The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	14315	68666	2250954	transposase	unidentified_phage(25.0%)	40	NA	NA
AZA26144.1|14315_15578_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA24437.1|15637_16795_-	hypothetical protein	NA	NA	NA	NA	NA
AZA24438.1|18733_19783_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
AZA24439.1|20300_21005_-	methyltransferase	NA	NA	NA	NA	NA
AZA24440.1|22038_23217_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA24441.1|24548_25583_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.9	1.8e-42
AZA24442.1|25680_26619_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	32.2	1.1e-17
AZA24443.1|27840_28479_+	spermidine/putrescine ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.6	1.0e-19
AZA24444.1|28475_29243_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AZA24445.1|29245_29491_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24446.1|29711_30866_-	lysin	NA	Q38317	Lactobacillus_phage	56.2	2.3e-59
AZA24447.1|31127_31649_+	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	31.4	2.3e-14
AZA26145.1|31830_33093_-|transposase	IS3 family transposase ISL6	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
AZA24448.1|33625_34459_+	pyridoxamine kinase	NA	NA	NA	NA	NA
AZA24449.1|34494_35052_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24450.1|35078_37844_-	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	31.2	1.4e-30
AZA24451.1|37992_38715_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24452.1|38910_40236_+|transposase	transposase	transposase	C1KFS0	Lactobacillus_virus	33.1	5.8e-46
AZA24453.1|40366_40567_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24454.1|40842_41322_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24455.1|41412_41841_+	transcriptional regulator	NA	NA	NA	NA	NA
AZA24456.1|41965_42811_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZA24457.1|42889_43078_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AZA24458.1|43544_44117_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24459.1|44272_44452_-	hypothetical protein	NA	NA	NA	NA	NA
AZA24460.1|50007_51057_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	4.7e-43
AZA24461.1|51633_52596_+	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
AZA24462.1|53731_54175_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	44.2	1.1e-25
AZA24463.1|54197_55376_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	53.3	7.3e-109
AZA26146.1|55337_55541_-	hypothetical protein	NA	NA	NA	NA	NA
AZA24464.1|56265_57030_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24465.1|57026_57809_+	hypothetical protein	NA	NA	NA	NA	NA
AZA26147.1|57869_59132_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
AZA24466.1|59321_59807_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AZA24467.1|60260_61310_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	1.1e-42
AZA26148.1|61793_62930_+|transposase	transposase	transposase	G3MB42	Bacillus_virus	35.1	7.4e-50
AZA26149.1|63348_64068_-	aquaporin family protein	NA	NA	NA	NA	NA
AZA24468.1|64233_65148_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZA24469.1|65326_66769_+	sucrose phosphorylase	NA	NA	NA	NA	NA
AZA24470.1|67487_68666_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	84308	149909	2250954	protease,transposase	Bacillus_phage(22.73%)	53	NA	NA
AZA26150.1|84308_85571_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA24484.1|85782_86691_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AZA24485.1|86809_87667_+	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	9.5e-50
AZA24486.1|87935_89159_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.0	7.9e-98
AZA24487.1|89624_91844_+	ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent	NA	A0A068F3I8	Mycobacterium_phage	34.2	5.3e-84
AZA24488.1|91950_93000_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
AZA24489.1|93162_93690_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24490.1|93691_94240_+	ECF transporter S component	NA	NA	NA	NA	NA
AZA24491.1|94232_94796_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AZA26151.1|94867_96130_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.3	6.1e-29
AZA24492.1|96515_97517_-	D-2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	35.2	2.5e-49
AZA24493.1|97806_99162_-	FAD-binding protein	NA	NA	NA	NA	NA
AZA24494.1|99570_100002_+	peptide deformylase	NA	NA	NA	NA	NA
AZA24495.1|100046_100577_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA24496.1|100566_101046_-	S-ribosylhomocysteinase	NA	NA	NA	NA	NA
AZA26152.1|101456_101579_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZA24497.1|102040_103636_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZA24498.1|103798_105376_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	7.2e-11
AZA24499.1|105963_107331_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	28.8	1.2e-30
AZA24500.1|107450_108359_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA26153.1|108542_109805_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA24501.1|110059_110761_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24502.1|110841_112749_+	DNA mismatch repair protein MutS	NA	F2QAG1	Chrysochromulina_ericina_virus	30.1	4.3e-18
AZA24503.1|112899_113949_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
AZA24504.1|115247_116615_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	28.8	1.2e-30
AZA24505.1|116779_117904_+	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	A0A218MNE0	uncultured_virus	38.9	1.1e-66
AZA24506.1|118070_119009_+	glucokinase	NA	NA	NA	NA	NA
AZA24507.1|119060_119984_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AZA24508.1|120598_121825_-	MFS transporter	NA	NA	NA	NA	NA
AZA24509.1|122146_122302_+	fumarate reductase flavoprotein subunit	NA	NA	NA	NA	NA
AZA24510.1|122445_123366_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA24511.1|123550_124036_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AZA24512.1|124673_125375_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24513.1|125408_125588_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24514.1|125669_127075_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.7	1.1e-42
AZA24515.1|127206_128139_+	quinate/shikimate dehydrogenase	NA	NA	NA	NA	NA
AZA24516.1|128183_129110_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	40.7	6.0e-58
AZA24517.1|131179_131647_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24518.1|131940_132990_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
AZA24519.1|133016_133178_+	bacitracin ABC transporter	NA	NA	NA	NA	NA
AZA24520.1|133338_135462_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24521.1|135495_136071_-	hypothetical protein	NA	NA	NA	NA	NA
AZA24522.1|136228_136528_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24523.1|137801_138053_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24524.1|138395_139724_+	HNH endonuclease	NA	Q331Y3	Clostridium_botulinum_C_phage	37.7	7.3e-57
AZA24525.1|140790_141615_-	glycosyl transferase	NA	NA	NA	NA	NA
AZA24526.1|141642_142419_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZA24527.1|142679_143408_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.5	3.4e-40
AZA24528.1|143454_145350_+	cell wall metabolism sensor histidine kinase WalK	NA	A0A1V0SGX0	Hokovirus	23.1	7.1e-21
AZA24529.1|145339_146914_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24530.1|146914_147715_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24531.1|147733_148531_+	MBL fold hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	32.0	2.5e-28
AZA24532.1|148625_149909_+|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.5	2.0e-19
>prophage 3
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	153122	194963	2250954	protease,transposase	unidentified_phage(20.0%)	42	NA	NA
AZA26154.1|153122_154385_-|transposase	IS3 family transposase ISL6	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
AZA24537.1|154596_155775_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA24538.1|156530_156713_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24539.1|156884_157226_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24540.1|157290_157656_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
AZA24541.1|157790_158459_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AZA24542.1|158468_159824_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.2	1.5e-09
AZA24543.1|160123_161599_+	MFS transporter	NA	NA	NA	NA	NA
AZA24544.1|162562_163381_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA24545.1|163438_163651_-	hypothetical protein	NA	NA	NA	NA	NA
AZA24546.1|163664_164279_-	hypothetical protein	NA	NA	NA	NA	NA
AZA24547.1|164351_164705_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24548.1|164841_165741_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AZA24549.1|165757_166312_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	32.0	7.8e-13
AZA24550.1|166469_167627_-	cation transporter	NA	NA	NA	NA	NA
AZA24551.1|168219_168354_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24552.1|168475_169387_+	HNH endonuclease	NA	NA	NA	NA	NA
AZA24553.1|169616_170744_+	LysM peptidoglycan-binding domain-containing protein	NA	D2KRB9	Lactobacillus_phage	44.0	6.7e-19
AZA24554.1|171449_172211_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	5.3e-28
AZA24555.1|172214_173798_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA24556.1|174267_175317_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
AZA24557.1|175440_176067_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AZA24558.1|176149_176521_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AZA24559.1|176507_177206_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
AZA24560.1|177433_177913_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24561.1|177964_179428_-	cardiolipin synthase	NA	NA	NA	NA	NA
AZA24562.1|179429_180374_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZA24563.1|180446_181214_+	ribonuclease	NA	A0A1L6Z550	Klebsiella_phage	35.3	1.1e-17
AZA24564.1|181301_182258_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
AZA26155.1|182605_183442_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AZA24565.1|183425_184085_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZA26156.1|184187_185180_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	31.9	9.7e-38
AZA24566.1|185310_186360_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	4.7e-43
AZA24567.1|186595_187276_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZA24568.1|187286_188120_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24569.1|188159_188810_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AZA24570.1|189004_189625_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AZA24571.1|189630_190143_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZA24572.1|191582_192926_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	30.1	2.2e-48
AZA24573.1|192882_193116_-	hypothetical protein	NA	NA	NA	NA	NA
AZA24574.1|193566_193866_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24575.1|193760_194963_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	233244	294765	2250954	tRNA,integrase,transposase	Streptococcus_phage(26.67%)	40	232058:232117	271124:273550
232058:232117	attL	TTGATATGACCCCCGAAATTAGGACACTAATTTCGGGGGTTATTTTCATGACTAAATACA	NA	NA	NA	NA
AZA24606.1|233244_234423_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA24607.1|234956_236159_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA24608.1|236053_236353_-	hypothetical protein	NA	NA	NA	NA	NA
AZA24609.1|236703_238725_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.1	3.4e-66
AZA26157.1|238875_239250_-	hypothetical protein	NA	NA	NA	NA	NA
AZA24610.1|239405_240353_-	hypothetical protein	NA	NA	NA	NA	NA
AZA24611.1|240524_241772_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	36.2	4.3e-59
AZA24612.1|241874_242855_-	hypothetical protein	NA	A0A1W6JPS3	Staphylococcus_phage	47.1	1.6e-08
AZA24613.1|243094_243289_+	DNA-binding protein	NA	NA	NA	NA	NA
AZA24614.1|243279_243570_+	DNA-binding protein	NA	NA	NA	NA	NA
AZA24615.1|243774_244089_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24616.1|244088_244952_+	hypothetical protein	NA	A0A2H4JEH3	uncultured_Caudovirales_phage	24.8	5.7e-10
AZA24617.1|244948_246466_+	hypothetical protein	NA	I1TLI2	Bacillus_phage	35.0	1.7e-54
AZA24618.1|247037_251765_+	helicase	NA	A0A2H4UTW8	Bodo_saltans_virus	28.1	8.1e-50
AZA26158.1|251809_253072_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA24619.1|254706_255672_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AZA24620.1|255717_256467_-	hypothetical protein	NA	NA	NA	NA	NA
AZA24621.1|256630_257320_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AZA24622.1|257571_258855_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AZA24623.1|258857_259475_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24624.1|259553_262556_+	glucan modification protein	NA	NA	NA	NA	NA
AZA24625.1|262876_263983_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	46.0	5.1e-88
AZA24626.1|265494_266760_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.9	5.1e-84
AZA24627.1|268083_268797_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24628.1|268817_269996_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA24629.1|271370_272558_+	amidohydrolase	NA	NA	NA	NA	NA
AZA24630.1|272896_274301_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.7	2.4e-42
271124:273550	attR	TGTATTTAGTCATGAAAATAACCCCCGAAATTAGTGTCCTAATTTCGGGGGTCATATCAAAAGGGAGTCCCTTTTTTTATACCCAATTGGAATTTAGTTTAAGGAACTGTTCATCCTTACACATAAAATTATACAGTTCCATTTATTGGCATCGTAATTGTAGGTTTGCCAATATTTTATGTAGTAAAACGAATGGACAGAAAAAGATTGAAATAATATAGTTGATAAACATAATGGTGGATTTGTTATGAATGCAAATTTTGAAACAAAATTAATGCAGCTTTTAGATCAAAACAAAGATGAGATTATTAAAATTCGTCGTTATCTACACGAGCATCCAGAGTTATCTTTTCATGAGAAAAAGACGTCTGAATTCATCGAAAATTACTATCGTGATTTGGATTGCCAGGTGCGCCATTGTGGAGATGACTATGGCATTGTAGTAGATATTAATCCAGATAAGCCGGGTAAAAAATTAGCTTGGCGTGCTGACTTTGATGCATTGCCAATTCAAGAAAACAACGAATTGCCTTTTAAATCTCAAAATCCCGGTGTCATGCATGCGTGCGGTCATGATGGTCATTCTGCCTATCTTTTGGTATTAGGCAAATGCTTAATTCAATTAAAAGATCAAATTAATGGAAGCATTCGCTTAATTCATCAGCCAGCTGAGGAAGTTGCCCCAGGCGGAGCTTTATCGATGATTAAAGACGGAGCGCTAGATGGTGTTGACGATGTGATCGGTATTCACGTAATGAGCACGATGCCAACGGGAACGGTTCAGCTTCATGCAGGAGCAACGCAGACCGGACGTGCAAATTTTGATCTGACTTTTACTGGTAAAGGTGGTCATGCTTCAATGCCAGAACTTAGCAATGATGCAATTGTGGCTGGATCTTATTTTGTCACTCAGCTGCAAACCGTTGTTTCTAGAAGGTTAAATCCATTTGATGTTGGCAGCGTAACTATTGGCTCATTTGATGGGGCAGGTAGCTATAATGCCATCCAAGGACAGGTAAAACTTAAGGGCGATGTCCGGCTGATAAATGAAGCTACTCGTAAATTAATGAAGAAAAATATTAAACAAATCATCAAGGGAACCGATGTAACTTTCGGCGTTAAATCTGAACTTAATTATGACGATAATTATCCAGTTTTAGTTAACAATCAAGATTTGACTAAAAAAGTAGAAAATTGGATTAAAGAGAGTAAAATTCCTGAAGTTACTGCTGTAAAGGATAGCGGAGTAGTAAATGCTTCGGAGGATTTTGCCTACTATGCTCAGAAGAAGCCAGCTTGTTTCTTTTATGTTGGGTGTCAGCCTGAAGATGGCGGAATATATCCGCATCACAGTCCTAAATTCATGATGAATGAAGATTGTTTAATCATTTGTGCTAGAAGTGCGGCTAGTGTAATCAGTCATTATTTTGCTTAAATAAAAAAGCATTTGACAATTTTCTGGGATAGCTTTATTGTTAATAATAAATTAAAAAATTAAAAGCAGAGTAATTATCGCTTAATTGTTACAGAGAATTATTGGTTGGTGAGAGATAAGCAATTGAAGGTAATGAAGATGGGCTTGGATATCAGTATTAGCGATAAGTAGCTAACAACGGCGTTGTGAACCGTTAGCTGTCACAAACTATGTTGGTAGTTAATAAGATTCATTGCGCGAGTAATGGATAAATTAAAGGTGGTAACGCGAAGCACTCGTCCTTTTGAAGTGCCCTACAATTGTTAGACATAGACATCTAACGATTGTGGGGTATTTTTATGACCAAATATTCATCTGAACTAAAAGTACAAATTGCTTCTGATTATCTTTACGGCAGAGACTCATACAATGGATTAAGCCAAAAGTATAATATCGCTGCGTCAATAATTCGTACGTGGGTGAAAGCCGCTGAACTTAATGGATTGGAAAGCTTAAAAGTTAAGCGAACCAAAAGAGAATATTCTGTTGACTTTAAACTGGATGTGGTAAGCTACTATCTAAAATCCGATGTAGGACGTAATCTGGTAGCTGCTAAATTCAATATTAGTCCGTCACAAGTGTATTCATGGACTAAGAAGTTCCAGCGAGGCGGTCCAGATGCGCTCCTTCCTGTCAAGAAAGGTAGACCCGCTAAAATGCCTAAGAAGACCGAGAAAGCCGAGCGTAATAAGCAAATAGGTACTCTAACTGATAAGCAGAAATATGAGGCCAAAATTCTGGAAAAGGATGCCAGAATCAAAGAATTAGAATTGGAGCTCATCATCGCAAAAAAAGTGGCCGCCCGGTATCCACGCTATCCAATCGACAAAAGACACAGATAACTTGTGATATCCGGGCAGACCACCCAGAATTTCAGTTAAAACAGTTGTTTAAAGCTCTTAATCTCAATCGTAAGACTTATTACGACAACCTTAAAAGAATCGCTAAGAAGG	NA	NA	NA	NA
AZA24631.1|274589_274772_+	cytochrome C551	NA	NA	NA	NA	NA
