The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	3473	79832	2210811	holin,tRNA,transposase,protease	Lactobacillus_virus(26.67%)	53	NA	NA
AZA20895.1|3473_4859_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
AZA20896.1|4867_6853_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
AZA20897.1|6992_8396_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	27.6	7.5e-36
AZA20898.1|8496_10056_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
AZA20899.1|10149_11253_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20900.1|11317_11470_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20901.1|12720_13578_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA20902.1|13946_15869_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.6	4.0e-96
AZA20903.1|15868_16156_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
AZA20904.1|16155_16533_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
AZA20905.1|16545_16986_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
AZA20906.1|17086_17341_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20907.1|17441_18746_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.8	3.2e-49
AZA20908.1|20001_21264_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.5	7.7e-32
AZA20909.1|21374_22232_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA20910.1|23925_25236_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.2	9.1e-44
AZA20911.1|25414_26149_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AZA20912.1|26378_27632_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.2	7.5e-120
AZA20913.1|27736_27955_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20914.1|30268_31528_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.0	1.5e-35
AZA20915.1|33248_34298_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	2.1e-51
AZA20916.1|34402_35188_+	HAD family phosphatase	NA	NA	NA	NA	NA
AZA20917.1|35235_35922_-	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	50.6	1.2e-55
AZA20918.1|35946_36594_-	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	47.9	1.1e-47
AZA20919.1|38458_39316_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA20920.1|39421_41356_+	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
AZA20921.1|42237_43128_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AZA20922.1|45232_46270_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
AZA20923.1|48654_49374_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
AZA20924.1|49491_50319_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	28.8	9.6e-23
AZA20925.1|50425_51034_+	ECF transporter S component	NA	NA	NA	NA	NA
AZA20926.1|53429_54533_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20927.1|54621_55278_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZA22540.1|56120_56216_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AZA20928.1|56369_56651_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20929.1|56647_57505_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZA20930.1|57596_58226_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20931.1|58230_59799_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.1	2.5e-11
AZA20932.1|59836_60106_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AZA20933.1|60092_60401_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AZA20934.1|60529_61699_-	cation:proton antiporter	NA	NA	NA	NA	NA
AZA20935.1|66489_67584_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	55.9	1.8e-106
AZA22541.1|68333_69512_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA20936.1|69784_70921_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20937.1|70940_71237_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20938.1|72249_72402_+	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
AZA20939.1|72417_73932_+	D-alanine--poly(phosphoribitol) ligase subunit 1	NA	A0A2K9KZV5	Tupanvirus	28.4	4.4e-34
AZA20940.1|73931_75170_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.4	1.5e-24
AZA20941.1|75228_75468_+	D-alanine--poly(phosphoribitol) ligase subunit 2	NA	NA	NA	NA	NA
AZA20942.1|75460_76747_+	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
AZA20943.1|76746_77691_+	class A beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AZA20944.1|77867_78725_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA20945.1|79124_79832_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	91058	143542	2210811	holin,bacteriocin,protease,transposase	unidentified_phage(15.38%)	43	NA	NA
AZA20953.1|91058_93182_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.2	1.1e-115
AZA20954.1|93288_93930_+	signal peptidase I	NA	NA	NA	NA	NA
AZA20955.1|94023_94788_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20956.1|94878_96240_+	amino acid permease	NA	NA	NA	NA	NA
AZA20957.1|98829_99687_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA20958.1|99721_100078_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20959.1|100193_101372_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA20960.1|102108_103122_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	41.7	1.6e-64
AZA20961.1|103734_104784_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA20962.1|104907_106086_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA20963.1|106136_107201_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
AZA20964.1|107637_108630_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	67.0	1.4e-129
AZA20965.1|108840_110130_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	35.3	2.3e-68
AZA20966.1|110133_111432_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.5	1.0e-18
AZA20967.1|111574_112753_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA20968.1|112878_113241_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20969.1|113352_114402_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA20970.1|114537_115017_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20971.1|115058_115862_-	ATP-binding cassette domain-containing protein	NA	M1H3A1	Paramecium_bursaria_Chlorella_virus	32.6	4.8e-11
