The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033884	Escherichia coli strain 50579417 chromosome, complete genome	5206490	79060	86578	5206490		Escherichia_phage(42.86%)	7	NA	NA
AYZ99759.1|79060_79609_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
AYZ99760.1|79613_80492_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
AYZ99761.1|80549_81449_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
AYZ99762.1|81448_82534_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
AYZ99763.1|82905_83799_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AYZ99764.1|84030_85026_-	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
AYZ99765.1|85183_86578_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	9.8e-20
>prophage 2
CP033884	Escherichia coli strain 50579417 chromosome, complete genome	5206490	136765	185972	5206490	capsid,head,holin,transposase,tail,portal,terminase,integrase,plate,lysis	Enterobacteria_phage(32.61%)	61	138272:138298	171171:171197
AYZ99803.1|136765_138127_+	U32 family peptidase	NA	Q6DW11	Phage_TP	99.2	1.6e-216
138272:138298	attL	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
AYZ99804.1|138699_139863_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.7	1.0e-203
AYZ99805.1|139862_140342_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	4.3e-84
AYZ99806.1|142796_142916_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AYZ99807.1|142948_143224_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
AYZ99808.1|143280_143799_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
AYZ99809.1|143811_145002_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	1.8e-224
AYZ99810.1|145261_145954_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	98.3	1.4e-123
AYZ99811.1|146445_146625_+	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
AYZ99812.1|146677_146956_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ99813.1|147159_147687_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	95.4	1.2e-90
AYZ99814.1|147690_150009_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	68.1	6.3e-213
AYZ99815.1|150019_150550_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	99.4	3.9e-102
AYZ99816.1|150542_151451_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
AYZ99817.1|151455_151803_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
AYZ99818.1|151799_152435_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	8.5e-112
AYZ99819.1|152518_153304_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ99820.1|153375_153828_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	1.7e-74
AYZ99821.1|153820_154288_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	7.4e-81
AYZ99822.1|154250_154424_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
AYZ99823.1|154395_154821_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	1.0e-65
AYZ99824.1|154808_155234_-	protein lysA	NA	Q858W1	Yersinia_virus	89.4	1.5e-59
AYZ99825.1|155248_155746_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
AYZ99826.1|155745_156027_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AYZ99827.1|156030_156234_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AYZ99828.1|156233_156743_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AYZ99829.1|156842_157586_-|terminase	terminase	terminase	Q858W5	Yersinia_virus	98.8	4.6e-125
AYZ99830.1|157589_158663_-|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.4	1.9e-201
AYZ99831.1|158721_159576_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0F7LA11	Escherichia_phage	100.0	1.7e-139
AYZ99832.1|159749_161522_+	oxidoreductase	NA	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
AYZ99833.1|161521_162556_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
AYZ99834.1|162873_163530_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ99835.1|163613_164345_-	hypothetical protein	NA	A0A218M4H5	Erwinia_phage	78.6	1.0e-108
AYZ99836.1|164574_164781_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	97.0	1.1e-31
AYZ99837.1|164780_165233_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.0	3.0e-79
AYZ99838.1|165232_167518_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	98.3	0.0e+00
AYZ99839.1|167507_167783_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
AYZ99840.1|167779_168004_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AYZ99841.1|168006_168306_-	hypothetical protein	NA	S4TUD1	Salmonella_phage	98.0	3.5e-44
AYZ99842.1|168305_168530_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
AYZ99843.1|168593_169094_-	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
AYZ99844.1|169271_169547_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
AYZ99845.1|169661_169961_+	XRE family transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
AYZ99846.1|170077_171091_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	2.4e-193
AYZ99847.1|171188_171380_-	hypothetical protein	NA	NA	NA	NA	NA
171171:171197	attR	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
AYZ99848.1|171367_171685_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ99849.1|172099_172999_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
AYZ99850.1|173080_173860_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AYZ99851.1|173959_175000_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
AYZ99852.1|175047_175305_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AYZ99853.1|175377_176586_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AYZ99854.1|176951_178157_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
AYZ99855.1|178600_178921_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AYZ99856.1|178913_179300_+	amino acid-binding protein	NA	NA	NA	NA	NA
AYZ99857.1|179307_179994_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ99858.1|179971_180598_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ99859.1|180676_181882_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
AYZ99860.1|181994_182663_-	putative tetracyline resistance transcriptional regulator TetC	NA	NA	NA	NA	NA
AYZ99861.1|183555_183981_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AYZ99862.1|183977_184328_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AYZ99863.1|184358_185972_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 3
CP033884	Escherichia coli strain 50579417 chromosome, complete genome	5206490	221514	230957	5206490		Enterobacteria_phage(85.71%)	10	NA	NA
AYZ99887.1|221514_222651_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
AYZ99888.1|222647_224648_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AYZ99889.1|224772_225234_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AYZ99890.1|225275_225746_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AYZ99891.1|225792_226512_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYZ99892.1|226508_228194_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
AYZ99893.1|228415_229147_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
AYZ99894.1|229206_229314_+	protein YohO	NA	NA	NA	NA	NA
AYZ99895.1|229294_230026_-	ABC transporter permease	NA	NA	NA	NA	NA
AYZ99896.1|230030_230957_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 4
CP033884	Escherichia coli strain 50579417 chromosome, complete genome	5206490	633049	678080	5206490	tail,terminase,holin,integrase	Escherichia_phage(55.1%)	54	634700:634716	674966:674982
AZA04289.1|633049_633223_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
AZA00241.1|633536_634052_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
AZA00242.1|634067_634607_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	96.6	1.6e-42
634700:634716	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
AZA00243.1|634803_635301_-	DUF2514 domain-containing protein	NA	A0A193GYU6	Enterobacter_phage	66.5	6.7e-48
AZA00244.1|635297_635927_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	96.7	2.9e-112
AZA00245.1|635916_636225_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	100.0	1.3e-49
AZA00246.1|636211_636616_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	94.8	2.3e-62