AZA24632.1|274978_276085_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	46.0	5.1e-88
AZA24633.1|276500_277550_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
AZA24634.1|277748_278048_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24635.1|277942_279145_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA24636.1|279734_279905_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA24637.1|280072_280723_+	HD domain-containing protein	NA	S4W232	Pandoravirus	25.7	1.2e-07
AZA24638.1|282390_283674_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.3	2.9e-58
AZA24639.1|287030_288659_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA24640.1|288816_289866_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
AZA24641.1|290140_291769_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA24642.1|291942_292155_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24643.1|293586_294765_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 5
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	322503	373940	2250954	tRNA,bacteriocin,transposase,protease	Bacillus_phage(23.53%)	42	NA	NA
AZA26159.1|322503_323766_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.8	1.0e-55
AZA24664.1|323966_325439_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AZA24665.1|325595_326438_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZA24666.1|327338_328388_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
AZA24667.1|329836_330208_-	toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CZV4	Paenibacillus_phage	45.6	8.9e-21
AZA24668.1|331768_332581_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA24669.1|332632_333382_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	38.4	3.9e-31
AZA26160.1|333378_334089_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZA24670.1|334509_335274_+	phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	52.2	1.5e-43
AZA24671.1|335353_336616_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
AZA26161.1|336717_337980_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA24672.1|338170_339136_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AZA24673.1|339296_340691_-	amino acid permease	NA	NA	NA	NA	NA
AZA24674.1|340768_341701_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AZA24675.1|341756_342218_+|tRNA	prolyl-tRNA editing protein	tRNA	NA	NA	NA	NA
AZA24676.1|342578_343025_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZA24677.1|343006_344029_+	asparaginase	NA	NA	NA	NA	NA
AZA26162.1|344212_344968_+	hydrolase Cof	NA	NA	NA	NA	NA
AZA24678.1|345053_345530_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
AZA24679.1|345609_347043_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.3	1.5e-103
AZA24680.1|347111_347666_-	isochorismatase	NA	G3MA16	Bacillus_virus	39.1	8.9e-33
AZA24681.1|347918_348776_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24682.1|348768_349035_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
AZA24683.1|349131_349902_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AZA24684.1|350059_350251_+	hypothetical protein	NA	NA	NA	NA	NA
AZA26163.1|351713_353060_+	histidine kinase	NA	NA	NA	NA	NA
AZA24685.1|353052_353829_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AZA24686.1|354199_355249_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
AZA24687.1|355431_355719_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZA24688.1|355905_356157_+	hypothetical protein	NA	NA	NA	NA	NA
AZA26164.1|356226_357489_-|transposase	IS3 family transposase ISL6	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
AZA24689.1|358310_359360_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
AZA24690.1|359660_360320_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	48.3	7.1e-45
AZA24691.1|360291_361842_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA24692.1|363088_363799_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.7	9.7e-16
AZA24693.1|364217_364886_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZA24694.1|365207_366233_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AZA26165.1|366237_366717_+	competence protein ComE	NA	A7KUY9	Bacillus_phage	55.5	5.3e-34
AZA24695.1|366697_367312_+	methanol dehydrogenase	NA	NA	NA	NA	NA
AZA24696.1|367669_370360_+	magnesium-translocating P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	25.1	4.3e-40
AZA26166.1|370550_371813_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA24697.1|371957_373940_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	37.0	1.9e-93
>prophage 6
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	446439	571905	2250954	tRNA,transposase	Bacillus_phage(26.67%)	107	NA	NA
AZA24772.1|446439_447228_+|tRNA	tRNA pseudouridine synthase A	tRNA	NA	NA	NA	NA
AZA24773.1|447333_447777_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AZA24774.1|447789_448185_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AZA24775.1|448494_449673_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA24776.1|449863_450058_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24777.1|450273_450573_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24778.1|452717_453341_+	ADP-ribose pyrophosphatase	NA	NA	NA	NA	NA
AZA24779.1|454671_455163_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AZA26171.1|455947_457129_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AZA24780.1|457115_458171_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24781.1|458766_459816_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	1.1e-42
AZA26172.1|459937_461551_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA24782.1|461722_462835_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24783.1|462849_463917_+	hypothetical protein	NA	NA	NA	NA	NA
AZA26173.1|463983_464685_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZA24784.1|464847_465987_+	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
AZA24785.1|465990_467418_+	flippase	NA	NA	NA	NA	NA
AZA24786.1|467468_468203_+	glycosyltransferase	NA	NA	NA	NA	NA
AZA24787.1|468202_469303_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
AZA24788.1|469299_470001_+	glycosyl transferase	NA	A0A1V0SL98	Klosneuvirus	29.2	4.8e-07
AZA24789.1|470105_470936_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.9	5.2e-69
AZA24790.1|471141_473808_+	calcium-translocating P-type ATPase, PMCA-type	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	28.8	9.2e-75
AZA24791.1|473964_474162_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24792.1|474363_474834_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24793.1|474851_475370_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.6	3.3e-13
AZA26174.1|475409_475871_+	SprT family protein	NA	NA	NA	NA	NA
AZA24794.1|476104_476728_+	ECF transporter S component	NA	NA	NA	NA	NA
AZA24795.1|476741_477395_+	N-acetylmuramidase	NA	S5M633	Brevibacillus_phage	48.0	1.3e-27
AZA24796.1|477580_478240_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	47.7	9.2e-45
AZA24797.1|480144_482406_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.3	1.9e-126
AZA24798.1|482416_484432_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.7	1.6e-100
AZA24799.1|484428_485574_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
AZA24800.1|485585_485891_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
AZA24801.1|485890_487333_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A	tRNA	NA	NA	NA	NA
AZA24802.1|487338_488769_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit B	tRNA	NA	NA	NA	NA
AZA24803.1|488804_489731_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	25.9	1.4e-14
AZA24804.1|489791_490505_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
AZA24805.1|490507_491863_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	48.1	4.4e-110
AZA24806.1|492045_492903_+	Mrr restriction system protein	NA	NA	NA	NA	NA
AZA24807.1|493020_494070_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
AZA24808.1|494434_495070_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
AZA24809.1|496586_498512_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.9	2.4e-93
AZA24810.1|498690_499740_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
AZA24811.1|501107_501674_+	nodulation protein L	NA	NA	NA	NA	NA
AZA24812.1|501763_502024_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
AZA24813.1|501980_502337_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
AZA24814.1|502463_502949_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AZA24815.1|503157_504969_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	37.2	3.4e-89
AZA26175.1|505187_506450_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA26176.1|506538_509268_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AZA26177.1|509433_510696_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA24816.1|511122_512745_+	ABC-F family ATPase	NA	A0A2K9L3Z8	Tupanvirus	25.5	1.9e-46
AZA24817.1|512804_512927_-	alpha-ketoglutarate permease	NA	NA	NA	NA	NA
AZA24818.1|513088_513454_-	hypothetical protein	NA	NA	NA	NA	NA
AZA24819.1|513696_514896_-	multidrug transporter subunit MdtG	NA	NA	NA	NA	NA
AZA24820.1|515034_515748_-	hypothetical protein	NA	NA	NA	NA	NA
AZA24821.1|516014_516800_+	glutamate racemase	NA	NA	NA	NA	NA
AZA24822.1|516877_518299_+	dipeptidase	NA	NA	NA	NA	NA
AZA24823.1|518312_519398_+	M42 family peptidase	NA	NA	NA	NA	NA
AZA24824.1|519605_520175_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24825.1|520504_521131_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	42.8	7.2e-39
AZA24826.1|521130_521787_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.7	9.9e-39
AZA24827.1|522329_523070_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.7	1.1e-33
AZA24828.1|523091_523931_+	glutamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA24829.1|523930_524572_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZA24830.1|524583_525252_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZA24831.1|525293_526139_+	glutamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA24832.1|526344_527856_+	HD domain-containing protein	NA	NA	NA	NA	NA
AZA24833.1|527859_530025_+	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
AZA24834.1|530033_531431_+	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
AZA24835.1|531427_532345_+	hypothetical protein	NA	NA	NA	NA	NA
AZA26178.1|532847_533117_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24836.1|533133_533379_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24837.1|533525_534023_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24838.1|534089_535010_+	ribokinase	NA	NA	NA	NA	NA
AZA24839.1|535025_535676_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AZA24840.1|535688_536381_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
AZA26179.1|536566_537829_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.0	1.7e-55
AZA24841.1|537947_538883_+	purine nucleosidase	NA	NA	NA	NA	NA
AZA24842.1|538891_539614_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZA24843.1|539995_542398_+	phosphoketolase family protein	NA	NA	NA	NA	NA
AZA24844.1|542535_542841_+	sortase	NA	NA	NA	NA	NA
AZA24845.1|542980_544327_+	hemolysin	NA	NA	NA	NA	NA
AZA24846.1|544435_545008_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.3	6.0e-08
AZA24847.1|545088_546381_-	amino acid permease	NA	NA	NA	NA	NA
AZA24848.1|546487_547174_+	1,4-beta-N-acetylmuramidase	NA	NA	NA	NA	NA
AZA24849.1|547170_548415_+	ATP-dependent helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	26.6	5.6e-35
AZA24850.1|548407_549727_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AZA24851.1|550888_552202_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AZA26180.1|552269_553532_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA24852.1|553743_554922_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA26181.1|556072_557335_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.2	1.4e-54
AZA26182.1|557525_557930_+	hypothetical protein	NA	NA	NA	NA	NA
AZA26183.1|557913_558180_-	hypothetical protein	NA	NA	NA	NA	NA
AZA24853.1|558161_559445_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.6	7.8e-64
AZA24854.1|559557_560808_+	aluminum resistance protein	NA	NA	NA	NA	NA
AZA24855.1|560880_562968_-	putative ornithine decarboxylase	NA	NA	NA	NA	NA
AZA24856.1|563007_563250_-	hypothetical protein	NA	NA	NA	NA	NA
AZA24857.1|563709_565164_+	amino acid permease	NA	NA	NA	NA	NA
AZA24858.1|565246_565441_-	hypothetical protein	NA	NA	NA	NA	NA
AZA24859.1|565542_566685_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	35.0	2.3e-27
AZA24860.1|566726_567206_-	GtrA family protein	NA	NA	NA	NA	NA
AZA24861.1|567198_567645_-	flavodoxin	NA	NA	NA	NA	NA
AZA24862.1|567791_568619_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AZA24863.1|568621_569536_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
AZA24864.1|569659_570574_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	49.2	8.2e-76
AZA26184.1|570642_571905_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
>prophage 7
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	582328	640679	2250954	protease,transposase,tRNA	Bacillus_phage(23.53%)	51	NA	NA
AZA24876.1|582328_584524_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.4	7.4e-123
AZA24877.1|584692_584893_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24878.1|584999_585266_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AZA24879.1|585265_586993_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AZA24880.1|587259_588255_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.5	1.1e-41
AZA24881.1|588421_588826_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AZA26185.1|588928_589678_+	adaptor protein MecA	NA	NA	NA	NA	NA
AZA26186.1|591372_591447_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24882.1|592300_592945_-	dithiol-disulfide isomerase	NA	NA	NA	NA	NA
AZA24883.1|593025_593628_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AZA24884.1|593731_594364_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
AZA24885.1|594360_595158_+	NAD kinase	NA	NA	NA	NA	NA
AZA24886.1|595172_596066_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.9	7.7e-10
AZA26187.1|596279_597542_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA24887.1|597613_597802_-	hypothetical protein	NA	NA	NA	NA	NA
AZA24888.1|597873_598701_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AZA24889.1|598859_599909_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
AZA24890.1|599978_600989_-	lactonase family protein	NA	NA	NA	NA	NA
AZA24891.1|601153_601534_+	PTS sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
AZA24892.1|601543_602734_+	AI-2E family transporter	NA	NA	NA	NA	NA
AZA24893.1|602730_603288_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
AZA24894.1|603318_603714_+	DUF1149 domain-containing protein	NA	NA	NA	NA	NA
AZA24895.1|603733_606100_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.5	1.1e-84
AZA24896.1|606105_607329_+	insulinase family protein	NA	NA	NA	NA	NA
AZA24897.1|607325_608579_+	insulinase family protein	NA	NA	NA	NA	NA
AZA24898.1|608575_609304_+	KR domain-containing protein	NA	NA	NA	NA	NA
AZA24899.1|609371_610514_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZA24900.1|610558_611122_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AZA26188.1|611187_612450_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA24901.1|612790_613900_+	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	61.2	5.6e-119
AZA26189.1|613971_615234_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA24902.1|615510_617154_+	ribonuclease Y	NA	NA	NA	NA	NA
AZA24903.1|617257_618457_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
AZA24904.1|618509_619169_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.5	2.0e-39
AZA24905.1|619212_620490_+	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	43.1	5.3e-81
AZA24906.1|620486_621173_+	ComF family protein	NA	NA	NA	NA	NA
