817	4158443		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AYY82550.1|3710650_3711817_-	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	56.9	5.5e-117
>prophage 242
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3719093	3721184	4158443		Bacillus_phage(50.0%)	2	NA	NA
AYY82557.1|3719093_3720473_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	27.0	5.7e-20
AYY82558.1|3720485_3721184_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	31.1	1.1e-06
>prophage 243
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3728873	3736132	4158443		Salmonella_phage(33.33%)	7	NA	NA
AYY82567.1|3728873_3730058_+	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	23.7	2.6e-13
AYY82568.1|3730159_3731692_-	glycerol kinase	NA	NA	NA	NA	NA
AYY82569.1|3731734_3732550_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	29.1	4.5e-17
AYY82570.1|3732844_3733087_+	cell division protein ZapB	NA	NA	NA	NA	NA
AYY82571.1|3733169_3733673_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AYY82572.1|3733782_3734700_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AYY82573.1|3734797_3736132_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.8	1.5e-41
>prophage 244
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3751478	3754422	4158443		Bodo_saltans_virus(50.0%)	2	NA	NA
AYY82584.1|3751478_3752909_-	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	33.9	2.1e-62
AYY82585.1|3752919_3754422_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.0	2.8e-57
>prophage 245
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3759217	3760942	4158443		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AYY82590.1|3759217_3760942_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	22.6	8.1e-24
>prophage 246
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3783100	3786203	4158443		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AYY82604.1|3783100_3784048_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.5	9.3e-30
AYY82605.1|3785018_3786203_+	elongation factor Tu	NA	A0A1V0SC62	Catovirus	27.7	1.1e-06
>prophage 247
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3805509	3808284	4158443	tRNA	Prochlorococcus_phage(33.33%)	3	NA	NA
AYY82640.1|3805509_3806457_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	31.0	1.7e-07
AYY82641.1|3806483_3807008_-	peptide deformylase	NA	A0A2I7R586	Vibrio_phage	38.8	4.2e-16
AYY82642.1|3807138_3808284_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	35.3	2.7e-31
>prophage 248
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3821071	3822721	4158443		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AYY82653.1|3821071_3822721_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.2	1.3e-63
>prophage 249
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3830192	3835551	4158443		Bacillus_phage(33.33%)	4	NA	NA
AYY82660.1|3830192_3832217_+	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.7	4.0e-115
AYY82661.1|3832291_3833800_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
AYY82662.1|3833803_3835105_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.2	7.7e-35
AYY82663.1|3835224_3835551_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	45.4	5.6e-19
>prophage 250
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3840090	3846268	4158443		Enterobacteria_phage(40.0%)	6	NA	NA
AYY82667.1|3840090_3841221_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	28.6	1.2e-31
AYY82668.1|3841217_3842480_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	26.8	1.4e-25
AYY83066.1|3842476_3843544_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.6	3.5e-102
AYY82669.1|3843563_3844445_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	68.4	4.5e-111
AYY82670.1|3844422_3845136_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AYY82671.1|3845137_3846268_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	36.5	3.6e-20
>prophage 251
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3862630	3866571	4158443		Brevibacillus_phage(50.0%)	3	NA	NA
AYY82686.1|3862630_3863554_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	25.8	1.8e-22
AYY82687.1|3863553_3864270_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
AYY82688.1|3864414_3866571_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	3.3e-115
>prophage 252
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3869853	3871683	4158443		Catovirus(100.0%)	1	NA	NA
AYY82693.1|3869853_3871683_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.5	3.0e-85
>prophage 253
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3886320	3886866	4158443		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AYY82702.1|3886320_3886866_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.9	1.7e-28
>prophage 254
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3889909	3893268	4158443		Vibrio_phage(50.0%)	2	NA	NA
AYY82704.1|3889909_3891232_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	29.8	9.0e-15
AYY82705.1|3891255_3893268_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	39.0	1.8e-62
>prophage 255
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3898781	3903466	4158443		Brazilian_cedratvirus(50.0%)	3	NA	NA
AYY83070.1|3898781_3900080_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.8	3.8e-66
AYY82711.1|3900508_3900937_+	HTH-type transcriptional repressor NsrR	NA	NA	NA	NA	NA
AYY82712.1|3900976_3903466_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.4	1.6e-65
>prophage 256
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3927210	3928945	4158443		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AYY82737.1|3927210_3927738_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	3.2e-56
AYY82738.1|3927937_3928945_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	45.0	6.7e-71
>prophage 257
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3932511	3934835	4158443		Vibrio_phage(25.0%)	4	NA	NA
AYY82742.1|3932511_3932778_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	66.2	5.1e-18
AYY82743.1|3932964_3933315_+	DNA-binding protein	NA	A0A0C4UQZ2	Shigella_phage	30.8	8.2e-08
AYY82744.1|3933397_3933814_+	DNA-binding protein	NA	C9DGL1	Escherichia_phage	51.9	3.3e-08
AYY82745.1|3933863_3934835_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.4	2.4e-09
>prophage 258