AZA00247.1|636791_639398_-	SGNH/GDSL hydrolase family protein	NA	G9L6E4	Escherichia_phage	65.2	2.7e-79
AZA00248.1|639593_639851_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	97.6	3.7e-42
AZA00249.1|639988_640120_+	hypothetical protein	NA	NA	NA	NA	NA
AZA00250.1|640165_640858_+	BRO-like protein	NA	G9L6E2	Escherichia_phage	80.2	2.2e-97
AZA00251.1|640987_641314_+	hypothetical protein	NA	NA	NA	NA	NA
AZA00252.1|641300_641813_+	hypothetical protein	NA	NA	NA	NA	NA
AZA00253.1|641894_642056_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
AZA00254.1|642087_642384_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	100.0	2.5e-50
AZA00255.1|642579_645054_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.3	0.0e+00
AZA00256.1|645059_646862_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	98.0	0.0e+00
AZA00257.1|646858_649372_-	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	97.4	0.0e+00
AZA00258.1|649371_649917_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	93.9	1.8e-86
AZA00259.1|649916_650381_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.9e-84
AZA00260.1|650380_652852_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	98.7	0.0e+00
AZA00261.1|652851_653457_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	4.7e-112
AZA00262.1|653456_653780_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
AZA00263.1|653830_654166_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	8.5e-55
AZA00264.1|654176_654614_-	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	95.2	1.4e-70
AZA00265.1|654665_655652_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.4	5.6e-187
AZA00266.1|655666_656362_-	peptidase	NA	G9L6C4	Escherichia_phage	100.0	6.0e-95
AZA00267.1|656364_656661_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
AZA00268.1|656657_658337_-|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.3	8.0e-303
AZA00269.1|658351_658558_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
AZA00270.1|659309_660011_+	hypothetical protein	NA	NA	NA	NA	NA
AZA00271.1|660222_661692_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	97.8	6.8e-290
AZA00272.1|661688_662399_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	85.2	1.0e-105
AZA00273.1|662439_662778_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	96.4	3.5e-56
AZA00274.1|662892_663552_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	61.9	1.4e-53
AZA00275.1|663562_664318_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	93.2	6.5e-143
AZA00276.1|664319_665216_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	88.9	2.9e-158
AZA00277.1|665212_665689_-	hypothetical protein	NA	A0A2I6TCH0	Escherichia_phage	68.8	9.4e-31
AZA00278.1|665750_666095_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	8.2e-61
AZA04290.1|666212_666998_-	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	100.0	9.3e-153
AZA00279.1|666994_667810_-	primosomal protein	NA	Q286X4	Escherichia_phage	95.6	1.7e-117
AZA00280.1|667825_668026_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	1.0e-31
AZA00281.1|668176_668407_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
AZA00282.1|668561_669146_+	XRE family transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
AZA00283.1|669454_669754_+	hypothetical protein	NA	G9L6A4	Escherichia_phage	99.0	5.8e-47
AZA00284.1|669750_670572_+	exodeoxyribonuclease VIII	NA	A0A2R9YJH7	Escherichia_phage	98.5	1.5e-161
AZA00285.1|670568_671510_+	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	99.7	1.0e-177
AZA00286.1|671559_671808_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
AZA04291.1|671965_672217_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	5.2e-41
AZA00287.1|672209_672860_+	adenine methylase	NA	G9L699	Escherichia_phage	96.3	5.2e-125
AZA00288.1|672856_673516_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.5	4.4e-103
AZA00289.1|673518_674775_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	4.4e-237
AZA00290.1|674967_676545_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
674966:674982	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
AZA00291.1|676613_678080_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
>prophage 5
CP033884	Escherichia coli strain 50579417 chromosome, complete genome	5206490	895029	902169	5206490		Escherichia_phage(83.33%)	6	NA	NA
AZA00471.1|895029_897591_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
AZA00472.1|897696_898353_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
AZA00473.1|898403_899171_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
AZA00474.1|899366_900275_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
AZA00475.1|900271_901534_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AZA00476.1|901530_902169_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 6
CP033884	Escherichia coli strain 50579417 chromosome, complete genome	5206490	1149995	1196236	5206490	tRNA,protease,transposase	Stx2-converting_phage(42.86%)	53	NA	NA
AZA00688.1|1149995_1150754_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
AZA00689.1|1150959_1151880_-	agmatinase	NA	NA	NA	NA	NA
AZA00690.1|1152017_1153994_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AZA04312.1|1154002_1154134_-	virulence promoting factor	NA	NA	NA	NA	NA
AZA00691.1|1154269_1154485_+	hypothetical protein	NA	NA	NA	NA	NA
AZA00692.1|1154481_1154733_-	DUF2684 family protein	NA	NA	NA	NA	NA
AZA00693.1|1154788_1155943_+	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
AZA00694.1|1156378_1157773_+	galactose-proton symporter	NA	NA	NA	NA	NA
AZA00695.1|1157849_1158347_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
AZA00696.1|1158441_1159149_+	deoxyribonuclease I	NA	NA	NA	NA	NA
AZA00697.1|1159228_1159960_+	ribosomal RNA small subunit methyltransferase E	NA	NA	NA	NA	NA
AZA00698.1|1159972_1160923_+	glutathione synthetase	NA	NA	NA	NA	NA
AZA00699.1|1161031_1161595_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
AZA00700.1|1161594_1162011_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AZA00701.1|1162185_1163166_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
AZA00702.1|1163183_1163888_+	YggS family pyridoxal phosphate enzyme	NA	NA	NA	NA	NA
AZA00703.1|1163905_1164472_+	YggT family protein	NA	NA	NA	NA	NA
AZA00704.1|1164468_1164759_+	YggU family protein	NA	NA	NA	NA	NA
AZA00705.1|1164766_1165360_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
AZA00706.1|1165352_1166489_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
AZA00707.1|1166643_1167651_-	DUF1202 family protein	NA	NA	NA	NA	NA
AZA00708.1|1167767_1168814_-	L-asparaginase 2	NA	NA	NA	NA	NA
AZA00709.1|1168989_1169709_-	DUF2884 family protein	NA	NA	NA	NA	NA
AZA00710.1|1169892_1170219_-	DUF469 domain-containing protein	NA	NA	NA	NA	NA
AZA00711.1|1170218_1170938_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AZA00712.1|1171098_1172151_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AZA00713.1|1172178_1172454_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AZA00714.1|1172518_1173598_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
AZA00715.1|1173799_1175056_+	nucleoside permease NupG	NA	NA	NA	NA	NA
AZA00716.1|1175104_1177240_-	ornithine decarboxylase	NA	NA	NA	NA	NA
AZA00717.1|1177632_1178340_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
AZA00718.1|1178718_1179984_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	37.6	3.3e-75
AZA00719.1|1182247_1182595_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
AZA00720.1|1183090_1183327_-	hypothetical protein	NA	NA	NA	NA	NA
AZA00721.1|1183326_1183761_-	hypothetical protein	NA	NA	NA	NA	NA
AZA00722.1|1183748_1184150_-	hypothetical protein	NA	NA	NA	NA	NA
AZA00723.1|1184409_1184979_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AZA00724.1|1185178_1185379_+	hypothetical protein	NA	NA	NA	NA	NA
AZA00725.1|1186098_1186365_-	hypothetical protein	NA	NA	NA	NA	NA
AZA00726.1|1186306_1186465_+	transcriptional regulator	NA	NA	NA	NA	NA
AZA00727.1|1186433_1186712_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AZA00728.1|1186806_1187409_+	hypothetical protein	NA	NA	NA	NA	NA