AZA24907.1|621252_621810_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AZA24908.1|621969_624372_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AZA24909.1|624459_625575_+	peptide chain release factor 2	NA	NA	NA	NA	NA
AZA24910.1|625586_625889_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24911.1|625863_626823_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
AZA24912.1|626822_627656_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AZA24913.1|627661_628678_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZA24914.1|628749_629682_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	46.1	5.4e-75
AZA24915.1|629802_631845_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AZA24916.1|631834_634693_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	1.3e-305
AZA24917.1|634789_635332_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24918.1|637179_638058_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.9	1.3e-09
AZA24919.1|638067_639087_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	50.5	8.3e-85
AZA24920.1|639094_640027_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	34.2	1.8e-46
AZA24921.1|640094_640679_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	56.0	2.2e-53
>prophage 8
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	651687	761263	2250954	integrase,capsid,transposase,terminase,tRNA,holin	Lactobacillus_phage(51.72%)	118	678947:678964	729048:729065
AZA26192.1|651687_652950_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.2	8.5e-55
AZA24930.1|653381_653948_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZA24931.1|653904_654474_-	hypothetical protein	NA	NA	NA	NA	NA
AZA24932.1|654470_655355_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AZA24933.1|655515_656199_+	uracil-DNA glycosylase	NA	S4VYQ4	Pandoravirus	43.7	1.4e-43
AZA24934.1|656219_657209_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
AZA24935.1|657219_657705_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AZA24936.1|657780_658317_-	exonuclease	NA	NA	NA	NA	NA
AZA24937.1|658439_659333_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
AZA26193.1|659373_660462_+	spermidine/putrescine import ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	40.8	5.1e-32
AZA24938.1|660464_661277_+	spermidine/putrescine ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	25.0	2.8e-11
AZA24939.1|661273_662077_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
AZA24940.1|662073_663156_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA24941.1|663187_664027_+	TIGR00159 family protein	NA	NA	NA	NA	NA
AZA24942.1|664026_664977_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24943.1|665000_666353_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AZA24944.1|666485_667298_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AZA24945.1|667349_668324_+	serine hydrolase	NA	A0A1J0GRK9	Mycobacterium_phage	26.0	6.2e-05
AZA24946.1|668402_668846_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
AZA24947.1|668839_669214_+	copper-binding protein	NA	NA	NA	NA	NA
AZA24948.1|669213_671130_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.5	8.0e-89
AZA26194.1|673013_674276_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.2	8.5e-55
AZA24949.1|674392_674851_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AZA24950.1|674947_675604_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
AZA24951.1|675690_677322_-	APC family permease	NA	NA	NA	NA	NA
AZA24952.1|677581_678109_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AZA24953.1|678125_678974_+	patatin family protein	NA	NA	NA	NA	NA
678947:678964	attL	GGCCTTGAAGGAATTTTT	NA	NA	NA	NA
AZA24954.1|679059_679941_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA24955.1|680047_680569_+	VanZ family protein	NA	NA	NA	NA	NA
AZA24956.1|680651_681383_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZA24957.1|681542_682514_+	competence protein	NA	NA	NA	NA	NA
AZA24958.1|682485_683484_+	type II secretion system protein F	NA	NA	NA	NA	NA
AZA26195.1|683690_684953_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA24959.1|684952_685291_+	prepilin-type cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AZA24960.1|685287_685725_+	type II secretion system protein	NA	NA	NA	NA	NA
AZA24961.1|685714_685981_+	type II secretion system protein	NA	NA	NA	NA	NA
AZA24962.1|685949_686567_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24963.1|686708_687707_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZA24964.1|687740_688928_+	acetate kinase	NA	NA	NA	NA	NA
AZA24965.1|689422_690529_-|integrase	site-specific integrase	integrase	U3PCM7	Lactobacillus_phage	92.9	7.1e-199
AZA24966.1|690531_691065_-	hypothetical protein	NA	Q37954	Lactococcus_phage	93.9	7.9e-63
AZA24967.1|691079_691745_-	XRE family transcriptional regulator	NA	U3PIS7	Lactobacillus_phage	95.9	1.8e-120
AZA24968.1|691901_692096_+	XRE family transcriptional regulator	NA	U3PDM7	Lactobacillus_phage	96.9	1.9e-27
AZA24969.1|692130_692298_+	hypothetical protein	NA	Q14T69	Lactococcus_phage	80.0	2.9e-19
AZA24970.1|692512_692791_+	hypothetical protein	NA	U3PCN4	Lactobacillus_phage	64.1	9.0e-26
AZA24971.1|692754_694152_+	DEAD/DEAH box helicase	NA	U3PFS7	Lactobacillus_phage	93.1	1.6e-248
AZA24972.1|694151_694841_+	NTP-binding protein	NA	U3PIS9	Lactobacillus_phage	94.3	4.7e-124
AZA24973.1|694860_695430_+	hypothetical protein	NA	U3PDN3	Lactobacillus_phage	92.1	4.9e-95
AZA24974.1|695439_696234_+	DNA primase	NA	U3PBE3	Lactobacillus_phage	92.8	3.0e-138
AZA24975.1|696226_697546_+	hypothetical protein	NA	U3PCP1	Lactobacillus_phage	90.0	1.3e-231
AZA24976.1|697819_698239_+	hypothetical protein	NA	Q8SDG8	Lactococcus_phage	75.9	1.1e-32
AZA24977.1|698240_698879_+	methylase	NA	A0A0D3MJX8	Leuconostoc_phage	49.0	1.9e-50
AZA24978.1|698883_699216_+	hypothetical protein	NA	U3PDN9	Lactobacillus_phage	93.6	1.1e-54
AZA24979.1|699205_699469_+	hypothetical protein	NA	U3PBE5	Lactobacillus_phage	82.4	1.1e-38
AZA24980.1|699599_699839_+	hypothetical protein	NA	NA	NA	NA	NA
AZA24981.1|700132_700624_+	hypothetical protein	NA	U3PIU0	Lactobacillus_phage	84.2	8.3e-75
AZA26197.1|701191_701620_+|terminase	terminase small subunit	terminase	Q37950	Lactococcus_phage	95.1	2.7e-69
AZA26196.1|701609_702911_+|terminase	PBSX family phage terminase large subunit	terminase	U3PBE8	Lactobacillus_phage	95.8	1.4e-254
AZA24982.1|702921_704439_+|capsid	capsid protein	capsid	Q38341	Lactococcus_phage	95.4	1.4e-282
AZA24983.1|704441_705569_+|capsid	minor capsid protein	capsid	U3PFU0	Lactobacillus_phage	96.3	1.4e-205
AZA24984.1|705634_706171_+	hypothetical protein	NA	U3PIU5	Lactobacillus_phage	95.5	1.4e-78
AZA24985.1|706181_707045_+|capsid	capsid protein	capsid	U3PDP8	Lactobacillus_phage	97.6	6.4e-155
AZA24986.1|707044_707260_+	hypothetical protein	NA	U3PBF1	Lactobacillus_phage	78.9	2.0e-25
AZA24987.1|707234_707669_+	hypothetical protein	NA	U3PCQ2	Lactobacillus_phage	95.1	2.5e-70
AZA24988.1|707665_708022_+	hypothetical protein	NA	U3PFU5	Lactobacillus_phage	96.6	1.2e-62
AZA24989.1|708021_708363_+	hypothetical protein	NA	U3PIU9	Lactobacillus_phage	98.2	8.4e-58
AZA26198.1|708424_708766_+|capsid	minor capsid protein	capsid	U3PDQ2	Lactobacillus_phage	92.9	1.6e-56
AZA24990.1|708770_709262_+	hypothetical protein	NA	U3PBF6	Lactobacillus_phage	96.9	1.2e-73
AZA24991.1|709317_709761_+	hypothetical protein	NA	U3PCQ6	Lactobacillus_phage	92.5	1.7e-66
AZA24992.1|709735_710338_+	hypothetical protein	NA	U3PFU8	Lactobacillus_phage	91.0	7.3e-105
AZA26199.1|712633_713083_-	hypothetical protein	NA	A4L7R4	Lactococcus_phage	77.9	6.6e-10
AZA26200.1|713255_714338_+	hypothetical protein	NA	U3PIV2	Lactobacillus_phage	96.9	1.8e-199
AZA24993.1|714347_716237_+	hypothetical protein	NA	Q38353	Lactococcus_phage	94.6	0.0e+00
AZA24994.1|716236_718627_+	hypothetical protein	NA	Q38354	Lactococcus_phage	92.3	0.0e+00
AZA26201.1|720019_720319_+	hypothetical protein	NA	U3PCL7	Lactobacillus_phage	89.8	1.5e-39
AZA24995.1|720490_721666_+	hypothetical protein	NA	F8J1C9	Lactobacillus_phage	64.6	6.7e-163
AZA24996.1|721703_722009_+	hypothetical protein	NA	F8J1D0	Lactobacillus_phage	97.0	2.3e-46
AZA26202.1|722138_722867_+	hypothetical protein	NA	U3PIR7	Lactobacillus_phage	82.0	1.9e-54
AZA24997.1|722869_723187_+	hypothetical protein	NA	Q38357	Lactococcus_phage	80.6	3.0e-33
AZA24998.1|723173_723497_+|holin	phage holin	holin	U3PBD0	Lactobacillus_phage	90.7	1.8e-46
AZA24999.1|723486_724380_+	lysin	NA	Q38359	Lactococcus_phage	88.3	1.3e-137
AZA25000.1|724430_724625_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25001.1|724773_725103_+	hypothetical protein	NA	Q37936	Lactococcus_phage	93.6	5.6e-51
AZA25002.1|725877_726603_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	1.6e-34
AZA25003.1|726599_728165_+	two-component sensor histidine kinase	NA	Q6XLV6	Feldmannia_irregularis_virus	25.1	9.3e-11
AZA25004.1|728212_730435_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	43.2	1.7e-146
729048:729065	attR	AAAAATTCCTTCAAGGCC	NA	NA	NA	NA
AZA25005.1|730583_731210_+	VanZ family protein	NA	NA	NA	NA	NA
AZA25006.1|731286_732627_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AZA25007.1|734797_735802_+	penicillin-binding protein	NA	X2KYU1	Mycobacterium_phage	27.3	9.9e-06
AZA25008.1|735824_736076_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25009.1|736137_737493_-	DUF1727 domain-containing protein	NA	NA	NA	NA	NA
AZA25010.1|737633_738236_+	thymidine kinase	NA	C1KFH3	Lactobacillus_virus	49.7	2.2e-45
AZA25011.1|738259_739345_+	peptide chain release factor 1	NA	NA	NA	NA	NA
AZA25012.1|739337_740180_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AZA25013.1|740179_741175_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	38.0	7.2e-49
AZA26203.1|741370_742633_+|transposase	IS3 family transposase ISL6	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
AZA25014.1|742736_743366_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AZA25015.1|743475_744195_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
AZA25016.1|744213_744438_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
AZA25017.1|744491_744998_+	ATP synthase F0 subunit B	NA	NA	NA	NA	NA
AZA25018.1|744997_745540_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
AZA25019.1|745562_747074_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
AZA25020.1|747084_748047_+	ATP synthase subunit gamma	NA	NA	NA	NA	NA
AZA25021.1|748066_749506_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
AZA25022.1|749517_749958_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
AZA26204.1|750006_750237_+	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
AZA25023.1|750322_751312_+	rod shape-determining protein	NA	NA	NA	NA	NA
AZA25024.1|751314_751602_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
AZA25025.1|751614_751842_+	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
AZA25026.1|751866_753057_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
AZA25027.1|753128_753590_-	universal stress protein	NA	NA	NA	NA	NA
AZA25028.1|753647_753932_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25029.1|754283_755588_-	recombinase RarA	NA	A0A127AWE7	Bacillus_phage	51.4	5.8e-107
AZA25030.1|755584_756049_-	DUF1694 domain-containing protein	NA	NA	NA	NA	NA
AZA25031.1|756173_756785_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
AZA25032.1|757081_758800_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
AZA25033.1|758885_760043_+	cysteine desulfurase	NA	NA	NA	NA	NA
AZA25034.1|760045_761263_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
>prophage 9
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	783754	905846	2250954	tRNA,transposase,protease	Bacillus_phage(15.38%)	99	NA	NA
AZA25055.1|783754_786550_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	26.3	2.0e-80
AZA25056.1|786549_786759_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	37.5	7.8e-06
AZA25057.1|786774_787332_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AZA25058.1|787335_787554_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25059.1|787573_788272_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AZA25060.1|788271_789435_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	29.0	4.6e-31
AZA25061.1|789489_789831_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25062.1|789835_790963_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AZA25063.1|791062_791722_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AZA25064.1|791721_792375_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AZA26207.1|792388_794779_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.6	3.5e-57
AZA25065.1|794947_796297_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	51.8	7.0e-124
AZA25066.1|796550_797774_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.0	2.8e-95
AZA25067.1|798044_799724_-	ribonuclease J	NA	NA	NA	NA	NA
AZA25068.1|799713_799947_-	DUF1447 domain-containing protein	NA	NA	NA	NA	NA
AZA25069.1|800126_800681_-	peptide deformylase	NA	NA	NA	NA	NA
AZA25070.1|800902_802774_+	translational GTPase TypA	NA	NA	NA	NA	NA
AZA25071.1|802872_804075_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
AZA25072.1|804064_804406_+	DUF2129 domain-containing protein	NA	NA	NA	NA	NA
AZA25073.1|804402_804954_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AZA25074.1|804954_805449_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	40.5	6.1e-25
AZA25075.1|805438_806479_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
AZA25076.1|806607_807366_+	competence protein	NA	NA	NA	NA	NA
AZA26208.1|807367_809578_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
AZA25077.1|809608_810598_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AZA25078.1|810690_810942_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AZA25079.1|811145_811415_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
AZA25080.1|811616_813458_+	RNase J family beta-CASP ribonuclease	NA	NA	NA	NA	NA
AZA25081.1|813444_814272_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25082.1|814460_815651_+	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	28.9	3.6e-31
AZA25083.1|815833_817159_+	trigger factor	NA	NA	NA	NA	NA
AZA25084.1|817310_818564_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.8	1.1e-131
AZA25085.1|818553_819156_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AZA26209.1|819204_820812_-	beta-carotene 15,15'-monooxygenase	NA	NA	NA	NA	NA
AZA25086.1|821058_822108_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	8.1e-43
AZA25087.1|822465_823128_+	nitrobenzoate reductase	NA	NA	NA	NA	NA
AZA25088.1|823401_825051_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA25089.1|825109_825487_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25090.1|825914_827465_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA25091.1|828191_829559_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	28.8	3.2e-31
AZA25092.1|829797_831021_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.0	3.6e-95
AZA26210.1|831354_832617_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25093.1|832950_833250_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25094.1|833144_834347_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA25095.1|834630_835623_+	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.7	6.7e-39
AZA25096.1|835796_836753_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	59.6	1.5e-112
AZA25097.1|836766_837255_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	40.9	1.2e-25
AZA25098.1|837288_839697_+	ATPase P	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	25.0	3.3e-39
AZA26211.1|840095_840956_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA25099.1|840992_842048_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.2e-27
AZA25100.1|842044_842758_+	ABC transporter permease	NA	NA	NA	NA	NA
AZA26212.1|842947_844210_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25101.1|844389_845787_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.9	6.7e-53
AZA26213.1|845962_847225_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25102.1|854513_855692_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