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3940630	3943502	4158443	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
AYY82752.1|3940630_3942577_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.9	6.4e-118
AYY82753.1|3942659_3943502_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.6	2.7e-17
>prophage 259
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3947838	3950595	4158443		Bodo_saltans_virus(100.0%)	1	NA	NA
AYY82758.1|3947838_3950595_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.0	1.9e-27
>prophage 260
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3956203	3958060	4158443		Catovirus(100.0%)	1	NA	NA
AYY82764.1|3956203_3958060_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A1V0SBR7	Catovirus	34.1	5.6e-55
>prophage 261
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3962974	3964678	4158443		Enterobacteria_phage(100.0%)	1	NA	NA
AYY82771.1|3962974_3964678_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	70.1	1.1e-214
>prophage 262
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3971407	3978648	4158443		Trichoplusia_ni_ascovirus(25.0%)	12	NA	NA
AYY82779.1|3971407_3971698_-	GIY-YIG nuclease family protein	NA	Q06VJ4	Trichoplusia_ni_ascovirus	45.6	2.2e-14
AYY82780.1|3971984_3972236_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYY82781.1|3972350_3972791_+	hypothetical protein	NA	NA	NA	NA	NA
AYY83072.1|3972815_3973178_-	hypothetical protein	NA	NA	NA	NA	NA
AYY82782.1|3973341_3973551_-	hypothetical protein	NA	NA	NA	NA	NA
AYY82783.1|3973577_3974042_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A2H5BH04	Vibrio_virus	60.4	6.5e-53
AYY82784.1|3974046_3976185_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	63.8	4.7e-263
AYY83073.1|3976174_3976489_+	hypothetical protein	NA	NA	NA	NA	NA
AYY82785.1|3976529_3976916_-	RidA family protein	NA	NA	NA	NA	NA
AYY82786.1|3976997_3977231_+	hypothetical protein	NA	NA	NA	NA	NA
AYY82787.1|3977240_3977699_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AYY82788.1|3977712_3978648_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	1.2e-53
>prophage 263
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	3986568	3991534	4158443	tRNA	Klosneuvirus(50.0%)	3	NA	NA
AYY82796.1|3986568_3989457_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	38.1	2.0e-147
AYY82797.1|3989470_3989920_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AYY82798.1|3990025_3991534_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.0	5.4e-48
>prophage 264
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	4001029	4007994	4158443		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
AYY82805.1|4001029_4003006_-	hypothetical protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	6.7e-22
AYY82806.1|4002995_4003739_-	hypothetical protein	NA	NA	NA	NA	NA
AYY83075.1|4003761_4007994_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.0	8.4e-22
>prophage 265
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	4037541	4038678	4158443		Mycobacterium_phage(100.0%)	1	NA	NA
AYY82829.1|4037541_4038678_-	RNA ligase RtcB family protein	NA	R4TNH6	Mycobacterium_phage	27.5	3.6e-28
>prophage 266
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	4050365	4054099	4158443		Micromonas_pusilla_virus(50.0%)	4	NA	NA
AYY82842.1|4050365_4052063_+	acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	30.8	9.6e-62
AYY82843.1|4052066_4052351_+	acetolactate synthase 1 small subunit	NA	NA	NA	NA	NA
AYY82844.1|4052420_4053317_-	cation transporter	NA	NA	NA	NA	NA
AYY82845.1|4053520_4054099_-	XRE family transcriptional regulator	NA	A0A0K2FLD1	Brevibacillus_phage	41.7	8.2e-05
>prophage 267
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	4057158	4058505	4158443		Moraxella_phage(100.0%)	1	NA	NA
AYY82848.1|4057158_4058505_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.0	7.4e-158
>prophage 268
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	4072447	4075794	4158443		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AYY82862.1|4072447_4074085_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	G9E4X0	Ostreococcus_lucimarinus_virus	28.8	2.0e-40
AYY82863.1|4074210_4074480_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
AYY82864.1|4074483_4075002_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
AYY82865.1|4075005_4075794_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.4	1.4e-26
>prophage 269
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	4084783	4085404	4158443		Streptococcus_phage(100.0%)	1	NA	NA
AYY82873.1|4084783_4085404_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.1	4.3e-20
>prophage 270
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	4103736	4104390	4158443		Bacillus_phage(100.0%)	1	NA	NA
AYY83076.1|4103736_4104390_-	two-component system response regulator NarL	NA	W8CYM9	Bacillus_phage	30.1	2.0e-07
>prophage 271
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	4109012	4110566	4158443		Escherichia_phage(100.0%)	1	NA	NA
AYY82887.1|4109012_4110566_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	33.3	3.2e-19
>prophage 272
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	4134286	4139301	4158443		Tupanvirus(50.0%)	6	NA	NA
AYY82912.1|4134286_4135264_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9L0E9	Tupanvirus	21.1	4.3e-06
AYY82913.1|4135307_4135721_-	hypothetical protein	NA	NA	NA	NA	NA
AYY82914.1|4135717_4136260_-	LemA family protein	NA	NA	NA	NA	NA
AYY82915.1|4136269_4137340_-	hypothetical protein	NA	NA	NA	NA	NA
AYY82916.1|4137376_4137934_-	LemA family protein	NA	NA	NA	NA	NA
AYY82917.1|4138221_4139301_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.2	4.6e-09
>prophage 273
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	4147888	4152283	4158443		Dickeya_phage(50.0%)	4	NA	NA
AYY82924.1|4147888_4148563_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	60.8	4.0e-59
AYY82925.1|4148769_4149024_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	75.0	5.3e-09
AYY82926.1|4149111_4151478_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	40.4	3.2e-132
AYY82927.1|4151656_4152283_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	42.5	9.5e-15
>prophage 274
CP033736	Proteus vulgaris strain FDAARGOS_556 chromosome, complete genome	4158443	4155788	4156454	4158443		Staphylococcus_phage(100.0%)	1	NA	NA
AYY82932.1|4155788_4156454_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.4	1.5e-13