AZA20972.1|115764_116352_-	ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	34.8	9.5e-17
AZA20973.1|116639_117569_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22543.1|117726_118905_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA20974.1|119332_119833_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20975.1|119850_120495_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20976.1|121543_122026_+	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	41.7	2.7e-17
AZA22544.1|122240_123506_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA20977.1|123566_124253_-	cobalamin biosynthesis protein CobQ	NA	NA	NA	NA	NA
AZA20978.1|124346_124532_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20979.1|124534_125347_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AZA20980.1|127028_127802_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AZA20981.1|130957_131308_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZA20982.1|131593_132835_+	MFS transporter	NA	NA	NA	NA	NA
AZA20983.1|132952_133096_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20984.1|133475_133574_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AZA20985.1|133676_134087_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZA20986.1|134928_135345_-	hypothetical protein	NA	NA	NA	NA	NA
AZA20987.1|135410_136013_+	ECF transporter S component	NA	NA	NA	NA	NA
AZA20988.1|136009_136804_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AZA20989.1|137602_138403_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.1	3.9e-13
AZA22545.1|138605_138902_+	hypothetical protein	NA	NA	NA	NA	NA
AZA20990.1|139055_139145_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AZA20991.1|139554_140904_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	50.3	1.4e-124
AZA20992.1|142363_143542_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	171085	227460	2210811	integrase,tRNA,transposase,protease	Bacillus_phage(28.57%)	46	170955:171014	211754:213078
170955:171014	attL	TGAGACTGTAAAATAGTTTGTGTAAGGATGAATGATTCCTTAAATTAATTTCTTAAAATA	NA	NA	NA	NA
AZA21014.1|171085_172264_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA21015.1|175087_175543_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21016.1|175593_175926_-	DNA-directed RNA polymerase subunit beta	NA	NA	NA	NA	NA
AZA21017.1|175876_176485_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	31.2	1.2e-17
AZA21018.1|176588_176867_+	RelB	NA	NA	NA	NA	NA
AZA21019.1|176856_177159_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
AZA21020.1|177281_178664_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AZA21021.1|180585_180933_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA22547.1|180972_181203_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA21022.1|181177_182515_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA21023.1|183201_183834_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21024.1|183970_185149_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA21025.1|185269_185734_-	ThiF family adenylyltransferase	NA	A0A1V0SCZ9	Indivirus	37.8	9.2e-07
AZA21026.1|186818_187817_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21027.1|187899_189078_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA21028.1|189253_189946_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AZA21029.1|189954_190137_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21030.1|190220_191078_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA21031.1|191140_191743_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
AZA21032.1|191806_192367_+	aldose epimerase	NA	NA	NA	NA	NA
AZA21033.1|192468_193578_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AZA21034.1|193577_194195_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21035.1|194230_197221_+	LTA synthase family protein	NA	NA	NA	NA	NA
AZA21036.1|197306_198701_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
AZA21037.1|198954_200217_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.9	5.6e-83
AZA21038.1|201300_202614_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.0	3.3e-62
AZA21039.1|202613_203267_+	HD domain-containing protein	NA	NA	NA	NA	NA
AZA21040.1|203375_204233_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA21041.1|204853_206485_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA21042.1|206641_207784_+	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	34.1	1.2e-63
AZA21043.1|207870_209271_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	5.3e-58
AZA21044.1|209405_210455_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.6	3.1e-50
AZA21045.1|210503_211682_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA21046.1|211990_212920_+	ABC transporter permease	NA	NA	NA	NA	NA
AZA21047.1|212928_213960_+	ABC transporter permease	NA	NA	NA	NA	NA
211754:213078	attR	TATTTTAAGAAATTAATTTAAGGAATCATTCATCCTTACACAAACTATTTTACAGTCTCATTAATCCTGTATTTTAAACTGTCTAATTTTTAGGTCTCAGTTCAAAGTATAAGCTTTTCTCTTATTTTTTTAATTTTATTTAGTATTTACCTAGATATTTTTGAATCATTTGGTATAATTAAAACAACATTAAAAAACAAAATATAAAATAAAAAGAAAAATGAGGGAGCAATTAATATGGCTAGATACCTATTAAAACGTATTTTTTATATGATCCTCACTTTGTTTATCGTAGCCACGGTAACGTTCTTCTTAATGAAGTTGATGCCTGGTTCACCTTACGCTAACGAAGCGAAGATGACACTAACACAGCAACATATTATGAATGAACAATATGGATTGAATAAGCCTGTTTGGCAACAATATTTAATCTATATTGCTGGGATGCTTCATGGAGATTTTGGAACGTCCTTCCAATACAGTAATCAACCTGTATCTTCATTGATTGGTGCTCGTTTAGGGGCTTCAATGCAATTGGGATTGCAAGCTTTAATCTTGGGCGTTGTATTTGGCGTAATCGTCGGTGCTATTGCTGCTGTGAAGCAAGGAACTTGGGTAGATTCAACTGCGACCGTAATTTCTATTATTGGTAAATCAGTTCCTAACTTCGTTTTAGCAGTACTTTTACAGTACTATATTGGTTTAAAGCTAGGTCTTTTTCCATTAGCTGGTTGGGGTCAATTCTCTCAAACGATCATGCCAACAATTGCTCTGGCGGTAGGACCATTCGCCGAGACGGCGCGGTTCATTAGAACTAGCATGGTTGATACCTTGAGTAGTGATTACATTGAATTAGGTAAAGCTAAAGGCTTGAGCCGAATGGAAGTTATTAGAAAGCACGCAATGCGTAACTCAATGATTCCATTAGTTACCTTAATTGGTCCTTATGCAGTTGCTTTGATGACCGGTTCAATGGTTATCGAGAATATCTTCAATATTCCTGGTATTGGTGAACAATTTATTAAGTCGATTTTGACTAACGACTACCCAACAATCATGGGAATTACGATGGTCTACTGTATCGGACTTGTAGTAATTTTGTTGATTACTGATATTATCTATGGATTGATTGATCCAAGAATTAGATTAGATGAAAGCGAGGCTTAGAAGACAATATGGCTGAAGAAAAATTAACCCTTCCTGCAGATGCCTTTGAACCTTTACCAAAAGATGAAGCGCAAGATAATGAAAATATTGCTGGTCCATCATTGTCCTTTGCCCAAAACGTTTGGATTCGTTTTAAGCAAAGAAAAGCAGCTGTGATT	NA	NA	NA	NA