AZA25103.1|855903_857109_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AZA25104.1|857232_858147_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA25105.1|858380_860078_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	33.7	2.0e-75
AZA26214.1|860351_861614_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25106.1|861700_863068_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
AZA25107.1|863275_863749_+	arginine repressor	NA	NA	NA	NA	NA
AZA25108.1|863760_864960_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.8	1.1e-46
AZA26215.1|865015_866278_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25109.1|866550_867525_+	amidohydrolase	NA	NA	NA	NA	NA
AZA25110.1|867526_868477_+	dihydrofolate reductase	NA	A0A1V0SBV6	Catovirus	30.7	8.4e-31
AZA25111.1|868550_870320_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.1	4.3e-81
AZA25112.1|870376_871315_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA25113.1|871587_873390_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
AZA25114.1|873458_874781_+	GTPase ObgE	NA	NA	NA	NA	NA
AZA25115.1|874917_876096_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA25116.1|876208_878152_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	28.6	3.1e-24
AZA25117.1|878188_879118_+	ribonuclease Z	NA	NA	NA	NA	NA
AZA25118.1|879128_879923_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZA25119.1|880037_880229_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
AZA26216.1|880411_881674_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25120.1|881758_883324_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AZA25121.1|883409_885311_+	ATP-dependent helicase	NA	D2J050	Enterococcus_phage	46.8	2.2e-107
AZA25122.1|885307_885499_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25123.1|885524_885776_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25124.1|885923_886487_+	TIGR01440 family protein	NA	NA	NA	NA	NA
AZA25125.1|886582_886981_+	transcriptional regulator	NA	NA	NA	NA	NA
AZA25126.1|887056_887830_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	56.4	1.1e-76
AZA25127.1|889113_890190_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	66.1	2.1e-126
AZA25128.1|890307_890508_-	DUF2929 domain-containing protein	NA	NA	NA	NA	NA
AZA25129.1|890642_894122_+	DNA polymerase III subunit alpha	NA	A0A0K1Y8F0	Streptomyces_phage	29.9	1.6e-103
AZA25130.1|894330_895290_+	6-phosphofructokinase	NA	NA	NA	NA	NA
AZA25131.1|895329_897099_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	35.7	2.1e-11
AZA25132.1|897942_898365_-	acyltransferase	NA	NA	NA	NA	NA
AZA25133.1|898555_899434_+	RNA-binding protein	NA	NA	NA	NA	NA
AZA25134.1|899426_900323_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.4	1.5e-37
AZA25135.1|900333_900687_+	reductase	NA	NA	NA	NA	NA
AZA25136.1|900676_901411_+	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.4	1.7e-10
AZA25137.1|901400_902003_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.3	6.3e-16
AZA25138.1|902002_902722_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AZA25139.1|902943_903690_+	ECF transporter S component	NA	NA	NA	NA	NA
AZA25140.1|903734_903917_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25141.1|903909_904257_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA25142.1|904312_904546_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25143.1|904502_905846_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	30.1	2.2e-48
>prophage 10
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	911872	972063	2250954	tRNA,transposase	unidentified_phage(22.22%)	47	NA	NA
AZA25150.1|911872_912922_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
AZA25151.1|913066_915928_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25152.1|916005_916941_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA25153.1|917204_918383_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA25154.1|918682_919588_+	transcriptional regulator	NA	NA	NA	NA	NA
AZA26217.1|919619_919904_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25155.1|919942_922369_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25156.1|922404_922824_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25157.1|923068_923974_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA25158.1|923992_924898_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA26218.1|925292_926555_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25159.1|926636_927815_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA25160.1|928301_929528_+	argininosuccinate synthase	NA	NA	NA	NA	NA
AZA25161.1|929563_930946_+	argininosuccinate lyase	NA	NA	NA	NA	NA
AZA25162.1|931198_931402_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25163.1|931741_931966_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25164.1|932419_932851_+	hypothetical protein	NA	A0A2P0ZL82	Lactobacillus_phage	33.6	4.4e-11
AZA25165.1|932784_934230_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25166.1|934430_935039_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AZA25167.1|935041_935710_+	DNA-binding response regulator	NA	A0A1J0GWE0	Alteromonas_phage	28.3	7.8e-07
AZA25168.1|935712_936972_+	sensor histidine kinase	NA	NA	NA	NA	NA
AZA25169.1|938825_939008_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25170.1|939000_939348_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA25171.1|939403_939637_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25172.1|941893_942628_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
AZA25173.1|942624_944499_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
AZA26219.1|944518_945373_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
AZA25174.1|945377_945821_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
AZA25175.1|945960_946215_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25176.1|946799_947849_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
AZA26220.1|948508_948799_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
AZA26221.1|949094_950357_+|transposase	IS3 family transposase ISL6	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
AZA25177.1|951403_952504_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
AZA25178.1|952506_953733_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
AZA25179.1|953736_954900_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
AZA25180.1|955063_956422_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25181.1|956478_956985_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AZA25182.1|957047_957992_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AZA25183.1|958132_960394_+	GTP pyrophosphokinase	NA	A0A1X9SH80	Bradyrhizobium_phage	34.9	5.7e-09
AZA25184.1|960422_960860_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AZA25185.1|961144_962431_+|tRNA	histidine--tRNA ligase	tRNA	A0A1V0SLE3	Klosneuvirus	26.8	1.1e-28
AZA25186.1|962446_964291_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AZA25187.1|964363_964879_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25188.1|965112_966888_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AZA25189.1|966963_968037_+	AI-2E family transporter	NA	NA	NA	NA	NA
AZA26222.1|969056_970319_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25190.1|970860_972063_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	992138	1045058	2250954	transposase	unidentified_phage(15.0%)	48	NA	NA
AZA26225.1|992138_993401_-|transposase	IS3 family transposase ISL6	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
AZA25205.1|993593_995186_-	asparagine synthase B	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	39.4	1.4e-99
AZA25206.1|997140_998424_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.3	2.2e-58
AZA25207.1|998903_1000523_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA25208.1|1000613_1000856_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25209.1|1001872_1003240_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
AZA26226.1|1003276_1003915_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25210.1|1004043_1004247_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25211.1|1004389_1005439_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
AZA25212.1|1005681_1006566_+	phosphate ABC transporter substrate-binding protein	NA	Q58MA7	Prochlorococcus_phage	24.5	1.8e-06
AZA25213.1|1006585_1007494_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AZA25214.1|1007496_1008372_+	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AZA26227.1|1008374_1009130_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	2.2e-18
AZA25215.1|1009148_1009787_+	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AZA25216.1|1009872_1010550_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.2	3.2e-32
AZA25217.1|1010549_1012208_+	ATPase	NA	W8CYF6	Bacillus_phage	34.6	8.6e-31
AZA25218.1|1012956_1013613_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AZA25219.1|1013922_1015345_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	41.5	1.8e-32
AZA25220.1|1015467_1016517_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.2e-41
AZA25221.1|1016678_1017230_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AZA26228.1|1018987_1020250_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.2	8.5e-55
AZA25222.1|1020275_1021019_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.9	2.4e-09
AZA25223.1|1021008_1021827_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	2.6e-12
AZA25224.1|1021805_1022582_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AZA25225.1|1022578_1023193_-	ECF transporter S component	NA	NA	NA	NA	NA
AZA25226.1|1023582_1024692_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AZA25227.1|1024979_1026008_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AZA25228.1|1026014_1026596_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25229.1|1026851_1027901_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	1.1e-42
AZA26229.1|1027948_1028770_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AZA25230.1|1029601_1030708_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	46.0	3.0e-88
AZA25231.1|1031785_1032136_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AZA25232.1|1032132_1033206_+	GTP cyclohydrolase I FolE	NA	A0A2I7S8W4	Vibrio_phage	40.7	3.2e-34
AZA25233.1|1033189_1034527_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AZA25234.1|1034516_1035608_+	dihydropteroate synthase	NA	NA	NA	NA	NA
AZA25235.1|1035619_1036156_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AZA25236.1|1036577_1036859_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25237.1|1037336_1037744_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AZA25238.1|1038118_1038778_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZA25239.1|1038758_1039433_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZA26230.1|1039442_1040183_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.4	3.8e-31
AZA25240.1|1040194_1041055_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA25241.1|1041315_1042683_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	28.8	1.2e-30
AZA25242.1|1042708_1042906_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZA25243.1|1042946_1043129_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25244.1|1043121_1043469_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA25245.1|1043524_1043758_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25246.1|1043714_1045058_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	30.1	6.3e-48
>prophage 12
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	1053429	1126645	2250954	tRNA,transposase	Bacillus_phage(31.25%)	57	NA	NA
AZA26231.1|1053429_1054692_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25254.1|1054899_1055925_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AZA25255.1|1055935_1057018_-	phosphomevalonate kinase	NA	NA	NA	NA	NA
AZA25256.1|1057095_1058055_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
AZA25257.1|1058110_1059022_-	mevalonate kinase	NA	NA	NA	NA	NA
AZA25258.1|1059155_1062695_+	ATP-dependent helicase	NA	NA	NA	NA	NA
AZA25259.1|1062721_1066405_+	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	26.2	2.4e-25
AZA25260.1|1066433_1069226_+	ATP-dependent DNA helicase	NA	A0A1X9I5C8	Streptococcus_phage	33.3	7.1e-62
AZA25261.1|1069285_1070548_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25262.1|1070746_1070929_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25263.1|1070921_1071269_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA25264.1|1071324_1071558_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25265.1|1071514_1072858_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	30.1	2.2e-48
AZA25266.1|1072991_1073459_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25267.1|1073520_1074819_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	28.6	2.1e-53
AZA25268.1|1074909_1075557_+	DnaD domain protein	NA	NA	NA	NA	NA
AZA25269.1|1075578_1076208_+	endonuclease III	NA	NA	NA	NA	NA
AZA26232.1|1076242_1077046_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AZA26233.1|1077224_1078487_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25270.1|1078542_1079028_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZA26234.1|1079021_1079444_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25271.1|1079580_1080615_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.9	1.8e-42
AZA25272.1|1080846_1081848_-	D-2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	33.8	2.3e-39
AZA25273.1|1081896_1083825_-	S9 family peptidase	NA	NA	NA	NA	NA
AZA25274.1|1083971_1086284_-	penicillin-binding protein	NA	NA	NA	NA	NA
AZA25275.1|1086270_1086903_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	36.9	9.5e-23
AZA25276.1|1087700_1088165_+	cell division regulator GpsB	NA	NA	NA	NA	NA
AZA25277.1|1089817_1091050_+	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
AZA25278.1|1091204_1091561_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25279.1|1091553_1093233_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
AZA25280.1|1093244_1093697_+	signal peptidase II	NA	NA	NA	NA	NA
AZA25281.1|1093698_1094613_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AZA25282.1|1094614_1095670_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
AZA25283.1|1095669_1098861_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AZA25284.1|1098955_1099237_+	ACT domain-containing protein	NA	NA	NA	NA	NA
AZA25285.1|1099236_1100580_+	PFL family protein	NA	NA	NA	NA	NA
AZA25286.1|1100646_1102338_-	DUF814 domain-containing protein	NA	Q84500	Paramecium_bursaria_Chlorella_virus	40.2	2.5e-09
AZA25287.1|1102654_1103536_+	DegV family protein	NA	NA	NA	NA	NA
AZA25288.1|1103591_1104662_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25289.1|1104810_1105860_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AZA25290.1|1105972_1106884_-	EamA family transporter	NA	NA	NA	NA	NA
AZA25291.1|1108278_1109361_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	44.9	4.2e-79
AZA25292.1|1109704_1110328_+	fructose-2,6-bisphosphatase	NA	NA	NA	NA	NA
AZA25293.1|1110910_1111429_-	nitroreductase	NA	NA	NA	NA	NA
AZA25294.1|1112661_1113840_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA25295.1|1114293_1114611_+	DNA invertase Pin	NA	NA	NA	NA	NA
AZA25296.1|1114736_1115528_+	peptide transporter	NA	E2ELL2	Clostridium_phage	25.7	1.0e-13
AZA25297.1|1115599_1115839_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25298.1|1115994_1117071_-	tyrosine recombinase XerS	NA	A0A0E3XA96	Gordonia_phage	29.6	1.6e-06
AZA25299.1|1117304_1118453_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.9	1.3e-41
AZA25300.1|1118594_1119764_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
AZA25301.1|1119787_1120366_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AZA25302.1|1121569_1122880_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA25303.1|1122857_1123511_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZA26235.1|1123930_1124638_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA25304.1|1125000_1125321_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AZA26236.1|1125382_1126645_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