AZA04313.1|1187314_1187512_-	hypothetical protein	NA	NA	NA	NA	NA
AZA00729.1|1187580_1187778_+	hypothetical protein	NA	NA	NA	NA	NA
AZA00730.1|1188263_1188479_-	hypothetical protein	NA	NA	NA	NA	NA
AZA00731.1|1188611_1189529_+	hypothetical protein	NA	NA	NA	NA	NA
AZA00732.1|1189613_1190486_+	GTPase family protein	NA	NA	NA	NA	NA
AZA00733.1|1190871_1191810_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZA00734.1|1191775_1193048_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
AZA04314.1|1193232_1193493_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA00735.1|1193819_1194245_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AZA00736.1|1194241_1194592_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AZA00737.1|1194622_1196236_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 7
CP033884	Escherichia coli strain 50579417 chromosome, complete genome	5206490	2717695	2786116	5206490	tRNA,protease,holin,transposase	uncultured_Caudovirales_phage(16.67%)	59	NA	NA
AZA02060.1|2717695_2719048_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AZA02061.1|2719231_2719618_+	cytochrome b562	NA	NA	NA	NA	NA
AZA02062.1|2719809_2720052_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	50.0	1.4e-14
AZA02063.1|2720041_2720332_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	63.8	3.8e-27
AZA02064.1|2720332_2720797_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	K4F9T1	Cronobacter_phage	57.1	8.5e-53
AZA02065.1|2720981_2723120_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
AZA02066.1|2723513_2725169_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AZA02067.1|2725218_2726640_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AZA02068.1|2726758_2727706_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
AZA04370.1|2727890_2727944_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
AZA02069.1|2728084_2730781_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	3.4e-45
AZA02070.1|2730986_2731373_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AZA02071.1|2731445_2731907_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AZA02072.1|2731919_2732855_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
AZA02073.1|2732858_2732993_-	pyrBI operon leader peptide	NA	NA	NA	NA	NA
AZA02074.1|2733273_2733669_-	RidA family protein	NA	NA	NA	NA	NA
AZA02075.1|2733799_2734513_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZA02076.1|2734583_2735177_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZA02077.1|2735321_2735774_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
AZA02078.1|2735896_2737492_+	DNA-binding protein	NA	NA	NA	NA	NA
AZA02079.1|2737547_2738552_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AZA02080.1|2738713_2739130_+	regulator of ribonuclease activity B	NA	NA	NA	NA	NA
AZA02081.1|2739175_2739679_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZA02082.1|2739871_2741068_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
AZA02083.1|2741123_2743979_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
AZA02084.1|2743978_2744422_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AZA02085.1|2744775_2746287_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AZA02086.1|2746553_2747654_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AZA02087.1|2747653_2748736_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AZA02088.1|2748896_2750399_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.9	1.4e-83
AZA02089.1|2750476_2751475_-	transcriptional regulator	NA	NA	NA	NA	NA
AZA02090.1|2751541_2752861_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
AZA02091.1|2752923_2753688_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AZA02092.1|2753711_2754743_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
AZA02093.1|2754959_2755523_+	thermosensitive gluconokinase	NA	NA	NA	NA	NA
AZA02094.1|2755526_2756546_-	aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
AZA02095.1|2761103_2762432_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AZA02096.1|2763058_2764276_+	MFS transporter	NA	NA	NA	NA	NA
AZA04371.1|2764287_2765406_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AZA02097.1|2765448_2765574_+	hypothetical protein	NA	NA	NA	NA	NA
AZA02098.1|2765626_2765884_-	hypothetical protein	NA	NA	NA	NA	NA
AZA02099.1|2766197_2767364_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
AZA02100.1|2767299_2767713_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AZA02101.1|2767672_2767831_-|holin	choline transporter	holin	NA	NA	NA	NA
AZA04372.1|2767775_2769773_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
AZA02102.1|2769926_2771083_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AZA02103.1|2772016_2772274_+	hypothetical protein	NA	NA	NA	NA	NA
AZA02104.1|2772830_2773598_-	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AZA02105.1|2773598_2774555_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	2.4e-17
AZA02106.1|2774551_2775550_-	Fe3+ dicitrate ABC transporter permease	NA	NA	NA	NA	NA
AZA02107.1|2775546_2776449_-	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AZA02108.1|2776493_2778818_-	fe(3+) dicitrate transporter fecA	NA	NA	NA	NA	NA
AZA02109.1|2778904_2779858_-	protein FecR	NA	NA	NA	NA	NA
AZA02110.1|2779854_2780376_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AZA02111.1|2781892_2782081_-	hypothetical protein	NA	NA	NA	NA	NA
AZA02112.1|2782125_2782383_+	biofilm development YmgB/AriR family protein	NA	NA	NA	NA	NA
AZA02113.1|2782545_2782755_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.9e-06
AZA02114.1|2783133_2784492_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
AZA02115.1|2784730_2786116_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	5.0e-258
>prophage 8
CP033884	Escherichia coli strain 50579417 chromosome, complete genome	5206490	3371619	3418369	5206490	transposase,protease,tRNA	uncultured_Mediterranean_phage(33.33%)	44	NA	NA
AZA02610.1|3371619_3372078_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AZA02611.1|3372211_3373585_+	proline-specific permease ProY	NA	NA	NA	NA	NA
AZA02612.1|3373740_3375558_+	maltodextrin glucosidase	NA	NA	NA	NA	NA
AZA02613.1|3375743_3377201_+	hypothetical protein	NA	NA	NA	NA	NA
AZA02614.1|3377221_3377803_-	ACP phosphodiesterase	NA	NA	NA	NA	NA
AZA02615.1|3378021_3379092_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AZA02616.1|3379147_3380275_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
AZA02617.1|3380297_3380630_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AZA02618.1|3380657_3382505_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AZA02619.1|3382515_3383487_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
AZA02620.1|3383464_3383725_+	hypothetical protein	NA	NA	NA	NA	NA
AZA02621.1|3383681_3384140_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AZA02622.1|3384326_3384674_+	HNH endonuclease	NA	NA	NA	NA	NA
AZA02623.1|3384711_3385596_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
AZA02624.1|3386799_3387957_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	92.5	8.2e-198
AZA02625.1|3388331_3388781_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AZA02626.1|3388784_3389888_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	6.3e-54
AZA02627.1|3389976_3390447_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
AZA02628.1|3390466_3390886_+	N utilization substance protein B	NA	NA	NA	NA	NA
AZA02629.1|3390963_3391941_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
AZA02630.1|3391918_3392434_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
AZA02631.1|3392610_3394182_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AZA02632.1|3394412_3395387_-	aldo/keto reductase	NA	NA	NA	NA	NA
AZA02633.1|3395441_3397304_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AZA02634.1|3397328_3398228_-	farnesyl-diphosphate synthase	NA	NA	NA	NA	NA
AZA02635.1|3398227_3398470_-	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
AZA02636.1|3398675_3400124_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