AZA21048.1|213975_215034_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	3.7e-19
AZA21049.1|215054_215999_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	4.6e-21
AZA21050.1|216080_217397_-	aminopeptidase E	NA	R4TV59	Phaeocystis_globosa_virus	36.1	1.0e-63
AZA21051.1|217537_217984_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AZA21052.1|218216_218669_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AZA21053.1|218757_219420_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZA21054.1|219580_220180_-	DUF159 family protein	NA	NA	NA	NA	NA
AZA21055.1|220304_221327_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AZA21056.1|221351_221831_+	competence protein ComE	NA	A7KUY9	Bacillus_phage	59.0	5.2e-37
AZA21057.1|221811_222429_+	TPM domain-containing protein	NA	NA	NA	NA	NA
AZA21058.1|225483_227460_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.0	1.1e-98
>prophage 4
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	232420	297742	2210811	tRNA,transposase,protease	Lactobacillus_virus(17.65%)	55	NA	NA
AZA21065.1|232420_233803_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AZA21066.1|234032_234545_+	S-layer protein	NA	NA	NA	NA	NA
AZA21067.1|235449_235881_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21068.1|235937_236933_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	48.9	6.2e-93
AZA21069.1|237336_238515_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21070.1|238628_239645_+	cell separation protein	NA	NA	NA	NA	NA
AZA21071.1|239780_241175_+	cell division protein	NA	NA	NA	NA	NA
AZA21072.1|241415_242390_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.8	6.6e-47
AZA21073.1|243418_243694_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21074.1|243721_245086_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.1	1.4e-31
AZA21075.1|245199_245601_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
AZA21076.1|245647_246205_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
AZA21077.1|246323_247943_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.2	5.6e-136
AZA21078.1|248072_249368_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZA21079.1|249491_249713_+	HAD family phosphatase	NA	NA	NA	NA	NA
AZA21080.1|249719_250109_+	HAD family hydrolase	NA	NA	NA	NA	NA
AZA21081.1|250164_251589_-	dipeptidase	NA	NA	NA	NA	NA
AZA21082.1|251669_252494_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZA21083.1|252593_253868_-	purine permease	NA	Q9KX94	Enterobacteria_phage	27.9	1.1e-28
AZA21084.1|253871_254450_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AZA21085.1|254756_255359_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21086.1|255574_256432_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA21087.1|256585_257875_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.2	6.3e-122
AZA21088.1|258187_258388_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22548.1|258374_258668_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21089.1|258710_258863_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA21090.1|259086_260637_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	34.1	6.2e-23
AZA21091.1|263029_264265_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.2	6.9e-102
AZA21092.1|265803_266982_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA21093.1|267172_268249_+	cell surface protein	NA	NA	NA	NA	NA
AZA21094.1|268548_269778_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.2	7.1e-123
AZA21095.1|270027_271077_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA21096.1|271157_271994_-	HAD family hydrolase	NA	NA	NA	NA	NA
AZA21097.1|272178_272424_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AZA21098.1|272550_273918_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AZA21099.1|273931_275443_+	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	39.1	1.1e-69
AZA21100.1|275525_275882_+	holo-ACP synthase	NA	NA	NA	NA	NA
AZA21101.1|275884_277015_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.7	1.6e-28
AZA22549.1|277260_277746_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZA22550.1|277947_279213_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA21102.1|279267_279975_-	CBS domain-containing protein	NA	NA	NA	NA	NA
AZA21103.1|280152_281124_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AZA21104.1|281258_281816_+|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AZA21105.1|281817_285315_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AZA21106.1|285326_285569_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
AZA21107.1|285634_286012_+	septum formation initiator family protein	NA	NA	NA	NA	NA
AZA21108.1|286011_286374_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
AZA21109.1|286414_287671_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AZA21110.1|287765_289931_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0BXI2	Ostreococcus_lucimarinus_virus	41.0	1.5e-107
AZA21111.1|289983_290874_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
AZA21112.1|290948_291977_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AZA21113.1|291992_293543_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	35.6	1.5e-82
AZA21114.1|293854_294337_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21115.1|294701_295157_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AZA21116.1|295261_297742_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	33.4	1.6e-118
>prophage 5
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	328630	418783	2210811	holin,integrase,tRNA,transposase	Lactobacillus_virus(10.71%)	88	330361:330378	341793:341810
AZA21154.1|328630_329422_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AZA21155.1|329522_329966_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AZA21156.1|329981_330377_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
330361:330378	attL	AATTCTCAAAGCGTTAAT	NA	NA	NA	NA
AZA21157.1|330446_331499_-|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	30.4	1.0e-37