>prophage 13
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	1155498	1279093	2250954	protease,integrase,transposase,tRNA	Bacillus_phage(20.0%)	100	1146664:1146723	1243400:1244863
1146664:1146723	attL	ATGCTAATTTCCCATAAATTACTACTCAAAGTACTCTATTACTTGATATATCAACCTTTT	NA	NA	NA	NA
AZA25331.1|1155498_1156140_-|integrase	integrase	integrase	A3F636	Streptococcus_phage	34.9	2.3e-24
1146664:1146723	attL	ATGCTAATTTCCCATAAATTACTACTCAAAGTACTCTATTACTTGATATATCAACCTTTT	NA	NA	NA	NA
AZA26237.1|1156470_1157733_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.8	1.0e-55
AZA25332.1|1157911_1158421_-	acetyltransferase	NA	NA	NA	NA	NA
AZA25333.1|1158433_1159135_-	prismane protein	NA	NA	NA	NA	NA
AZA25334.1|1159159_1159336_+	transcriptional regulator	NA	NA	NA	NA	NA
AZA25335.1|1159430_1160069_+	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AZA25336.1|1160120_1160597_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25337.1|1160509_1160800_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25338.1|1161616_1162126_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AZA25339.1|1162149_1162830_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AZA25340.1|1164718_1165024_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
AZA25341.1|1165023_1165938_-	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
AZA25342.1|1165941_1166985_-	type III-A CRISPR-associated RAMP protein Csm5	NA	NA	NA	NA	NA
AZA26238.1|1166987_1167866_-	type III-A CRISPR-associated RAMP protein Csm4	NA	NA	NA	NA	NA
AZA25343.1|1167888_1168557_-	type III-A CRISPR-associated RAMP protein Csm3	NA	NA	NA	NA	NA
AZA25344.1|1168560_1169052_-	type III-A CRISPR-associated protein Csm2	NA	NA	NA	NA	NA
AZA25345.1|1169054_1171391_-	type III-A CRISPR-associated protein Cas10/Csm1	NA	NA	NA	NA	NA
AZA25346.1|1171383_1172136_-	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
AZA25347.1|1174419_1175886_-	hypothetical protein	NA	NA	NA	NA	NA
1172932:1173105	attR	ATGCTAATTTCCCATAAATTACTACTCAAAGTACTCTATTACTTGATATATCAACCTTTTAGAGGATTTCGTTGAGTTTAAGTTACAACTCAAAAAATATTATCTTAAACTTCGAAAAAGGCCGTAATAGTAGGCTTTTTAGACATTGAGTTGTAAAATCCTGGGAAATTAGCA	NA	NA	NA	NA
AZA26239.1|1177666_1177702_-	hypothetical protein	NA	NA	NA	NA	NA
1172932:1173105	attR	ATGCTAATTTCCCATAAATTACTACTCAAAGTACTCTATTACTTGATATATCAACCTTTTAGAGGATTTCGTTGAGTTTAAGTTACAACTCAAAAAATATTATCTTAAACTTCGAAAAAGGCCGTAATAGTAGGCTTTTTAGACATTGAGTTGTAAAATCCTGGGAAATTAGCA	NA	NA	NA	NA
AZA25348.1|1178485_1178761_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZA25349.1|1178753_1179473_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AZA25350.1|1179554_1179761_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25351.1|1179880_1180108_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA25352.1|1180103_1180772_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA25353.1|1181278_1182457_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA25354.1|1186842_1187361_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26240.1|1187631_1187823_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25355.1|1187872_1188721_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AZA25356.1|1188765_1190190_-	RNA methyltransferase	NA	NA	NA	NA	NA
AZA25357.1|1190182_1191157_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25358.1|1191156_1191897_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZA25359.1|1192006_1192204_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25360.1|1192351_1192963_-	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
AZA25361.1|1193041_1193794_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZA25362.1|1194306_1195485_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA25363.1|1196310_1197741_-	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZA25364.1|1197841_1199362_-	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
AZA25365.1|1199365_1200289_-	glycine/betaine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	1.9e-27
AZA26241.1|1200902_1201322_+	3-beta hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
AZA26242.1|1201393_1202656_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA26243.1|1202845_1203976_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25366.1|1204043_1204277_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25367.1|1204631_1205885_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA25368.1|1206007_1207231_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.0	3.9e-97
AZA25369.1|1207899_1208949_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
AZA25370.1|1209096_1214871_-	peptidase S8	NA	A0A217EQY2	Bacillus_phage	31.2	2.9e-09
AZA25371.1|1215322_1215826_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZA25372.1|1215906_1216407_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25373.1|1216840_1217455_+	DedA family protein	NA	NA	NA	NA	NA
AZA25374.1|1217822_1218839_+	aspartate--ammonia ligase	NA	NA	NA	NA	NA
AZA25375.1|1218914_1220213_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	28.4	6.3e-53
AZA25376.1|1220278_1221286_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.9	2.6e-14
AZA25377.1|1221328_1224352_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	32.5	6.2e-136
AZA25378.1|1224355_1226239_-	lactose permease	NA	NA	NA	NA	NA
AZA25379.1|1226596_1227646_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	3.9e-45
AZA25380.1|1227849_1228686_+|integrase	integrase	integrase	NA	NA	NA	NA
AZA25381.1|1228729_1229296_+	signal peptidase I	NA	NA	NA	NA	NA
AZA25382.1|1229365_1229557_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25383.1|1230121_1231360_-	peptidase T	NA	NA	NA	NA	NA
AZA25384.1|1231403_1232201_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AZA25385.1|1232193_1232886_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZA25386.1|1233157_1234456_-|transposase	transposase	transposase	C1KFS0	Lactobacillus_virus	39.0	2.8e-69
AZA25387.1|1235174_1238060_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26244.1|1238275_1239538_+|transposase	IS3 family transposase ISL6	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
AZA25388.1|1239540_1241766_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26245.1|1242221_1243358_-|transposase	transposase	transposase	G3MB42	Bacillus_virus	35.1	2.8e-49
AZA26246.1|1243435_1244698_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25389.1|1245968_1247379_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.7	2.4e-42
AZA25390.1|1247590_1247836_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA25391.1|1247842_1247977_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA25392.1|1248078_1249215_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.8	3.6e-36
AZA25393.1|1249250_1250372_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	37.4	5.8e-39
AZA25394.1|1250413_1251532_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.7	4.1e-37
AZA25395.1|1251503_1253342_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.2	5.0e-56
AZA25396.1|1253373_1255440_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AZA25397.1|1255432_1256344_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AZA25398.1|1256609_1257359_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AZA25399.1|1257358_1258264_-	GTPase Era	NA	NA	NA	NA	NA
AZA25400.1|1258247_1258667_-	cytidine deaminase	NA	NA	NA	NA	NA
AZA25401.1|1258668_1259193_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
AZA25402.1|1259192_1260140_-	phosphate starvation-inducible protein PhoH	NA	H6X2N1	Pseudomonas_phage	48.4	5.2e-49
AZA25403.1|1260294_1260471_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AZA25404.1|1260639_1261497_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AZA25405.1|1261754_1262804_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
AZA25406.1|1262989_1263259_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25407.1|1263324_1264209_-	YitT family protein	NA	NA	NA	NA	NA
AZA25408.1|1265240_1266419_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA25409.1|1266655_1267879_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.0	9.6e-96
AZA25410.1|1268659_1269844_-	amino acid aminotransferase	NA	NA	NA	NA	NA
AZA25411.1|1270024_1271335_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
AZA25412.1|1271693_1272401_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25413.1|1272684_1272969_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25414.1|1272992_1273301_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25415.1|1273300_1273486_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25416.1|1273865_1274762_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
AZA25417.1|1274847_1276242_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IEP8	Erwinia_phage	27.8	4.0e-37
AZA25418.1|1276244_1276778_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AZA25419.1|1276886_1277774_-	tyrosine recombinase XerC	NA	A0A1P8DJJ6	Virus_Rctr41k	31.5	2.5e-21
AZA25420.1|1277773_1279093_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
>prophage 14
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	1285357	1418799	2250954	protease,tail,integrase,transposase,capsid,terminase,tRNA,holin,head	Lactobacillus_phage(57.35%)	114	1353272:1353331	1377141:1377220
AZA25427.1|1285357_1286560_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA25428.1|1286454_1286754_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25429.1|1286967_1287630_+	hemolysin III	NA	NA	NA	NA	NA
AZA26247.1|1287668_1288931_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25430.1|1289117_1290308_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	33.6	8.9e-46
AZA25431.1|1290381_1291281_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	40.5	1.3e-52
AZA25432.1|1291315_1291561_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26248.1|1291634_1291931_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25433.1|1292029_1292221_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25434.1|1292698_1294471_-	sugar ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	2.0e-49
AZA25435.1|1294467_1296210_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.2	1.7e-37
AZA25436.1|1296605_1297508_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA25437.1|1298248_1298788_-	hypothetical protein	NA	F8J1D7	Lactobacillus_phage	98.4	2.9e-60
AZA25438.1|1301499_1301850_-	hypothetical protein	NA	F8J1D4	Lactobacillus_phage	99.1	6.6e-58
AZA25439.1|1301851_1303033_-	lysin	NA	A9UJV4	Lactobacillus_phage	96.5	1.6e-217
AZA25440.1|1303013_1303367_-|holin	holin	holin	F8J1D3	Lactobacillus_phage	100.0	2.6e-54
AZA25441.1|1303370_1303694_-	hypothetical protein	NA	F8J1D2	Lactobacillus_phage	100.0	5.0e-52
AZA25442.1|1303714_1304137_-	hypothetical protein	NA	A9UJV1	Lactobacillus_phage	100.0	5.3e-78
AZA25443.1|1304096_1304294_-	XkdX family protein	NA	F8J1D1	Lactobacillus_phage	98.5	2.0e-27
AZA25444.1|1304290_1304599_-	hypothetical protein	NA	F8J1D0	Lactobacillus_phage	96.1	7.8e-47
AZA25445.1|1304636_1304918_-	hypothetical protein	NA	F8J1C9	Lactobacillus_phage	81.7	3.2e-39
AZA25446.1|1306217_1306436_-	hypothetical protein	NA	F8J1C7	Lactobacillus_phage	100.0	3.0e-32
AZA25447.1|1306515_1307949_-	hypothetical protein	NA	Q9AZD2	Lactobacillus_phage	79.5	1.6e-219
AZA25448.1|1307951_1310390_-	hypothetical protein	NA	F8J1C5	Lactobacillus_phage	94.6	0.0e+00
AZA25449.1|1310404_1312585_-	hypothetical protein	NA	F8J1C4	Lactobacillus_phage	90.3	0.0e+00
AZA25450.1|1312652_1318259_-|tail	phage tail tape measure protein	tail	F8J1C3	Lactobacillus_phage	94.5	0.0e+00
AZA25451.1|1318454_1318886_-	hypothetical protein	NA	F8J1C1	Lactobacillus_phage	97.2	1.4e-70
AZA25452.1|1319007_1319628_-|tail	phage tail protein	tail	F8J1C0	Lactobacillus_phage	95.6	1.7e-109
AZA25453.1|1319628_1320033_-	hypothetical protein	NA	F8J1B9	Lactobacillus_phage	92.2	6.4e-65
AZA25454.1|1320613_1320967_-|head,tail	head-tail adaptor protein	head,tail	F8J1B7	Lactobacillus_phage	100.0	1.6e-64
AZA25455.1|1320956_1321316_-	DNA-packaging protein	NA	F8J1B6	Lactobacillus_phage	100.0	1.3e-61
AZA25456.1|1321541_1322714_-|capsid	phage major capsid protein	capsid	F8J1B4	Lactobacillus_phage	99.7	6.4e-214
AZA25457.1|1322726_1323458_-|protease	Clp protease ClpP	protease	F8J1B3	Lactobacillus_phage	96.3	1.5e-125
AZA25458.1|1324750_1326091_-|terminase	terminase large subunit	terminase	F8J1B1	Lactobacillus_phage	99.3	2.6e-256
AZA26249.1|1326296_1326731_-|terminase	terminase	terminase	F8J1B1	Lactobacillus_phage	94.3	1.1e-75
AZA25459.1|1326779_1327178_-	HNH endonuclease	NA	F8J1B0	Lactobacillus_phage	97.7	3.5e-71
AZA25460.1|1327155_1327662_-|terminase	phage terminase small subunit P27 family	terminase	F8J1A9	Lactobacillus_phage	98.8	2.7e-84
AZA25461.1|1327731_1327920_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25462.1|1330206_1330653_-	transcriptional regulator	NA	F8J1G8	Lactobacillus_phage	98.6	2.7e-80
AZA25463.1|1330684_1330900_-	hypothetical protein	NA	F8J1G7	Lactobacillus_phage	100.0	1.3e-35
AZA25464.1|1330889_1331429_-	hypothetical protein	NA	F8J1G6	Lactobacillus_phage	98.9	1.8e-102
AZA25465.1|1331412_1331685_-	DUF1599 domain-containing protein	NA	F8J1G5	Lactobacillus_phage	100.0	1.7e-45
AZA25466.1|1331699_1331927_-	hypothetical protein	NA	F8J1G4	Lactobacillus_phage	100.0	1.2e-39
AZA25467.1|1332516_1332957_-	hypothetical protein	NA	F8J1G1	Lactobacillus_phage	95.2	6.8e-76
AZA25468.1|1333087_1333438_-	hypothetical protein	NA	F8J1F9	Lactobacillus_phage	100.0	2.1e-56
AZA25469.1|1333400_1333607_-	hypothetical protein	NA	F8J1F8	Lactobacillus_phage	100.0	4.9e-29
AZA25470.1|1334024_1334285_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25471.1|1334301_1334520_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25472.1|1334588_1334885_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25473.1|1334881_1335670_-	phage antirepressor Ant	NA	A0A075KJT3	Lactobacillus_phage	65.7	1.7e-90
AZA25474.1|1335805_1336105_-	hypothetical protein	NA	F8J1F5	Lactobacillus_phage	100.0	3.3e-50
AZA26250.1|1336236_1336482_-	hypothetical protein	NA	F8J1F3	Lactobacillus_phage	100.0	1.6e-42
AZA25475.1|1336578_1336869_-	hypothetical protein	NA	F8J1F2	Lactobacillus_phage	99.0	1.6e-49
AZA25476.1|1337054_1339409_-	DNA primase	NA	F8J1F0	Lactobacillus_phage	99.9	0.0e+00
AZA25477.1|1339428_1339977_-	hypothetical protein	NA	F8J1E9	Lactobacillus_phage	99.3	2.2e-84
AZA26251.1|1341133_1341307_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA25478.1|1341510_1342140_+	XRE family transcriptional regulator	NA	Q9G0C2	Lactococcus_phage	44.1	1.7e-35
AZA26252.1|1342576_1343839_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25479.1|1345926_1346514_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AZA25480.1|1346609_1347446_-	fatty acid-binding protein DegV	NA	A0A1X9I5J4	Streptococcus_phage	40.1	2.5e-47
AZA25481.1|1347753_1349031_+	enolase	NA	W6LP63	Streptococcus_phage	51.4	9.3e-110
AZA25482.1|1349286_1349895_-	DUF4230 domain-containing protein	NA	NA	NA	NA	NA
AZA25483.1|1352032_1353211_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
1353272:1353331	attL	CCCGATTGAATATCGGAATCATGTTTTAACAACCTTAACGGCGTAATACTAAATTGTCCC	NA	NA	NA	NA
AZA25484.1|1354000_1355503_+	ABC transporter permease	NA	NA	NA	NA	NA
AZA25485.1|1355551_1356406_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA25486.1|1356583_1358842_+	proton-efflux P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.8	1.3e-42
AZA25487.1|1359119_1360253_-	AI-2E family transporter	NA	NA	NA	NA	NA
AZA25488.1|1360369_1361395_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
AZA25489.1|1361596_1362484_-	cation transporter	NA	NA	NA	NA	NA
AZA25490.1|1362595_1362898_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZA25491.1|1362977_1363505_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.8	6.5e-25