AZA02637.1|3400177_3400768_-	protein deglycase YajL	NA	NA	NA	NA	NA
AZA02638.1|3400730_3401642_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AZA02639.1|3401809_3402301_+	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
AZA02640.1|3402428_3403793_-	MFS transporter	NA	NA	NA	NA	NA
AZA02641.1|3403941_3404832_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AZA02642.1|3404843_3405173_-	cytochrome bo(3) ubiquinol oxidase subunit 4	NA	NA	NA	NA	NA
AZA02643.1|3405172_3405787_-	cytochrome bo(3) ubiquinol oxidase subunit 3	NA	NA	NA	NA	NA
AZA02644.1|3405776_3407768_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AZA02645.1|3407789_3408737_-	cytochrome ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AZA02646.1|3409196_3410672_-	muropeptide MFS transporter AmpG	NA	NA	NA	NA	NA
AZA02647.1|3410715_3411294_-	hypothetical protein	NA	NA	NA	NA	NA
AZA02648.1|3411598_3411916_+	protein BolA	NA	NA	NA	NA	NA
AZA02649.1|3411924_3412113_+	hypothetical protein	NA	NA	NA	NA	NA
AZA02650.1|3412259_3413558_+	trigger factor	NA	NA	NA	NA	NA
AZA02651.1|3413803_3414427_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
AZA02652.1|3414552_3415827_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
AZA02653.1|3416014_3418369_+|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
>prophage 9
CP033884	Escherichia coli strain 50579417 chromosome, complete genome	5206490	3783033	3840849	5206490	capsid,head,holin,protease,transposase,tail,portal,terminase,integrase	Enterobacteria_phage(36.21%)	80	3776420:3776436	3818480:3818496
3776420:3776436	attL	CGGAAGATGGCAGCGTG	NA	NA	NA	NA
AZA02946.1|3783033_3783492_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AZA02947.1|3783603_3784887_-	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
AZA02948.1|3785021_3786092_-|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	99.4	9.6e-201
AZA02949.1|3786069_3786288_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AZA02950.1|3786327_3786495_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
AZA04411.1|3786427_3786631_+	hypothetical protein	NA	NA	NA	NA	NA
AZA02951.1|3786595_3787474_-	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	53.4	6.7e-67
AZA02952.1|3787470_3787680_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
AZA02953.1|3787681_3787870_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	93.5	2.9e-28
AZA02954.1|3788042_3788537_-	ead/Ea22-like family protein	NA	A0A0P0ZD75	Stx2-converting_phage	55.0	3.0e-24
AZA02955.1|3788523_3788778_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	3.2e-38
AZA02956.1|3788774_3788942_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	5.0e-24
AZA02957.1|3788938_3789220_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.8	2.8e-43
AZA02958.1|3789236_3789551_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
AZA02959.1|3789562_3790045_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	96.2	2.3e-77
AZA02960.1|3790028_3790940_-	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	99.3	1.1e-168
AZA02961.1|3790936_3791245_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
AZA02962.1|3791329_3791605_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	100.0	1.6e-46
AZA02963.1|3791726_3791927_-	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	4.2e-33
AZA02964.1|3792055_3792328_-	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	97.8	2.2e-40
AZA02965.1|3792778_3793462_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
AZA02966.1|3793461_3793782_-	hypothetical protein	NA	NA	NA	NA	NA
AZA02967.1|3793905_3794613_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	99.6	4.3e-133
AZA02968.1|3794692_3794920_+	DNA-binding protein	NA	G9L677	Escherichia_phage	98.7	1.7e-35
AZA02969.1|3795058_3795355_+	hypothetical protein	NA	A0A1U9AJB5	Stx1_converting_phage	98.0	1.5e-47
AZA02970.1|3795387_3796287_+	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
AZA02971.1|3796283_3796985_+	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	99.1	6.4e-129
AZA02972.1|3796981_3797272_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
AZA02973.1|3797345_3797786_+	phage protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
AZA04412.1|3797782_3797965_+	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
AZA02974.1|3797961_3798132_+	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	96.4	3.5e-25
AZA02975.1|3798124_3798736_+	recombination protein NinG	NA	Q716C3	Shigella_phage	100.0	2.7e-99
AZA02976.1|3798779_3799268_+	antiterminator	NA	M1FPN0	Enterobacteria_phage	100.0	5.3e-90
AZA02977.1|3799633_3799849_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
AZA02978.1|3799853_3800204_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
AZA02979.1|3800267_3800801_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
AZA02980.1|3801017_3801203_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
AZA02981.1|3801420_3801687_+	hypothetical protein	NA	NA	NA	NA	NA
AZA02982.1|3801692_3802232_-	hypothetical protein	NA	NA	NA	NA	NA
AZA02983.1|3802370_3802721_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	1.4e-63
AZA02984.1|3802868_3803351_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
AZA02985.1|3803350_3805108_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
AZA02986.1|3805255_3806482_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	3.1e-203
AZA02987.1|3806474_3807074_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
AZA02988.1|3807088_3808306_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.4	1.7e-161
AZA02989.1|3808382_3808700_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
AZA02990.1|3808708_3809047_+|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
AZA02991.1|3809043_3809493_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
AZA02992.1|3809489_3809834_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	2.3e-55
AZA02993.1|3809894_3810599_+|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	93.6	1.7e-113
AZA02994.1|3810598_3810985_+|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
AZA04413.1|3811026_3811287_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	1.7e-39
AZA02995.1|3811333_3814561_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.6	0.0e+00
AZA02996.1|3814538_3814895_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
AZA02997.1|3814894_3815593_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	7.6e-130
AZA02998.1|3815598_3816342_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.0e-148
AZA02999.1|3816239_3816887_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
AZA03000.1|3816947_3820427_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.8	0.0e+00
3818480:3818496	attR	CACGCTGCCATCTTCCG	NA	NA	NA	NA
AZA03001.1|3820494_3821094_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
AZA03002.1|3821245_3823615_+|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	47.9	8.3e-104
AZA03003.1|3823611_3823893_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	46.7	5.0e-16
AZA03004.1|3823902_3824607_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	6.0e-58
AZA03005.1|3824617_3824911_+	hypothetical protein	NA	NA	NA	NA	NA
AZA03006.1|3825123_3826455_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
AZA03007.1|3827200_3827677_-	kinase inhibitor	NA	NA	NA	NA	NA
AZA03008.1|3827735_3829025_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
AZA03009.1|3829111_3830152_+	biotin synthase	NA	NA	NA	NA	NA
AZA03010.1|3830148_3831303_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AZA03011.1|3831289_3832045_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
AZA03012.1|3832037_3832715_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AZA03013.1|3833293_3835315_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AZA03014.1|3835352_3836261_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.7	3.2e-27
AZA03015.1|3836657_3837647_+	cyclic pyranopterin monophosphate synthase	NA	NA	NA	NA	NA
AZA03016.1|3837668_3838181_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