AZA21158.1|331573_331762_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21159.1|331823_332924_-	replication initiation protein	NA	A0A1S6LVK5	Cruciviridae_sp	28.2	4.7e-09
AZA21160.1|333111_333618_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21161.1|333624_334707_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
AZA21162.1|334709_335015_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21163.1|335162_336251_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21164.1|336269_337319_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA21165.1|337399_339037_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	38.0	3.9e-92
AZA21166.1|339589_340138_+	ATP-binding protein	NA	NA	NA	NA	NA
AZA21167.1|340176_341355_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA21168.1|341899_342271_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
341793:341810	attR	AATTCTCAAAGCGTTAAT	NA	NA	NA	NA
AZA21169.1|342360_342945_-	DJ-1 family protein	NA	NA	NA	NA	NA
AZA21170.1|343719_344478_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AZA21171.1|344516_345197_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AZA21172.1|345259_346159_+	cation transporter	NA	A0A1V0SED0	Indivirus	34.8	8.3e-12
AZA21173.1|346167_346350_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21174.1|346363_347044_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AZA21175.1|347147_348083_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	I7CCW4	Staphylococcus_virus	25.7	9.5e-11
AZA21176.1|348221_349451_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.9	2.3e-121
AZA21177.1|349921_352600_+	magnesium-translocating P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	24.7	4.2e-43
AZA21178.1|353264_354107_-	sugar transporter	NA	NA	NA	NA	NA
AZA21179.1|354250_355600_-	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	36.1	3.0e-74
AZA21180.1|355910_357170_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.7	1.3e-119
AZA21181.1|357317_357620_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22553.1|357741_358920_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21182.1|359131_359683_+	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	3.1e-38
AZA21183.1|359682_361059_+	DNA repair protein RadA	NA	A0A2I7QPS8	Vibrio_phage	24.6	8.8e-05
AZA21184.1|361134_362634_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AZA21185.1|362726_364157_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	29.2	3.1e-45
AZA21186.1|364149_364593_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21187.1|364579_365332_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AZA21188.1|365474_366020_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AZA21189.1|366085_366943_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA21190.1|367069_367288_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21191.1|367399_368896_+	gluconate kinase	NA	NA	NA	NA	NA
AZA21192.1|370703_371882_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21193.1|372198_372348_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AZA21194.1|372355_372523_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
AZA21195.1|372630_373188_+	transcription termination/antitermination protein NusG	NA	F5B3X4	Synechococcus_phage	30.8	1.1e-11
AZA21196.1|373315_373741_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
AZA21197.1|373823_374516_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
AZA21198.1|374657_375911_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.2	2.0e-08
AZA21199.1|376994_377861_+	phosphate ABC transporter substrate-binding protein	NA	M1PR58	Cyanophage	22.6	4.2e-05
AZA21200.1|377864_378860_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AZA21201.1|378861_379749_+	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AZA21202.1|379756_380554_+	phosphate ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	33.5	1.0e-13
AZA21203.1|380555_381311_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.5	3.0e-15
AZA21204.1|381327_382005_+	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AZA21205.1|383599_384112_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
AZA21206.1|384162_384525_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
AZA21207.1|385426_386056_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZA21208.1|386045_386552_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	39.5	1.2e-07
AZA21209.1|386746_388534_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	39.7	2.0e-49
AZA21210.1|388566_388902_+	nucleoid-associated protein, YbaB/EbfC family	NA	NA	NA	NA	NA
AZA21211.1|388902_389502_+	recombination protein RecR	NA	NA	NA	NA	NA
AZA21212.1|389501_389747_+	DUF2508 family protein	NA	NA	NA	NA	NA
AZA21213.1|389850_390489_+	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	51.0	3.6e-54
AZA21214.1|390500_390821_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21215.1|390821_391679_+	DNA polymerase III subunit delta	NA	M1NSC1	Streptococcus_phage	29.2	3.9e-19
AZA21216.1|391689_392040_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
AZA21217.1|392041_392896_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.7	2.3e-64
AZA21218.1|392898_393633_+	acyl-[acyl-carrier-protein] thioesterase	NA	NA	NA	NA	NA
AZA21219.1|393675_394194_+	folate family ECF transporter S component	NA	NA	NA	NA	NA
AZA21220.1|394218_394953_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AZA21221.1|394936_395509_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AZA22554.1|395532_396582_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	35.2	1.1e-50
AZA21222.1|396758_398096_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA22555.1|398070_398301_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA21223.1|398340_398688_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA21224.1|399529_400573_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	46.2	1.5e-86
AZA21225.1|400710_400899_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