AZA25492.1|1363494_1365771_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.6	2.8e-72
AZA25493.1|1365767_1366469_-	class A sortase	NA	NA	NA	NA	NA
AZA25494.1|1366449_1368288_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.5	1.5e-20
AZA25495.1|1368409_1369549_-	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	25.9	3.1e-16
AZA25496.1|1369631_1371476_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	6.0e-142
AZA25497.1|1371535_1372135_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AZA25498.1|1372146_1373190_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AZA25499.1|1373325_1374267_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	35.1	1.8e-09
AZA26253.1|1374380_1374974_-|integrase	site-specific integrase	integrase	Q9AZI0	Lactococcus_phage	37.9	2.9e-29
AZA25500.1|1376481_1376898_-	hypothetical protein	NA	A0A1B0T6A8	Bacillus_phage	29.7	4.1e-06
AZA26254.1|1377154_1378417_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.2	2.5e-54
1377141:1377220	attR	GGGACAATTTAGTATTACGCCGTTAAGGTTGTTAAAACATGATTCCGATATTCAATCGGGGTCATGTTTTTTCGTCCTGT	NA	NA	NA	NA
AZA25501.1|1379718_1380768_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
AZA25502.1|1383569_1384937_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
AZA25503.1|1385175_1386399_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.0	3.6e-95
AZA26255.1|1386811_1388074_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.2	2.5e-54
AZA25504.1|1388843_1389755_+	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	41.8	2.8e-60
AZA25505.1|1389776_1390961_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
AZA25506.1|1390926_1391499_+	serine acetyltransferase	NA	NA	NA	NA	NA
AZA25507.1|1391534_1392584_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
AZA26256.1|1393044_1393398_+	diacetyl reductase ((R)-acetoin forming) domain protein	NA	NA	NA	NA	NA
AZA25508.1|1393772_1394030_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25509.1|1394272_1395169_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AZA25510.1|1395219_1395582_-	ribosome-binding factor A	NA	NA	NA	NA	NA
AZA25511.1|1395594_1398072_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.9	2.3e-19
AZA25512.1|1398076_1398361_-	50S ribosomal protein L7	NA	NA	NA	NA	NA
AZA26257.1|1398387_1398666_-	DUF448 domain-containing protein	NA	NA	NA	NA	NA
AZA25513.1|1398696_1399848_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AZA25514.1|1399867_1400344_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AZA25515.1|1400452_1404790_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	31.6	9.8e-18
AZA25516.1|1404802_1406500_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AZA25517.1|1406539_1407787_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AZA25518.1|1407796_1408594_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AZA25519.1|1408599_1409331_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	38.2	2.4e-17
AZA25520.1|1409333_1409891_-	ribosome recycling factor	NA	NA	NA	NA	NA
AZA25521.1|1409890_1410616_-	UMP kinase	NA	NA	NA	NA	NA
AZA25522.1|1410765_1411794_-	elongation factor Ts	NA	NA	NA	NA	NA
AZA25523.1|1411856_1412618_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AZA25524.1|1412781_1413792_-	methyltransferase	NA	NA	NA	NA	NA
AZA25525.1|1413862_1414477_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZA25526.1|1414567_1415938_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA25527.1|1416152_1417355_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA25528.1|1417249_1417549_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25529.1|1417749_1418799_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
>prophage 15
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	1465725	1670655	2250954	tRNA,transposase	Bacillus_phage(17.31%)	162	NA	NA
AZA25567.1|1465725_1466928_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA25568.1|1467073_1467259_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AZA25569.1|1469729_1469972_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25570.1|1470505_1471789_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.3	7.5e-59
AZA25571.1|1472039_1472723_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
AZA25572.1|1472752_1473646_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
AZA25573.1|1473646_1475671_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SD90	Indivirus	26.3	4.9e-20
AZA25574.1|1475642_1476398_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
AZA25575.1|1476403_1477720_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
AZA25576.1|1477709_1478657_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	32.1	4.8e-10
AZA25577.1|1478669_1481051_-	primosomal protein N'	NA	NA	NA	NA	NA
AZA25578.1|1481113_1481335_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AZA25579.1|1481336_1481951_-	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	31.7	3.9e-13
AZA25580.1|1482124_1482430_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25581.1|1482484_1484341_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	9.6e-55
AZA25582.1|1484380_1484737_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA25583.1|1484947_1486636_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AZA25584.1|1486657_1487473_-	TlyA family rRNA (cytidine-2'-O)-methyltransferase	NA	NA	NA	NA	NA
AZA25585.1|1487472_1488336_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
AZA25586.1|1488340_1488580_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AZA25587.1|1488572_1489943_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.7	5.3e-34
AZA25588.1|1489929_1490781_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	44.7	7.2e-42
AZA25589.1|1490840_1491239_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
AZA25590.1|1491238_1491673_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AZA25591.1|1491692_1492259_-	elongation factor P	NA	NA	NA	NA	NA
AZA25592.1|1492328_1493435_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
AZA26260.1|1493579_1493873_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AZA25593.1|1493894_1494206_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AZA25594.1|1494446_1494803_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	41.8	6.3e-16
AZA25595.1|1496099_1497365_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AZA25596.1|1497380_1498922_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	45.1	8.2e-68
AZA25597.1|1498922_1499504_-	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AZA26261.1|1499503_1500547_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	8.3e-64
AZA25598.1|1500549_1502028_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.4	1.8e-51
AZA25599.1|1502003_1504226_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.2	6.5e-143
AZA25600.1|1504225_1504900_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AZA25601.1|1504899_1505148_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AZA25602.1|1505152_1505875_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	37.7	3.2e-38
AZA25603.1|1506198_1507494_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.6	1.4e-20
AZA26262.1|1507537_1508662_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AZA25604.1|1508651_1509119_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.2	5.2e-18
AZA25605.1|1509302_1509551_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
AZA25606.1|1509671_1511483_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25607.1|1511667_1513806_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	45.6	9.5e-99
AZA25608.1|1514293_1515343_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.5	2.6e-41
AZA25609.1|1515560_1517939_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
AZA25610.1|1519532_1520315_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
AZA25611.1|1520357_1521281_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	65.3	1.2e-109
AZA25612.1|1523161_1524343_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	35.9	6.7e-46
AZA25613.1|1527019_1528012_-	adenosine deaminase	NA	NA	NA	NA	NA
AZA25614.1|1528116_1529319_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA25615.1|1529213_1529513_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25616.1|1529833_1530175_-	HIRAN domain-containing protein	NA	NA	NA	NA	NA
AZA25617.1|1530366_1531296_+	DegV family protein	NA	NA	NA	NA	NA
AZA25618.1|1531384_1532185_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A218MNE0	uncultured_virus	45.1	2.5e-60
AZA25619.1|1532230_1532530_-	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	A0A218MNE0	uncultured_virus	66.7	5.0e-06
AZA25620.1|1532970_1534020_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
AZA25621.1|1534175_1535438_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25622.1|1535531_1536983_-	amino acid permease	NA	NA	NA	NA	NA
AZA25623.1|1537009_1537381_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25624.1|1537481_1538702_-	MFS transporter	NA	NA	NA	NA	NA
AZA25625.1|1538952_1540290_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
AZA26263.1|1540427_1541684_-	aluminum resistance protein	NA	NA	NA	NA	NA
AZA25626.1|1541689_1542607_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AZA25627.1|1542687_1543089_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AZA25628.1|1543151_1543379_-	DUF910 domain-containing protein	NA	NA	NA	NA	NA
AZA25629.1|1543378_1544050_-	DUF1751 domain-containing protein	NA	NA	NA	NA	NA
AZA25630.1|1544042_1544615_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AZA25631.1|1544668_1544818_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AZA25632.1|1544904_1547019_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
AZA25633.1|1547104_1549687_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25634.1|1551402_1551891_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
AZA25635.1|1551961_1554373_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AZA25636.1|1554372_1555422_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	34.9	1.1e-31
AZA25637.1|1555701_1556052_-	transcriptional regulator	NA	NA	NA	NA	NA
AZA25638.1|1556234_1557413_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA25639.1|1557594_1557894_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25640.1|1557788_1558991_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA25641.1|1559112_1559877_-	RNA methyltransferase	NA	NA	NA	NA	NA
AZA25642.1|1559942_1560215_+	Acylphosphatase domain-containing protein	NA	NA	NA	NA	NA
AZA25643.1|1560248_1561211_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
AZA25644.1|1561307_1562357_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
AZA25645.1|1562551_1564144_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	4.1e-22
AZA25646.1|1564136_1564850_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.8	1.5e-27
AZA25647.1|1565029_1565608_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
AZA25648.1|1565607_1566762_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AZA25649.1|1566765_1567113_-	ribosome silencing factor	NA	NA	NA	NA	NA
AZA25650.1|1567154_1567748_-	HD domain-containing protein	NA	NA	NA	NA	NA
AZA25651.1|1567740_1568379_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AZA26264.1|1568389_1569499_-	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
AZA25652.1|1569607_1569964_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AZA25653.1|1570008_1570209_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AZA25654.1|1570229_1570751_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	39.4	1.0e-14
AZA25655.1|1571293_1572559_+	ATPase	NA	NA	NA	NA	NA
AZA25656.1|1572603_1572786_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25657.1|1572778_1573126_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA25658.1|1573181_1573415_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25659.1|1573371_1574715_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	30.8	2.3e-50
AZA25660.1|1574927_1575164_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25661.1|1575224_1576403_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA25662.1|1577362_1579294_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	32.9	7.5e-95
AZA25663.1|1579593_1580517_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	32.0	8.7e-25
AZA25664.1|1580527_1581862_-	helicase DnaB	NA	NA	NA	NA	NA
AZA25665.1|1581865_1582333_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AZA25666.1|1582346_1582931_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
AZA25667.1|1582939_1583761_-	DNA-formamidopyrimidine glycosylase	NA	F8WPX6	Bacillus_phage	28.9	3.3e-23
AZA25668.1|1583771_1586435_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	29.8	5.0e-57
AZA25669.1|1586646_1587696_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	3.6e-43
AZA25670.1|1587855_1588884_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.1	2.1e-35
AZA25671.1|1591202_1591424_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25672.1|1591496_1592675_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA25673.1|1593058_1594108_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
AZA25674.1|1594548_1596087_-	cell surface protein	NA	NA	NA	NA	NA
AZA26265.1|1596946_1598209_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25675.1|1598239_1598815_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25676.1|1599367_1599550_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25677.1|1599542_1599890_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA25678.1|1599945_1600179_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25679.1|1600135_1601479_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	30.8	2.3e-50
AZA25680.1|1602307_1603486_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA25681.1|1607057_1608377_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AZA26266.1|1608614_1609877_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25682.1|1610116_1611340_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.0	7.9e-98
AZA25683.1|1611614_1612262_-	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
AZA25684.1|1612284_1612605_-	thioredoxin	NA	NA	NA	NA	NA
AZA25685.1|1612683_1613340_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AZA25686.1|1613416_1614634_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA26267.1|1614626_1615367_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	1.2e-19
AZA25687.1|1615470_1615908_+	diadenosine tetraphosphate hydrolase	NA	Q19XP5	Mycobacterium_phage	33.3	1.1e-06
AZA25688.1|1615924_1616275_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25689.1|1616344_1617283_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AZA25690.1|1617546_1618269_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AZA25691.1|1618258_1618882_+	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	26.0	8.5e-08
AZA25692.1|1619008_1619932_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AZA25693.1|1621008_1622598_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	8.2e-55
AZA25694.1|1623009_1624059_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	4.7e-43
AZA25695.1|1624230_1625181_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AZA25696.1|1625173_1627600_-	DNA repair protein	NA	NA	NA	NA	NA
AZA25697.1|1627596_1628802_-	DNA repair exonuclease	NA	NA	NA	NA	NA
AZA25698.1|1628804_1629158_-	YlbF family regulator	NA	NA	NA	NA	NA
AZA26268.1|1629199_1631287_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
AZA25699.1|1631427_1632276_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AZA25700.1|1632370_1633282_-	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
AZA25701.1|1633407_1634112_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AZA25702.1|1634286_1634670_-	sortase	NA	NA	NA	NA	NA
AZA25703.1|1638636_1639686_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
AZA25704.1|1640939_1641164_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25705.1|1642756_1642990_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26269.1|1643005_1643857_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AZA25706.1|1643858_1645145_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