AZA03017.1|3838183_3838669_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AZA03018.1|3838661_3838907_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
AZA03019.1|3838908_3839361_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
AZA03020.1|3839497_3840202_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
AZA03021.1|3840218_3840434_+	hypothetical protein	NA	NA	NA	NA	NA
AZA03022.1|3840390_3840849_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 10
CP033884	Escherichia coli strain 50579417 chromosome, complete genome	5206490	4187939	4265534	5206490	capsid,head,holin,transposase,tail,tRNA,portal,terminase,integrase	Escherichia_phage(33.93%)	92	4189067:4189082	4232382:4232397
AZA03334.1|4187939_4188398_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AZA03335.1|4188519_4189479_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
4189067:4189082	attL	GTCAGCGTGTCACCAC	NA	NA	NA	NA
AZA03336.1|4189625_4193072_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AZA03337.1|4193199_4194273_-	acyltransferase family protein	NA	NA	NA	NA	NA
AZA03338.1|4194533_4195733_+	lipoprotein-releasing system protein LolC	NA	NA	NA	NA	NA
AZA03339.1|4195725_4196427_+	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.8	5.4e-35
AZA03340.1|4196426_4197671_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AZA03341.1|4197699_4198611_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AZA03342.1|4198626_4199448_+	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
AZA03343.1|4199584_4200370_-	TPM domain-containing protein	NA	NA	NA	NA	NA
AZA03344.1|4200366_4200828_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
AZA03345.1|4200885_4201932_-	spermidine/putrescine-binding periplasmic protein	NA	NA	NA	NA	NA
AZA03346.1|4201928_4202723_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AZA03347.1|4202889_4204008_-|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
AZA03348.1|4203976_4204246_-	excisionase	NA	NA	NA	NA	NA
AZA03349.1|4204307_4206764_-	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	3.3e-103
AZA03350.1|4206841_4207045_-	DUF1482 family protein	NA	NA	NA	NA	NA
AZA03351.1|4207041_4207230_-	cell division inhibitor	NA	NA	NA	NA	NA
AZA03352.1|4207240_4208095_-	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
AZA04429.1|4208625_4209000_-	hypothetical protein	NA	NA	NA	NA	NA
AZA03353.1|4209011_4209164_-	DUF1391 domain-containing protein	NA	NA	NA	NA	NA
AZA03354.1|4209370_4209778_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
AZA03355.1|4209854_4210082_+	transcriptional regulator	NA	NA	NA	NA	NA
AZA03356.1|4210065_4210617_+	hypothetical protein	NA	NA	NA	NA	NA
AZA03357.1|4210588_4211629_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
AZA04430.1|4211660_4212083_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.3	2.8e-71
AZA03358.1|4212116_4212887_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
AZA03359.1|4212902_4213295_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
AZA03360.1|4213291_4213588_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
AZA03361.1|4213584_4214046_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
AZA03362.1|4214023_4214380_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
AZA03363.1|4214475_4214883_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	6.1e-23
AZA03364.1|4214884_4215250_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
AZA03365.1|4215246_4216233_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
AZA03366.1|4216353_4216533_+	hypothetical protein	NA	NA	NA	NA	NA
AZA03367.1|4216791_4216947_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AZA03368.1|4217163_4217415_+	hypothetical protein	NA	NA	NA	NA	NA
AZA03369.1|4217481_4217760_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
AZA03370.1|4217761_4218820_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
AZA03371.1|4218820_4219189_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.4e-34
AZA03372.1|4219181_4219871_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
AZA03373.1|4220083_4220281_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	93.8	1.7e-26
AZA03374.1|4220650_4220986_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
AZA03375.1|4221231_4221435_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
AZA03376.1|4221742_4221958_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AZA03377.1|4221962_4222853_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	70.6	3.6e-108
AZA03378.1|4222889_4223423_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	3.3e-101
AZA03379.1|4223941_4224127_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	77.0	7.1e-19
AZA03380.1|4224637_4225147_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AZA03381.1|4225118_4227047_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
AZA03382.1|4227030_4227237_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
AZA03383.1|4227233_4228826_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
AZA03384.1|4228815_4230264_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	9.9e-100
AZA03385.1|4230300_4230648_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
AZA03386.1|4230705_4231734_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.4e-116
AZA03387.1|4231785_4232160_+	hypothetical protein	NA	NA	NA	NA	NA
AZA03388.1|4232152_4232506_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
4232382:4232397	attR	GTGGTGACACGCTGAC	NA	NA	NA	NA
AZA03389.1|4232521_4233055_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
AZA03390.1|4233051_4233447_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AZA03391.1|4233454_4234204_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	2.7e-125
AZA03392.1|4234222_4234654_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	7.4e-43
AZA03393.1|4234680_4235094_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	4.6e-42
AZA03394.1|4235074_4237636_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
AZA03395.1|4237632_4237962_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
AZA03396.1|4237961_4238660_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.6	3.2e-128
AZA03397.1|4238670_4239414_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
AZA04431.1|4239359_4239992_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.7	1.2e-102
AZA03398.1|4240013_4240355_+	hypothetical protein	NA	NA	NA	NA	NA
AZA03399.1|4240335_4244028_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.7	0.0e+00
AZA03400.1|4244095_4244695_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
AZA03401.1|4244846_4247873_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
AZA03402.1|4247872_4248457_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
AZA03403.1|4248429_4248567_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AZA03404.1|4248511_4249180_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZA03405.1|4249236_4249503_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
AZA03406.1|4249734_4250598_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AZA03407.1|4250581_4251718_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AZA03408.1|4251967_4253194_+	peptidase T	NA	NA	NA	NA	NA
AZA03409.1|4253242_4254364_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AZA03410.1|4254439_4255900_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AZA03411.1|4255899_4256571_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AZA03412.1|4256740_4258111_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AZA04432.1|4258114_4258756_-	lysogenization regulator HflD	NA	NA	NA	NA	NA
AZA03413.1|4258791_4259898_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AZA03414.1|4259951_4260413_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AZA03415.1|4260422_4261061_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AZA03416.1|4261393_4261729_-	DUF1493 family protein	NA	NA	NA	NA	NA
AZA03417.1|4261728_4262178_-	hypothetical protein	NA	NA	NA	NA	NA
AZA03418.1|4262760_4264011_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	6.5e-23
AZA03419.1|4264113_4264437_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	62.6	6.3e-39