AZA21226.1|400908_401880_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AZA21227.1|401872_402583_+	GntR family transcriptional regulator	NA	A0A291LID1	Streptomyces_phage	39.4	6.3e-07
AZA22556.1|402645_402834_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22557.1|403336_404524_-	CoA transferase	NA	NA	NA	NA	NA
AZA21228.1|407692_409606_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.7	3.5e-60
AZA21229.1|409780_410428_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
AZA21230.1|410567_411026_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
AZA22558.1|412801_413089_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21231.1|413950_414244_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21232.1|414260_414482_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AZA21233.1|414779_415319_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21234.1|416428_417607_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA21235.1|417925_418783_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	424247	511432	2210811	integrase,tRNA,transposase	uncultured_virus(10.71%)	59	418770:418795	456015:456040
418770:418795	attL	AACGATTTAACTAGCACCACGCGTAT	NA	NA	NA	NA
AZA22559.1|424247_425426_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21237.1|425601_426357_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22560.1|427445_428054_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	41.8	5.9e-30
AZA21238.1|428290_428575_+	co-chaperone GroES	NA	A0A221S304	uncultured_virus	40.7	1.2e-12
AZA21239.1|428627_430250_+	molecular chaperone GroEL	NA	A0A240F766	uncultured_virus	53.8	2.9e-156
AZA22561.1|430431_433008_+	DNA mismatch repair protein MutS	NA	F2QAF7	Pyramimonas_orientalis_virus	25.2	5.4e-40
AZA21240.1|433007_434918_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.8	6.8e-56
AZA21241.1|434918_435509_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AZA21242.1|435557_436574_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.5	7.4e-09
AZA21243.1|436623_437058_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AZA21244.1|437191_438643_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	32.5	3.3e-63
AZA21245.1|438635_439757_+	DNA polymerase IV	NA	A0A1P8CWP4	Bacillus_phage	24.5	2.4e-16
AZA21246.1|439816_440773_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
AZA21247.1|440765_442127_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.2	2.6e-49
AZA21248.1|442364_445004_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.0	3.6e-63
AZA21249.1|445064_445322_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
AZA21250.1|445321_445750_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AZA21251.1|445751_446063_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
AZA21252.1|446126_448484_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	48.7	9.7e-20
AZA21253.1|448584_448896_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	43.8	1.3e-17
AZA21254.1|449135_450365_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.4	1.8e-65
AZA21255.1|450763_452044_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.5	1.3e-10
AZA21256.1|452054_452450_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
AZA21257.1|452607_453702_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.4	1.3e-107
AZA21258.1|453901_454315_-	DUF2507 domain-containing protein	NA	NA	NA	NA	NA
AZA21259.1|454391_455195_+	glutamate racemase	NA	NA	NA	NA	NA
AZA21260.1|455194_455815_+	XTP/dITP diphosphatase	NA	A0A2P1DNP2	Cassava_brown_streak_virus	34.0	8.8e-13
AZA21261.1|456113_456971_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
456015:456040	attR	ATACGCGTGGTGCTAGTTAAATCGTT	NA	NA	NA	NA
AZA21262.1|457187_458039_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AZA21263.1|458172_458598_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
AZA21264.1|458615_458987_+	DUF1269 domain-containing family protein	NA	NA	NA	NA	NA
AZA21265.1|458991_460701_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	1.3e-87
AZA21266.1|460865_461972_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
AZA21267.1|462118_463120_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.3	1.8e-20
AZA21268.1|464662_464983_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21269.1|464997_466389_+	bifunctional metallophosphatase/5'-nucleotidase	NA	S4VPC4	Pandoravirus	22.6	9.5e-07
AZA21270.1|466372_466999_+	DUF1027 domain-containing protein	NA	NA	NA	NA	NA
AZA21271.1|466995_467775_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
AZA21272.1|468443_469826_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AZA21273.1|469850_470498_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21274.1|470506_471436_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L162	Tupanvirus	28.0	8.2e-15
AZA21275.1|481262_482426_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
AZA21276.1|482439_483483_+	glycosyltransferase	NA	NA	NA	NA	NA
AZA21277.1|483482_484505_+	UPF0104 family protein	NA	NA	NA	NA	NA
AZA21278.1|484580_486638_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.5	2.3e-142
AZA21279.1|486704_486938_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AZA21280.1|487012_489352_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.6	2.1e-83
AZA21281.1|489364_489823_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	57.4	2.1e-43
AZA21282.1|491997_492183_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21283.1|495543_496467_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA21284.1|496883_498083_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	66.8	2.4e-139
AZA21285.1|498100_499561_+	MFS transporter	NA	S4TR35	Salmonella_phage	24.2	4.9e-06
AZA21286.1|500304_501546_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	58.2	3.1e-118
AZA21287.1|502214_502877_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AZA21288.1|503165_505580_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.8	0.0e+00
AZA21289.1|505673_507320_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZA21290.1|508832_509756_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21291.1|509774_510233_+	pullulanase	NA	NA	NA	NA	NA