AZA26270.1|1645517_1646780_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25707.1|1646994_1648845_-	pyruvate oxidase	NA	NA	NA	NA	NA
AZA25708.1|1649066_1650230_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25709.1|1650392_1652807_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	31.8	3.0e-125
AZA25710.1|1653118_1654738_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZA25711.1|1654832_1657247_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	66.7	0.0e+00
AZA25712.1|1657543_1658194_+	PAP2 family protein	NA	NA	NA	NA	NA
AZA25713.1|1658256_1659705_-	MFS transporter	NA	NA	NA	NA	NA
AZA25714.1|1659767_1660964_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.1	9.6e-141
AZA25715.1|1667343_1668270_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L162	Tupanvirus	21.9	2.0e-08
AZA25716.1|1668304_1668964_+	hypothetical protein	NA	NA	NA	NA	NA
AZA26271.1|1669605_1670655_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
>prophage 16
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	1706185	1829013	2250954	tRNA,transposase	Bacillus_phage(32.0%)	120	NA	NA
AZA25750.1|1706185_1706908_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AZA25751.1|1706925_1707456_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
AZA25752.1|1707497_1708247_-	acyl-[acyl-carrier-protein] thioesterase	NA	NA	NA	NA	NA
AZA25753.1|1708243_1709107_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.6	3.3e-66
AZA25754.1|1709106_1709439_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
AZA25755.1|1709453_1710326_-	DNA polymerase III subunit delta	NA	M1NSC1	Streptococcus_phage	26.8	1.6e-15
AZA25756.1|1710325_1710652_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25757.1|1710663_1711302_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	51.4	5.2e-53
AZA25758.1|1711431_1711668_-	DUF2508 domain-containing protein	NA	NA	NA	NA	NA
AZA25759.1|1711669_1712269_-	recombination protein RecR	NA	NA	NA	NA	NA
AZA25760.1|1712270_1712600_-	nucleoid-associated protein, YbaB/EbfC family	NA	NA	NA	NA	NA
AZA25761.1|1712671_1714495_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.6	7.7e-49
AZA26273.1|1714904_1716167_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25762.1|1716253_1717621_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
AZA25763.1|1717626_1718142_-|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
AZA25764.1|1718141_1718744_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZA25765.1|1718745_1719276_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
AZA25766.1|1719367_1722235_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26274.1|1722291_1722570_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25767.1|1722841_1723084_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25768.1|1723050_1723386_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AZA25769.1|1723703_1723895_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25770.1|1724972_1726091_-	penicillin-binding protein	NA	NA	NA	NA	NA
AZA25771.1|1726190_1727318_-	penicillin-binding protein	NA	NA	NA	NA	NA
AZA25772.1|1727475_1727748_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	70.0	1.1e-25
AZA25773.1|1728908_1729091_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25774.1|1729083_1729431_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA25775.1|1729486_1729720_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25776.1|1729676_1731020_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	30.1	2.2e-48
AZA25777.1|1732057_1732423_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
AZA25778.1|1732475_1732985_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
AZA25779.1|1733245_1733647_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25780.1|1735210_1736215_-	glycosyl transferase	NA	NA	NA	NA	NA
AZA25781.1|1736377_1737073_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
AZA26275.1|1737156_1737582_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
AZA26276.1|1737707_1738262_-	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
AZA25782.1|1738353_1738524_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
AZA25783.1|1738530_1738680_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AZA25784.1|1738855_1740607_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AZA25785.1|1740708_1741500_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZA25786.1|1741628_1741844_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25787.1|1741995_1743045_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
AZA25788.1|1743166_1743736_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AZA25789.1|1743847_1744597_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AZA25790.1|1744583_1745027_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25791.1|1745019_1746444_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.1	4.8e-46
AZA25792.1|1746586_1747153_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AZA26277.1|1747442_1748705_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25793.1|1749929_1750805_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	34.9	1.4e-08
AZA25794.1|1750923_1751949_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
AZA25795.1|1752034_1753537_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AZA25796.1|1753681_1754518_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA25797.1|1754517_1755216_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.8e-14
AZA25798.1|1755217_1755586_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZA25799.1|1755960_1757580_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA25800.1|1757711_1758236_+	NUDIX hydrolase	NA	A0A1S6L1P8	Vibrio_phage	28.6	3.9e-06
AZA25801.1|1758276_1759497_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
AZA25802.1|1759493_1760675_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
AZA26278.1|1760689_1761757_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25803.1|1762554_1763604_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	1.1e-42
AZA25804.1|1763846_1765781_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	1.0e-54
AZA25805.1|1766075_1767197_-	peptidase M24 family protein	NA	NA	NA	NA	NA
AZA25806.1|1767460_1767892_+	hypothetical protein	NA	NA	NA	NA	NA
AZA26279.1|1769307_1769523_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AZA25807.1|1769614_1770118_-	ECF transporter S component	NA	NA	NA	NA	NA
AZA25808.1|1770278_1771673_-	acetaldehyde dehydrogenase	NA	NA	NA	NA	NA
AZA26280.1|1771938_1773201_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25809.1|1773564_1774392_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AZA25810.1|1775142_1776321_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA25811.1|1783167_1783374_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26281.1|1783558_1784821_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25812.1|1785039_1785378_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AZA25813.1|1785390_1785522_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25814.1|1785487_1785709_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25815.1|1786301_1787249_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
AZA25816.1|1787358_1788735_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AZA25817.1|1788734_1789289_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	49.2	1.3e-39
AZA25818.1|1789394_1789682_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25819.1|1789766_1791116_+	cysteine aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	35.2	3.8e-69
AZA25820.1|1791181_1791475_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25821.1|1791468_1792404_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	I7CCW4	Staphylococcus_virus	30.1	7.8e-13
AZA25822.1|1792515_1792977_-	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ	NA	NA	NA	NA	NA
AZA26282.1|1793164_1794427_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
AZA25823.1|1794611_1795289_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AZA25824.1|1795302_1795488_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25825.1|1795489_1795675_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25826.1|1795695_1796376_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AZA25827.1|1796435_1797176_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AZA25828.1|1797394_1797976_+	DJ-1 family protein	NA	NA	NA	NA	NA
AZA25829.1|1797977_1798496_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZA25830.1|1798571_1799630_+	dipeptide epimerase	NA	NA	NA	NA	NA
AZA25831.1|1799631_1800372_+	serine hydrolase	NA	NA	NA	NA	NA
AZA25832.1|1800454_1801210_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AZA25833.1|1801355_1802768_+	dipeptidase PepV	NA	NA	NA	NA	NA
AZA25834.1|1803012_1804389_+	amino acid permease	NA	NA	NA	NA	NA
AZA25835.1|1804502_1805174_-	DUF4867 domain-containing protein	NA	NA	NA	NA	NA
AZA25836.1|1805166_1805742_-	galactose-6-phosphate isomerase subunit LacB	NA	NA	NA	NA	NA
AZA25837.1|1805761_1806190_-	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
AZA25838.1|1806208_1806976_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AZA25839.1|1807219_1808092_-	aldose epimerase	NA	NA	NA	NA	NA
AZA25840.1|1808104_1809037_-	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
AZA25841.1|1809033_1809213_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25842.1|1809404_1810397_-	tagatose 1,6-diphosphate aldolase	NA	NA	NA	NA	NA
AZA26283.1|1810433_1811696_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25843.1|1811916_1812174_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25844.1|1812218_1813640_-	PTS glucitol transporter subunit IIA	NA	NA	NA	NA	NA
AZA25845.1|1813692_1814007_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
AZA25846.1|1814190_1815240_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
AZA25847.1|1815247_1815769_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AZA25848.1|1816095_1816860_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
AZA25849.1|1817056_1818502_-	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	31.7	2.8e-54
AZA25850.1|1818512_1820216_-	PTS lactose transporter subunit IIB	NA	NA	NA	NA	NA
AZA25851.1|1820350_1821262_-	PRD domain-containing protein	NA	NA	NA	NA	NA
AZA25852.1|1821473_1821827_-	PTS lactose transporter subunit IIA	NA	NA	NA	NA	NA
AZA25853.1|1822445_1823465_-	galactose-1-epimerase	NA	NA	NA	NA	NA
AZA25854.1|1823564_1824731_+	galactokinase	NA	NA	NA	NA	NA
AZA25855.1|1824755_1826222_+	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
AZA25856.1|1826294_1827662_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
AZA25857.1|1827855_1828056_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25858.1|1828305_1829013_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	1834161	1920330	2250954	tRNA,transposase	Bacillus_phage(31.58%)	55	NA	NA
AZA26284.1|1834161_1835424_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25863.1|1836163_1836694_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZA25864.1|1836893_1837079_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25865.1|1837199_1838186_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.4	1.5e-22
AZA25866.1|1838208_1839666_-	sucrose-6-phosphate hydrolase	NA	NA	NA	NA	NA
AZA25867.1|1839950_1841897_+	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
AZA25868.1|1842082_1843162_+	6-phosphofructokinase	NA	NA	NA	NA	NA
AZA26285.1|1843387_1844650_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25869.1|1844705_1846427_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	45.0	3.6e-141
AZA25870.1|1848381_1848909_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26286.1|1849089_1850352_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25871.1|1852698_1853934_+	MFS transporter	NA	NA	NA	NA	NA
AZA25872.1|1854042_1854459_+	XRE family transcriptional regulator	NA	A0A2I7SC14	Paenibacillus_phage	34.7	3.5e-05
AZA26287.1|1854647_1855910_+|transposase	IS3 family transposase ISL6	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
AZA25873.1|1855965_1856274_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25874.1|1856411_1859552_+	NgoFVII family restriction endonuclease	NA	A0A0A1ENT0	Lactobacillus_phage	29.1	5.1e-32
AZA25875.1|1859631_1860621_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	39.0	1.9e-54
AZA25876.1|1860813_1861656_-	dipeptidyl-peptidase	NA	NA	NA	NA	NA
AZA25877.1|1863163_1864342_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA25878.1|1864431_1865802_+	amino acid permease	NA	NA	NA	NA	NA
AZA26288.1|1865866_1867129_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25879.1|1867900_1868269_-	DUF956 domain-containing protein	NA	NA	NA	NA	NA
AZA25880.1|1868278_1869193_-	PTS mannose family transporter subunit IID	NA	NA	NA	NA	NA
AZA25881.1|1869221_1870034_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AZA25882.1|1870052_1871120_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AZA25883.1|1872010_1873390_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
AZA25884.1|1874337_1875705_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	28.8	1.2e-30
AZA25885.1|1875875_1876337_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	58.6	7.9e-43
AZA25886.1|1876359_1878729_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.2	3.0e-77
AZA25887.1|1878795_1879029_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AZA25888.1|1879083_1881156_-	glycerol phosphate lipoteichoic acid synthase	NA	W6LM83	Streptococcus_phage	45.2	1.8e-139
AZA25889.1|1881174_1882188_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25890.1|1882180_1883230_-	glycosyltransferase	NA	NA	NA	NA	NA
AZA25891.1|1883222_1884392_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
AZA26289.1|1887247_1888510_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25892.1|1888784_1890212_-	amino acid permease	NA	NA	NA	NA	NA
AZA25893.1|1890341_1891565_-	arginine deiminase	NA	NA	NA	NA	NA
AZA25894.1|1891743_1892673_-	carbamate kinase	NA	NA	NA	NA	NA
AZA25895.1|1892691_1893693_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AZA25896.1|1893991_1894861_+	response regulator receiver protein	NA	NA	NA	NA	NA
AZA25897.1|1894943_1895663_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25898.1|1895697_1897269_-	amidohydrolase	NA	NA	NA	NA	NA
AZA25899.1|1904382_1904946_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AZA25900.1|1905103_1906411_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.0	2.0e-91
AZA25901.1|1906654_1907149_-	N-acetyltransferase	NA	A0A2K9L4B7	Tupanvirus	34.1	8.8e-08
AZA25902.1|1907148_1907742_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	39.3	5.6e-33
AZA25903.1|1907948_1908752_+	esterase	NA	NA	NA	NA	NA
AZA25904.1|1908754_1909639_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA25905.1|1909656_1910154_-	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
AZA25906.1|1910162_1910834_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
AZA25907.1|1911092_1912478_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZA25908.1|1912806_1913889_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25909.1|1914001_1917895_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25910.1|1917938_1918511_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZA26290.1|1919067_1920330_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
>prophage 18
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	1930956	2055637	2250954	transposase	Bacillus_phage(30.56%)	104	NA	NA
AZA26292.1|1930956_1932219_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25921.1|1932309_1933377_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25922.1|1933428_1934343_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
AZA25923.1|1934490_1935285_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZA25924.1|1935340_1935898_-	elongation factor P	NA	NA	NA	NA	NA