AZA03420.1|4264912_4265119_+	hypothetical protein	NA	NA	NA	NA	NA
AZA03421.1|4265075_4265534_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP033884	Escherichia coli strain 50579417 chromosome, complete genome	5206490	4486226	4540693	5206490	holin,tail,coat,tRNA,terminase	Escherichia_phage(49.06%)	67	NA	NA
AZA03613.1|4486226_4487600_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AZA03614.1|4487728_4488664_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AZA03615.1|4488715_4489951_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
AZA03616.1|4489952_4490168_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AZA04449.1|4490267_4490456_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
AZA04450.1|4490493_4490643_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
AZA03617.1|4490698_4491508_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
AZA03618.1|4491500_4494101_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
AZA03619.1|4494202_4494478_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
AZA04451.1|4494552_4494723_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AZA03620.1|4494722_4494944_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AZA04452.1|4495385_4495874_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
AZA03621.1|4495870_4496026_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AZA03622.1|4496036_4496171_-	hypothetical protein	NA	NA	NA	NA	NA
AZA03623.1|4496203_4496422_-	hypothetical protein	NA	NA	NA	NA	NA
AZA03624.1|4496458_4496878_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
AZA03625.1|4496957_4497212_+	DNA-binding protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AZA03626.1|4497208_4497631_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
AZA03627.1|4497708_4498497_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
AZA03628.1|4498503_4499250_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.5	1.1e-110
AZA03629.1|4499272_4500034_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	3.4e-115
AZA03630.1|4500049_4500472_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	7.4e-64
AZA03631.1|4500633_4501137_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	39.7	4.3e-18
AZA03632.1|4501257_4502031_-	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
AZA03633.1|4502553_4502679_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.2	4.0e-10
AZA04453.1|4502761_4503103_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
AZA03634.1|4503970_4504570_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
AZA03635.1|4504569_4504860_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
AZA03636.1|4504856_4505399_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
AZA03637.1|4505620_4506190_+	hypothetical protein	NA	NA	NA	NA	NA
AZA03638.1|4506158_4506461_-	hypothetical protein	NA	NA	NA	NA	NA
AZA03639.1|4506537_4506879_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
AZA03640.1|4506882_4507359_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	95.6	5.0e-85
AZA03641.1|4507575_4507761_+	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
AZA03642.1|4507957_4509415_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
AZA03643.1|4509552_4510344_+	transcriptional regulator	NA	R4TG31	Halovirus	40.2	2.8e-48
AZA03644.1|4510336_4511269_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
AZA03645.1|4511246_4511456_+	hypothetical protein	NA	NA	NA	NA	NA
AZA03646.1|4511459_4512554_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	4.5e-113
AZA03647.1|4512534_4513836_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
AZA03648.1|4513838_4515245_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
AZA03649.1|4515228_4516341_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
AZA03650.1|4516445_4517210_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
AZA03651.1|4517308_4518448_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	75.0	9.7e-159
AZA03652.1|4518670_4519066_+	protein singed	NA	NA	NA	NA	NA
AZA03653.1|4519065_4519449_+	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
AZA03654.1|4519449_4519830_+	HK97 gp10 family phage protein	NA	A0A059VF88	Pseudomonas_phage	43.6	1.5e-18
AZA03655.1|4519826_4520219_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AZA03656.1|4520245_4521208_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	8.4e-55
AZA04454.1|4521358_4521718_+	hypothetical protein	NA	NA	NA	NA	NA
AZA03657.1|4521825_4522026_+	hypothetical protein	NA	NA	NA	NA	NA
AZA03658.1|4522189_4525423_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	7.4e-103
AZA03659.1|4525415_4525754_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
AZA03660.1|4525753_4526452_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
AZA03661.1|4526457_4527201_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	1.0e-145
AZA03662.1|4527137_4527740_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
AZA03663.1|4527800_4531280_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
AZA03664.1|4531347_4531947_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
AZA03665.1|4532011_4534411_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
AZA03666.1|4534407_4534689_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
AZA03667.1|4534698_4535403_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
AZA03668.1|4535413_4535707_+	hypothetical protein	NA	NA	NA	NA	NA
AZA03669.1|4535934_4536525_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AZA03670.1|4536841_4537075_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AZA03671.1|4537143_4537257_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
AZA03672.1|4537860_4539144_+	MFS transporter	NA	NA	NA	NA	NA
AZA03673.1|4539232_4540693_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
>prophage 12
CP033884	Escherichia coli strain 50579417 chromosome, complete genome	5206490	4689294	4780163	5206490	capsid,head,holin,transposase,tail,portal,terminase	Enterobacteria_phage(51.16%)	92	NA	NA
AZA03791.1|4689294_4689753_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AZA03792.1|4689930_4690599_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
AZA03793.1|4690901_4691495_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
AZA03794.1|4691491_4692484_-	TDT family transporter	NA	NA	NA	NA	NA
AZA03795.1|4692607_4693588_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
AZA03796.1|4693579_4694119_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
AZA03797.1|4694181_4694406_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
AZA03798.1|4694545_4696201_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AZA03799.1|4696425_4697769_-	VOC family protein	NA	NA	NA	NA	NA
AZA03800.1|4697985_4698909_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA03801.1|4698946_4700587_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
AZA03802.1|4700985_4701135_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
AZA03803.1|4701206_4701380_-	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	59.6	4.4e-07
AZA04460.1|4701624_4702155_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
AZA03804.1|4702343_4703345_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZA03805.1|4703386_4704826_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AZA03806.1|4705022_4705823_-	YdcF family protein	NA	NA	NA	NA	NA
AZA03807.1|4705938_4706316_-	hypothetical protein	NA	NA	NA	NA	NA
AZA03808.1|4706435_4706885_-	hypothetical protein	NA	NA	NA	NA	NA
AZA04461.1|4706871_4707210_-	hypothetical protein	NA	NA	NA	NA	NA
AZA03809.1|4707494_4711397_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
AZA03810.1|4711597_4712203_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AZA03811.1|4712256_4713573_-	hypothetical protein	NA	NA	NA	NA	NA
AZA03812.1|4713562_4715320_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AZA03813.1|4716231_4716837_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
AZA03814.1|4717007_4719314_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