AZA22562.1|510253_511432_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
>prophage 7
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	518479	576249	2210811	tRNA,transposase	unidentified_phage(14.29%)	55	NA	NA
AZA21298.1|518479_519529_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA21299.1|519928_521107_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21300.1|521568_521877_-	PspC domain-containing protein	NA	NA	NA	NA	NA
AZA21301.1|522176_523472_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	28.0	2.5e-17
AZA21302.1|523473_524322_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AZA21303.1|524448_525123_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
AZA21304.1|525740_526268_-	phenolic acid decarboxylase	NA	NA	NA	NA	NA
AZA21305.1|526362_526974_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
AZA21306.1|527506_529192_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	31.5	2.7e-72
AZA21307.1|529302_530214_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
AZA21308.1|530286_530805_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AZA21309.1|530807_531077_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21310.1|531224_531509_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21311.1|533426_534266_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	38.0	2.1e-49
AZA21312.1|534599_534692_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
AZA22563.1|534712_535219_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22564.1|535224_535410_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZA21313.1|535420_536239_+	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
AZA21314.1|536289_536619_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21315.1|536682_537435_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	30.7	8.4e-26
AZA22565.1|537691_538870_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21316.1|539109_540159_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA21317.1|540283_540952_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	46.0	1.7e-17
AZA21318.1|541066_541213_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AZA21319.1|541316_542699_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AZA21320.1|544514_545372_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AZA21321.1|545460_547518_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
AZA21322.1|547538_547889_+	YlbF family regulator	NA	NA	NA	NA	NA
AZA21323.1|547897_549118_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
AZA21324.1|549098_551600_+	DNA repair protein	NA	NA	NA	NA	NA
AZA21325.1|551592_552570_+	HD domain-containing protein	NA	NA	NA	NA	NA
AZA21326.1|552611_552992_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21327.1|553057_554395_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA22566.1|554369_554600_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA21328.1|554639_554987_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA21329.1|555443_556346_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AZA22567.1|556582_557761_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21330.1|557840_558176_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21331.1|558185_558623_-	HIT family protein	NA	NA	NA	NA	NA
AZA21332.1|558834_559089_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AZA22568.1|559118_559454_+	addiction module antidote protein, HigA family	NA	NA	NA	NA	NA
AZA21333.1|559468_560212_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.6	1.7e-18
AZA21334.1|560204_561392_+	ABC transporter permease	NA	NA	NA	NA	NA
AZA21335.1|561403_562057_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AZA21336.1|562126_562447_+	thioredoxin	NA	NA	NA	NA	NA
AZA21337.1|562466_563114_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
AZA21338.1|563165_564473_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22569.1|564437_564647_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21339.1|566183_566381_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21340.1|566488_567097_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
AZA21341.1|567126_568452_+|transposase	transposase	transposase	G3MB42	Bacillus_virus	35.8	2.8e-56
AZA22570.1|568816_569215_+	ABC transporter permease	NA	NA	NA	NA	NA
AZA21342.1|569546_574424_+	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	32.8	3.0e-15
AZA21343.1|574706_576044_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA22571.1|576018_576249_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	583036	637054	2210811	tRNA,transposase,protease	Bacillus_phage(36.36%)	55	NA	NA
AZA21348.1|583036_584215_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22572.1|584335_584515_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21349.1|584809_587473_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	30.6	8.9e-62
AZA21350.1|587481_588312_+	formamidopyrimidine-DNA glycosylase	NA	A0A127AWE5	Bacillus_phage	25.9	7.1e-18
AZA21351.1|588308_588911_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
AZA21352.1|588913_589381_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
AZA21353.1|589383_590715_+	chromosome replication initiation protein	NA	NA	NA	NA	NA
AZA22573.1|590746_591655_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	28.1	9.2e-27
AZA21354.1|591945_593880_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	33.2	3.6e-97
AZA21355.1|594037_594559_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21356.1|594710_595241_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21357.1|595431_596040_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
AZA21358.1|596069_597395_+|transposase	transposase	transposase	G3MB42	Bacillus_virus	35.8	2.8e-56
AZA21359.1|598602_598899_+	ACT domain-containing protein	NA	NA	NA	NA	NA
AZA21360.1|598932_600111_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21361.1|600280_601534_+	DUF389 domain-containing protein	NA	NA	NA	NA	NA