AZA25925.1|1935951_1936866_-	type I pantothenate kinase	NA	NA	NA	NA	NA
AZA25926.1|1936968_1937538_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
AZA25927.1|1937666_1938110_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
AZA25928.1|1938115_1938865_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25929.1|1938926_1939757_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA25930.1|1941471_1942125_-	polar amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	3.3e-26
AZA25931.1|1942136_1942778_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZA25932.1|1943141_1945421_-	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AZA25933.1|1945414_1945639_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25934.1|1945616_1946279_+	metalloendopeptidase	NA	NA	NA	NA	NA
AZA25935.1|1946293_1946947_+	phosphoglycerate mutase family protein	NA	NA	NA	NA	NA
AZA25936.1|1947052_1947745_+	glycerophosphodiester phosphodiesterase	NA	A0A2H4PGQ5	Escherichia_phage	23.6	4.4e-13
AZA26293.1|1949467_1950730_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25937.1|1951751_1951991_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25938.1|1954304_1955828_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AZA25939.1|1955838_1956546_-	VanZ family protein	NA	NA	NA	NA	NA
AZA25940.1|1956805_1957228_+	GtrA family protein	NA	NA	NA	NA	NA
AZA25941.1|1957234_1957408_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25942.1|1957474_1957924_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.6	2.0e-19
AZA26294.1|1958022_1959285_-|transposase	IS3 family transposase ISL6	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
AZA25943.1|1959541_1960969_-	flippase	NA	NA	NA	NA	NA
AZA25944.1|1960971_1962195_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	71.2	1.7e-156
AZA25945.1|1962474_1962657_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25946.1|1962649_1962997_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA25947.1|1963052_1963286_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25948.1|1963242_1964586_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	30.1	2.2e-48
AZA25949.1|1964808_1965789_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AZA25950.1|1966041_1967091_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	1.1e-42
AZA26295.1|1967280_1968510_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AZA26296.1|1970782_1972045_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25951.1|1973733_1974621_+	DNA-entry nuclease	NA	NA	NA	NA	NA
AZA26297.1|1974939_1975236_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25952.1|1975491_1975860_-	transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	26.9	5.2e-05
AZA26298.1|1975995_1977258_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25953.1|1977458_1978472_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZA25954.1|1979031_1979388_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25955.1|1979474_1980653_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA25956.1|1982063_1982297_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25957.1|1982352_1982700_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA25958.1|1982692_1982875_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25959.1|1982959_1983154_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25960.1|1983157_1984606_-	flippase	NA	NA	NA	NA	NA
AZA25961.1|1985414_1986413_-	hypothetical protein	NA	A0A1V0SAH6	Catovirus	33.8	1.5e-14
AZA25962.1|1987612_1988680_-	hypothetical protein	NA	A0A1V0SAH6	Catovirus	32.0	3.0e-08
AZA25963.1|1990153_1991203_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
AZA25964.1|1992301_1993351_+|transposase	IS30-like element ISL7 family transposase	transposase	H7BWC8	unidentified_phage	33.1	8.1e-43
AZA26299.1|1993475_1993700_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25965.1|1993671_1995423_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA25966.1|1995660_1995987_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA25967.1|1995979_1996162_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25968.1|1997666_1998611_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	43.5	3.6e-10
AZA26300.1|1999662_2000772_-	polysaccharide polymerase	NA	Q6EVM4	Oenoccocus_phage	43.4	6.3e-62
AZA25969.1|2001891_2002614_-	glycosyl transferase	NA	A0A1V0SL98	Klosneuvirus	29.0	7.6e-08
AZA25970.1|2002625_2003120_-	glycosyltransferase	NA	NA	NA	NA	NA
AZA25971.1|2003128_2003593_-	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
AZA25972.1|2003641_2004310_-	multidrug MFS transporter	NA	NA	NA	NA	NA
AZA25973.1|2004343_2005120_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZA25974.1|2005123_2005903_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZA25975.1|2005912_2006800_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZA25976.1|2006799_2007843_-	transcriptional regulator	NA	NA	NA	NA	NA
AZA25977.1|2008171_2009452_+	GTPase HflX	NA	NA	NA	NA	NA
AZA25978.1|2009500_2010280_-	hydrolase	NA	NA	NA	NA	NA
AZA25979.1|2010325_2011084_-	hydrolase	NA	A0A0K2SUC1	Clostridium_phage	40.2	2.0e-14
AZA25980.1|2011380_2012094_-	hydrolase	NA	A0A0A7DMV4	Lactobacillus_phage	52.9	1.0e-17
AZA26301.1|2012211_2013474_-|transposase	IS3 family transposase ISL6	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
AZA25981.1|2013650_2014697_-	lactate dehydrogenase	NA	NA	NA	NA	NA
AZA25982.1|2014981_2015467_-	NlpC/P60 family protein	NA	A0A2L1IW19	Streptomyces_phage	40.4	4.3e-15
AZA25983.1|2015591_2016134_-	guanylate kinase	NA	A0A2R2ZH49	Clostridioides_phage	28.0	3.0e-09
AZA25984.1|2016223_2016553_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AZA25985.1|2016616_2018155_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25986.1|2018205_2018832_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25987.1|2018834_2019350_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25988.1|2019516_2019705_+	hypothetical protein	NA	NA	NA	NA	NA
AZA26302.1|2020922_2022185_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA25989.1|2023919_2024369_+	hypothetical protein	NA	NA	NA	NA	NA
AZA25990.1|2024424_2024556_-	prevent-host-death family antitoxin	NA	NA	NA	NA	NA
AZA25991.1|2024831_2025323_-	threonine/serine exporter	NA	NA	NA	NA	NA
AZA25992.1|2025325_2026081_-	threonine/serine exporter	NA	NA	NA	NA	NA
AZA25993.1|2026134_2027679_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.4	8.8e-46
AZA25994.1|2027693_2028071_-	hypothetical protein	NA	NA	NA	NA	NA
AZA25995.1|2028189_2029329_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AZA25996.1|2029669_2030968_+|transposase	transposase	transposase	C1KFS0	Lactobacillus_virus	38.3	6.9e-68
AZA25997.1|2031289_2033092_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AZA25998.1|2033161_2034388_-	lactate oxidase	NA	NA	NA	NA	NA
AZA25999.1|2034517_2036056_-	lactate permease	NA	NA	NA	NA	NA
AZA26000.1|2036636_2037008_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26001.1|2037110_2037908_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AZA26002.1|2037907_2038561_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	1.1e-16
AZA26003.1|2041845_2042760_-	1-phosphofructokinase	NA	NA	NA	NA	NA
AZA26004.1|2042759_2043509_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	32.4	1.6e-24
AZA26005.1|2043656_2044706_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	1.1e-42
AZA26303.1|2045072_2046335_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA26006.1|2046385_2047135_-	amino acid racemase	NA	NA	NA	NA	NA
AZA26007.1|2047148_2048699_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AZA26008.1|2048735_2049944_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	1.6e-26
AZA26009.1|2049933_2050620_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.6	1.9e-37
AZA26010.1|2050748_2052593_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.8	1.9e-42
AZA26011.1|2052603_2054331_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	3.2e-44
AZA26304.1|2054374_2055637_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
>prophage 19
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	2071007	2131330	2250954	protease,transposase	Streptococcus_phage(22.22%)	48	NA	NA
AZA26029.1|2071007_2072186_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA26030.1|2072265_2072751_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AZA26031.1|2072857_2073664_-	DNA-binding response regulator	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	24.0	1.4e-07
AZA26032.1|2073672_2074716_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26306.1|2074902_2076165_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA26033.1|2076195_2077227_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26034.1|2077229_2077841_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26035.1|2077979_2078279_+	hypothetical protein	NA	NA	NA	NA	NA
AZA26036.1|2078173_2079376_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA26037.1|2079554_2080229_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	1.0e-35
AZA26038.1|2080230_2081289_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA26039.1|2081331_2081838_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZA26040.1|2082158_2083562_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AZA26041.1|2083740_2084478_-	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	32.1	9.4e-22
AZA26042.1|2084542_2085178_+	hypothetical protein	NA	NA	NA	NA	NA
AZA26307.1|2086557_2087820_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
AZA26308.1|2088714_2090961_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.4	2.8e-61
AZA26309.1|2092736_2093999_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.2	8.5e-55
AZA26043.1|2094175_2095399_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.7	5.1e-97
AZA26044.1|2095952_2096585_-	nitroreductase family protein	NA	NA	NA	NA	NA
AZA26045.1|2096710_2099242_-	peptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.1	9.0e-72
AZA26046.1|2099704_2100574_+	peptidoglycan-binding protein LysM	NA	A0A0E3XCL7	Enterococcus_phage	67.6	8.8e-19
AZA26047.1|2100744_2101692_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZA26048.1|2103450_2104869_-	anion permease	NA	NA	NA	NA	NA
AZA26049.1|2104894_2106298_-	class II fumarate hydratase	NA	NA	NA	NA	NA
AZA26050.1|2106815_2107055_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AZA26051.1|2107051_2107318_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26310.1|2107688_2108951_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA26052.1|2109214_2110582_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
AZA26053.1|2110765_2111680_+	cytochrome C5	NA	NA	NA	NA	NA
AZA26054.1|2111738_2111978_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26055.1|2112074_2112575_-	O-acetyl-ADP-ribose deacetylase	NA	F1SVT2	Red_sea_bream_iridovirus	47.0	2.0e-36
AZA26056.1|2112574_2113357_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AZA26057.1|2113468_2114227_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AZA26058.1|2114260_2115769_-	glycerol kinase	NA	NA	NA	NA	NA
AZA26059.1|2115965_2116634_+	cobalamin biosynthesis protein CobQ	NA	NA	NA	NA	NA
AZA26311.1|2116828_2117065_+	transcriptional regulator	NA	NA	NA	NA	NA
AZA26060.1|2117188_2119279_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.2	1.1e-123
AZA26061.1|2119808_2121515_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA26062.1|2121483_2122143_-|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	50.2	4.7e-49
AZA26063.1|2122317_2123031_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AZA26064.1|2123582_2123984_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26065.1|2124729_2125953_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.0	3.9e-97
AZA26066.1|2126075_2127329_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA26067.1|2127549_2127747_+	hypothetical protein	NA	NA	NA	NA	NA
AZA26312.1|2127819_2128485_+	hypothetical protein	NA	NA	NA	NA	NA
AZA26068.1|2128688_2128886_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	9.8e-19
AZA26313.1|2130067_2131330_+|transposase	IS3 family transposase ISL6	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
>prophage 20
CP029250	Lactobacillus delbrueckii subsp. lactis isolate NWC_1_2 chromosome, complete genome	2250954	2137203	2205844	2250954	protease,transposase	Streptococcus_phage(31.58%)	44	NA	NA
AZA26072.1|2137203_2138427_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	2.3e-97
AZA26073.1|2144032_2145211_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA26314.1|2145422_2146685_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA26074.1|2146857_2147127_-	anion transporter	NA	NA	NA	NA	NA
AZA26075.1|2148371_2148836_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	44.3	4.4e-25
AZA26076.1|2148850_2150029_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.1	5.8e-98
AZA26077.1|2150048_2150663_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.9	4.6e-30
AZA26078.1|2152158_2153442_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.3	2.2e-58
AZA26315.1|2159737_2161000_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA26079.1|2161186_2161813_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZA26080.1|2161816_2163817_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.9	4.4e-29
AZA26081.1|2163952_2164342_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
AZA26082.1|2164501_2164726_+	hypothetical protein	NA	NA	NA	NA	NA
AZA26083.1|2166404_2167691_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
AZA26084.1|2167680_2167923_-	D-alanine--poly(phosphoribitol) ligase subunit 2	NA	NA	NA	NA	NA
AZA26085.1|2167992_2169225_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.0	5.4e-22
AZA26086.1|2169221_2170724_-	D-alanine--poly(phosphoribitol) ligase subunit 1	NA	A0A2K9KZV5	Tupanvirus	28.3	1.7e-41
AZA26316.1|2170739_2170889_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
AZA26087.1|2171159_2171462_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26088.1|2171642_2172866_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	2.3e-97
AZA26089.1|2173156_2174365_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26090.1|2174422_2174617_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26317.1|2174886_2176149_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	6.5e-55
AZA26091.1|2176424_2176895_+	CBS domain-containing protein	NA	NA	NA	NA	NA
AZA26318.1|2179031_2180192_+	cation:proton antiporter	NA	NA	NA	NA	NA
AZA26092.1|2180277_2180934_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZA26093.1|2181026_2182127_+	YdcF family protein	NA	NA	NA	NA	NA
AZA26094.1|2182332_2183418_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	48.0	3.3e-79
AZA26095.1|2184864_2186148_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.3	2.2e-58
AZA26096.1|2186405_2187629_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	2.3e-97
AZA26097.1|2187970_2188402_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26098.1|2190562_2190973_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26099.1|2191015_2192056_+	protein kinase	NA	A0A2I2L4J2	Orpheovirus	32.1	1.3e-08
AZA26100.1|2192150_2192747_+	DUF4352 domain-containing protein	NA	A0A0P0IXE0	Lactobacillus_phage	70.0	1.4e-44
AZA26319.1|2194127_2194619_+	hypothetical protein	NA	NA	NA	NA	NA
AZA26320.1|2194836_2195061_-	hypothetical protein	NA	NA	NA	NA	NA
AZA26101.1|2195032_2196784_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA26102.1|2197308_2198139_+	ABC transporter permease	NA	NA	NA	NA	NA
AZA26103.1|2198131_2198920_+	ABC transporter permease	NA	NA	NA	NA	NA
AZA26104.1|2198929_2199964_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	1.3e-29
AZA26105.1|2199996_2201058_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA26106.1|2201198_2202260_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA26107.1|2202321_2204019_+	adenosine deaminase	NA	NA	NA	NA	NA
AZA26108.1|2204560_2205844_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.3	2.2e-58