AZA03815.1|4719377_4720238_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
AZA04462.1|4720445_4722854_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AZA03816.1|4726927_4727251_-	DUF1318 domain-containing protein	NA	NA	NA	NA	NA
AZA03817.1|4727258_4727444_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
AZA03818.1|4727440_4730080_-	YdbH family protein	NA	NA	NA	NA	NA
AZA03819.1|4730287_4731277_+	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
AZA03820.1|4731387_4731810_+	heat shock protein HslJ	NA	NA	NA	NA	NA
AZA03821.1|4731806_4732073_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AZA03822.1|4732346_4735871_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AZA03823.1|4736237_4737371_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
AZA03824.1|4737511_4737946_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	3.0e-28
AZA03825.1|4738530_4739445_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA03826.1|4739444_4740272_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
AZA03827.1|4740268_4741126_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AZA03828.1|4741122_4741980_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AZA03829.1|4742452_4743247_+	hypothetical protein	NA	NA	NA	NA	NA
AZA04463.1|4743792_4744086_-	hypothetical protein	NA	NA	NA	NA	NA
AZA03830.1|4744128_4745169_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	2.9e-125
AZA03831.1|4745178_4745460_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
AZA03832.1|4745459_4747835_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
AZA03833.1|4747955_4748414_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AZA03834.1|4748370_4748589_-	hypothetical protein	NA	NA	NA	NA	NA
AZA03835.1|4748610_4749210_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
AZA03836.1|4749277_4752757_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
AZA03837.1|4752817_4753420_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
AZA03838.1|4753356_4754100_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
AZA03839.1|4754105_4754804_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
AZA03840.1|4754803_4755133_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AZA03841.1|4755129_4757691_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.9	0.0e+00
AZA03842.1|4757683_4758118_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AZA03843.1|4758099_4758522_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AZA04464.1|4758537_4759278_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
AZA03844.1|4759285_4759681_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
AZA03845.1|4760268_4760622_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
AZA03846.1|4760633_4761032_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
AZA03847.1|4761073_4762099_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
AZA03848.1|4762153_4762486_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AZA03849.1|4762495_4763815_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
AZA03850.1|4763795_4765397_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
AZA03851.1|4765393_4765600_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AZA03852.1|4765596_4767522_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AZA03853.1|4767496_4768042_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AZA03854.1|4768430_4768664_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AZA03855.1|4768721_4769132_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AZA03856.1|4769283_4769457_-	protein GnsB	NA	NA	NA	NA	NA
AZA04465.1|4769628_4769784_-	hypothetical protein	NA	NA	NA	NA	NA
AZA04466.1|4769863_4769929_-	hypothetical protein	NA	NA	NA	NA	NA
AZA03857.1|4769931_4770120_-	cold-shock protein	NA	NA	NA	NA	NA
AZA03858.1|4770130_4770343_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AZA03859.1|4770705_4771203_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AZA03860.1|4771199_4771733_-	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AZA03861.1|4771729_4772041_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AZA03862.1|4772045_4772261_-|holin	holin	holin	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AZA03863.1|4773014_4773230_-	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AZA03864.1|4773530_4773743_+	cold-shock protein CspF	NA	NA	NA	NA	NA
AZA03865.1|4773797_4773887_+	hypothetical protein	NA	NA	NA	NA	NA
AZA03866.1|4774164_4774917_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AZA03867.1|4774930_4775980_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
AZA03868.1|4775981_4776260_-	hypothetical protein	NA	NA	NA	NA	NA
AZA03869.1|4776326_4776578_-	hypothetical protein	NA	NA	NA	NA	NA
AZA03870.1|4776794_4776950_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AZA03871.1|4777021_4777309_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AZA03872.1|4777308_4777548_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AZA03873.1|4777572_4777878_+	hypothetical protein	NA	NA	NA	NA	NA
AZA03874.1|4778080_4778413_+	protein FlxA	NA	NA	NA	NA	NA
AZA03875.1|4778849_4780163_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 13
CP033884	Escherichia coli strain 50579417 chromosome, complete genome	5206490	4785560	4799723	5206490		Salmonella_phage(22.22%)	17	NA	NA
AZA03883.1|4785560_4785968_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
AZA03884.1|4786136_4786292_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AZA03885.1|4786293_4786869_+	hypothetical protein	NA	NA	NA	NA	NA
AZA03886.1|4787355_4787544_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AZA03887.1|4787540_4787732_+	DUF1482 family protein	NA	NA	NA	NA	NA
AZA03888.1|4787825_4790297_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
AZA04467.1|4790384_4790621_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
AZA03889.1|4790655_4791936_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	3.9e-156
AZA03890.1|4791937_4792066_-	transporter	NA	NA	NA	NA	NA
AZA03891.1|4792123_4793143_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AZA03892.1|4793154_4794369_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AZA03893.1|4794574_4794901_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
AZA03894.1|4795035_4795377_+	DUF1283 family protein	NA	NA	NA	NA	NA
AZA03895.1|4795411_4795972_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AZA04468.1|4795974_4796685_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AZA03896.1|4796792_4797098_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AZA03897.1|4797296_4799723_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
>prophage 1
CP033882	Escherichia coli strain 50579417 plasmid p50579417_1, complete sequence	96948	0	95300	96948	lysis,head,holin,portal,tail,transposase,plate,terminase	Escherichia_phage(61.62%)	105	NA	NA
AYZ99477.1|269_635_+	ddrA	NA	A0A1B0V846	Salmonella_phage	98.3	9.3e-47
AYZ99478.1|647_3635_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	98.9	0.0e+00
AYZ99479.1|3624_3933_+	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	94.1	2.4e-48
AYZ99480.1|4136_4508_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ99481.1|4715_6071_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
AYZ99482.1|6319_6808_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	79.0	1.3e-64
AYZ99578.1|6977_7535_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
AYZ99483.1|7670_7838_+|holin	antiholin	holin	Q71TR5	Escherichia_phage	92.0	5.8e-20
AYZ99484.1|7798_8002_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ99485.1|7958_8417_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
AYZ99486.1|8531_9551_-|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
AYZ99487.1|9663_10794_+|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	84.5	9.2e-186
AYZ99488.1|10826_12548_-|portal	phage portal protein	portal	Q1MVN6	Enterobacteria_phage	99.5	0.0e+00
AYZ99489.1|12623_19391_+	helicase	NA	Q1MVN7	Enterobacteria_phage	98.8	0.0e+00
AYZ99490.1|19424_19865_+	peptide-binding protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