AZA22574.1|603004_603286_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21362.1|603246_603402_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21363.1|603417_604692_+	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
AZA21364.1|604882_605416_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	37.8	5.2e-14
AZA21365.1|605437_605638_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AZA21366.1|605681_606038_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AZA21367.1|606365_606713_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA22575.1|606752_606983_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA21368.1|606957_608295_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA21369.1|608453_608978_+	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
AZA21370.1|608970_610080_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
AZA21371.1|610090_610747_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AZA21372.1|610727_611321_+	HD domain-containing protein	NA	NA	NA	NA	NA
AZA21373.1|611342_611690_+	ribosome silencing factor	NA	NA	NA	NA	NA
AZA21374.1|611695_612847_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AZA21375.1|612848_613403_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
AZA21376.1|613565_614282_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.1	5.2e-25
AZA21377.1|614268_615828_+	sensor histidine kinase	NA	NA	NA	NA	NA
AZA21378.1|615864_616353_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AZA21379.1|616400_617363_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
AZA21380.1|617409_617682_-	acylphosphatase	NA	NA	NA	NA	NA
AZA21381.1|617779_618547_+	RNA methyltransferase	NA	NA	NA	NA	NA
AZA21382.1|618667_619846_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21383.1|620036_620387_+	transcriptional regulator	NA	NA	NA	NA	NA
AZA21384.1|620671_621721_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.3	1.2e-33
AZA21385.1|621724_624139_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AZA21386.1|624215_624692_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AZA21387.1|624755_625670_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AZA21388.1|625856_626198_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AZA21389.1|626166_626463_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA22576.1|626665_627931_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA21390.1|627996_628920_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AZA21391.1|629027_631619_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA21392.1|631709_633818_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
AZA21393.1|633894_634044_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AZA21394.1|634686_635367_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AZA21395.1|635367_635595_+	DUF910 family protein	NA	NA	NA	NA	NA
AZA21396.1|635653_636055_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AZA21397.1|636133_637054_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 9
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	640350	798087	2210811	transposase	Leptospira_phage(12.12%)	117	NA	NA
AZA21399.1|640350_641529_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21400.1|641649_642861_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.1	2.7e-10
AZA21401.1|643259_643979_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22577.1|644319_645498_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21402.1|645520_646399_+	ABC transporter	NA	NA	NA	NA	NA
AZA22578.1|646499_647489_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21403.1|648998_649814_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA21404.1|650136_650484_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA22579.1|650523_650754_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA21405.1|650728_652066_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA21406.1|652554_652902_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA22580.1|652941_653172_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA21407.1|653146_654484_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA21408.1|654573_655566_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	5.3e-52
AZA21409.1|655670_656627_-	beta-galactosidase small subunit	NA	NA	NA	NA	NA
AZA21410.1|656610_658497_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	33.6	4.8e-94
AZA21411.1|658719_659727_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZA22581.1|662089_664009_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AZA21412.1|665238_666474_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	48.6	4.0e-57
AZA21413.1|667958_669059_+	MFS transporter	NA	NA	NA	NA	NA
AZA21414.1|669126_670305_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22582.1|670628_671807_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21415.1|671949_673611_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
AZA21416.1|673621_674110_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.1	4.8e-22
AZA22583.1|674120_675239_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AZA21417.1|675436_676153_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	39.1	7.5e-40
AZA21418.1|676152_676404_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AZA21419.1|676403_677075_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AZA21420.1|677071_679303_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	38.9	7.8e-144
AZA21421.1|679260_680712_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	5.3e-61
AZA21422.1|680743_681793_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	43.9	9.2e-63
AZA21423.1|681789_683925_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	46.3	4.3e-75
AZA21424.1|683937_685194_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AZA21425.1|685613_686843_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.9	3.6e-66
AZA21426.1|687080_688340_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.7	3.7e-10