AYZ99491.1|19861_20110_+	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
AYZ99492.1|20146_21274_-	GTP pyrophosphokinase	NA	A0A1B0VBT5	Salmonella_phage	74.1	7.6e-156
AYZ99493.1|21376_22018_-	maturation control protein	NA	A0A077SK30	Escherichia_phage	96.7	1.2e-110
AYZ99494.1|22207_22768_-	recombinase	NA	Q5QBN4	Enterobacteria_phage	98.9	1.5e-99
AYZ99495.1|23014_23326_-	lysogeny establishment protein	NA	A0A077SK03	Escherichia_phage	100.0	1.0e-46
AYZ99496.1|23376_24408_-	recombinase	NA	Q71TG5	Escherichia_phage	100.0	9.9e-195
AYZ99497.1|24415_24637_-	creatininase	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
AYZ99498.1|25040_25154_+	peptidase	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
AYZ99499.1|25172_25268_+	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AYZ99500.1|25233_25443_+	c1 repressor inactivator	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
AYZ99501.1|25553_26405_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
AYZ99502.1|26437_27556_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	88.7	3.7e-179
AYZ99503.1|27552_27912_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	2.6e-25
AYZ99504.1|27880_28117_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ99505.1|28113_29598_-|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	99.8	4.3e-292
AYZ99506.1|29597_30791_-|terminase	terminase	terminase	A0A077SL59	Escherichia_phage	99.0	9.8e-178
AYZ99507.1|30876_31329_-	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
AYZ99508.1|31417_32461_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	99.4	1.7e-205
AYZ99509.1|32488_32668_-	PdcA protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
AYZ99510.1|32672_33053_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
AYZ99511.1|33052_33274_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AYZ99579.1|33456_35013_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.4e-104
AYZ99512.1|35009_36266_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AYZ99513.1|36387_39504_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	8.3e-27
AYZ99514.1|39769_40276_-	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	98.8	1.2e-92
AYZ99515.1|40348_41611_-	hypothetical protein	NA	Q1MVG4	Enterobacteria_phage	99.8	2.7e-234
AYZ99516.1|41612_41831_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AYZ99517.1|41912_42614_-	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	99.6	1.3e-142
AYZ99518.1|42610_43288_-	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
AYZ99519.1|43284_43911_-	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	99.5	2.3e-122
AYZ99520.1|43808_44471_-	norphogenetic protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
AYZ99521.1|44412_44568_-	norphogenetic protein	NA	A0A077SK20	Escherichia_phage	100.0	1.2e-19
AYZ99522.1|44634_45213_-	VRR-NUC domain-containing protein	NA	A0A077SLK0	Escherichia_phage	96.9	2.0e-104
AYZ99523.1|45215_45461_-	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
AYZ99524.1|45607_45985_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
AYZ99525.1|45994_47212_+|tail	phage tail protein	tail	A0A077SL53	Escherichia_phage	99.8	1.9e-224
AYZ99526.1|47215_47944_+|tail	phage tail protein	tail	A0A077SK19	Escherichia_phage	100.0	9.3e-139
AYZ99527.1|47930_48716_+|plate	baseplate	plate	A0A1B0V7N6	Salmonella_phage	99.2	7.9e-144
AYZ99528.1|48717_49734_+|tail	phage tail tape measure protein	tail	Q1MVH7	Enterobacteria_phage	100.0	3.5e-192
AYZ99529.1|49726_50359_+|plate	baseplate protein	plate	A0A077SK50	Escherichia_phage	100.0	6.9e-90
AYZ99530.1|50405_51404_-	hypothetical protein	NA	A0A1B0VCH7	Salmonella_phage	97.6	3.4e-192
AYZ99531.1|51403_52768_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	100.0	2.1e-253
AYZ99532.1|52758_52974_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ99533.1|53240_53405_-	DUF3927 domain-containing protein	NA	Q71T96	Escherichia_phage	100.0	7.6e-17
AYZ99534.1|53404_53830_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	100.0	1.8e-70
AYZ99535.1|54021_54213_+	hypothetical protein	NA	Q71T98	Escherichia_phage	100.0	6.0e-29
AYZ99536.1|55387_57652_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	68.5	0.0e+00
AYZ99537.1|57648_58554_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
AYZ99538.1|58546_58831_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
AYZ99539.1|59105_59285_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	100.0	3.1e-27
AYZ99540.1|59293_60082_+	hypothetical protein	NA	Q71TL4	Escherichia_phage	100.0	1.0e-119
AYZ99541.1|60121_60544_+	ppfA	NA	Q71TL5	Escherichia_phage	100.0	5.0e-60
AYZ99542.1|60719_61112_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
AYZ99543.1|61447_62332_+	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
AYZ99544.1|62624_63434_+	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.8	7.1e-156
AYZ99545.1|63602_64799_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AYZ99546.1|64815_65817_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
AYZ99547.1|66043_67750_+	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	94.4	4.7e-311
AYZ99548.1|67810_69400_+	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.9	2.9e-302
AYZ99549.1|69409_70225_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	2.6e-113
AYZ99550.1|70260_70842_+	hypothetical protein	NA	A0A077SL48	Escherichia_phage	100.0	4.5e-104
AYZ99551.1|70853_71363_+|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
AYZ99552.1|71534_72131_+	hypothetical protein	NA	A0A077SLI4	Escherichia_phage	99.5	5.3e-108
AYZ99580.1|72313_72559_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
AYZ99553.1|72609_73455_-	Replication protein repL	NA	Q1MVK3	Enterobacteria_phage	98.2	9.4e-151
AYZ99554.1|73484_74285_-	DNA-binding protein	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
AYZ99555.1|74449_75493_-	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	97.7	1.9e-185
AYZ99581.1|75489_75711_-	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	100.0	1.3e-38
AYZ99556.1|76291_76609_+	hypothetical protein	NA	Q71TC5	Escherichia_phage	100.0	2.9e-28
AYZ99557.1|76616_77396_+	hypothetical protein	NA	Q71TC6	Escherichia_phage	96.1	9.3e-145
AYZ99558.1|77643_78210_+	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	99.5	1.1e-99
AYZ99559.1|78220_78832_+|tail	phage tail protein	tail	Q71TN8	Escherichia_phage	99.5	2.9e-109
AYZ99560.1|78846_79728_+	morphogenetic protein	NA	Q71TC9	Escherichia_phage	98.6	2.7e-172
AYZ99561.1|79809_83505_+	lytic transglycosylase domain-containing protein	NA	A0A1B0VDM8	Salmonella_phage	85.8	0.0e+00
AYZ99562.1|83504_83861_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
AYZ99563.1|83857_85291_+	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	99.8	1.1e-271
AYZ99564.1|85290_86127_+|tail	phage tail protein	tail	A0A1B0V7F2	Salmonella_phage	100.0	1.4e-154
AYZ99565.1|86205_86640_+|tail	phage tail protein	tail	A0A077SLL3	Escherichia_phage	99.3	7.4e-75
AYZ99566.1|86651_89501_+|tail	phage tail protein	tail	A0A1B0V7G4	Salmonella_phage	44.7	2.8e-13
AYZ99567.1|89529_90015_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	50.6	5.8e-36
AYZ99568.1|90025_90523_+|tail	phage tail protein	tail	K7P7Q7	Enterobacteria_phage	57.3	2.9e-43
AYZ99569.1|90528_91140_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	78.6	3.6e-83
AYZ99570.1|91139_91598_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	57.4	1.4e-44
AYZ99571.1|91608_92085_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	59.4	2.4e-47
AYZ99572.1|92095_92524_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	69.3	1.4e-49
AYZ99573.1|92595_93168_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.0	4.4e-83
AYZ99574.1|93603_93867_+	hypothetical protein	NA	Q71TD9	Escherichia_phage	67.1	1.1e-22
AYZ99575.1|93941_94271_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
AYZ99576.1|94267_94711_+|lysis	lysis protein	lysis	A0A077SK09	Escherichia_phage	100.0	1.3e-82
AYZ99577.1|94697_95300_+	odaE	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