AZA21427.1|688539_689379_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AZA21428.1|689409_690366_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA21429.1|690371_691520_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA21430.1|691500_693045_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.9	5.2e-14
AZA21431.1|693113_694199_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	49.3	5.2e-77
AZA22584.1|697708_697795_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
AZA21432.1|698224_699610_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA21433.1|699764_700994_+	MFS transporter	NA	NA	NA	NA	NA
AZA21434.1|701197_702247_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA21435.1|702273_703656_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AZA21436.1|707583_708762_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21437.1|709999_710548_+	PepQ protein	NA	NA	NA	NA	NA
AZA21438.1|712289_713456_+	galactokinase	NA	NA	NA	NA	NA
AZA21439.1|713477_714941_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
AZA21440.1|716158_716659_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21441.1|716715_717315_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21442.1|717311_718127_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA21443.1|719855_721028_+	MFS transporter	NA	NA	NA	NA	NA
AZA21444.1|721046_721454_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AZA21445.1|722894_724232_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA22585.1|724206_724437_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA21446.1|724476_724824_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA21447.1|726108_726894_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21448.1|726981_728319_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA22586.1|728293_728524_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA21449.1|728563_728911_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA21450.1|730301_730808_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21451.1|731027_732206_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21452.1|732366_733818_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AZA21453.1|734015_735041_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.3	6.5e-45
AZA21454.1|735267_736437_+	MFS transporter	NA	NA	NA	NA	NA
AZA21455.1|736688_736901_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA21456.1|736973_737321_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21457.1|737360_737870_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21458.1|738218_739964_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA22587.1|740062_740230_+	quaternary ammonium transporter	NA	NA	NA	NA	NA
AZA21459.1|740617_740851_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21460.1|741003_741663_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZA21461.1|741643_742318_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZA22588.1|742327_743068_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-25
AZA21462.1|743080_743941_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA21463.1|743987_744284_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
AZA22589.1|746391_746487_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21464.1|746581_747439_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA21465.1|749046_751227_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21466.1|752772_753381_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
AZA21467.1|755106_756339_+	MFS transporter	NA	NA	NA	NA	NA
AZA22590.1|756616_757795_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22591.1|757983_760608_-	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	30.0	1.1e-83
AZA21468.1|761771_762155_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA22592.1|762533_762671_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21469.1|763896_764520_-	orotate phosphoribosyltransferase	NA	A0A0B5IW17	Pandoravirus	32.9	9.1e-26
AZA21470.1|764521_765226_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AZA21471.1|765480_766404_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AZA21472.1|766570_767113_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
AZA21473.1|767257_768214_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	34.1	1.6e-26
AZA21474.1|768213_769491_+	dihydroorotase	NA	NA	NA	NA	NA
AZA21475.1|769490_770576_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.5	2.5e-55
AZA21476.1|770568_773757_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
AZA21477.1|775118_776081_+	mucus-binding protein	NA	NA	NA	NA	NA
AZA21478.1|776059_776230_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AZA21479.1|776403_777267_+	sugar transporter	NA	NA	NA	NA	NA
AZA21480.1|777382_777664_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21481.1|777656_778082_+	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AZA21482.1|778133_780515_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
AZA21483.1|780706_781885_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21484.1|782627_784010_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AZA21485.1|784062_784419_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	38.6	5.0e-13
AZA21486.1|784427_785324_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	26.6	1.8e-11
AZA21487.1|785782_787003_+	lysin	NA	X2CXX8	Lactobacillus_phage	50.9	1.7e-60
AZA21488.1|787125_788922_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AZA21489.1|788992_789172_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AZA21490.1|789237_789915_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21491.1|789958_790984_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
AZA21492.1|792657_792969_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
AZA21493.1|792987_793278_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
AZA21494.1|793387_794497_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
AZA21495.1|794580_795150_+	elongation factor P	NA	NA	NA	NA	NA
AZA21496.1|795167_795593_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AZA21497.1|795600_795993_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
AZA21498.1|796051_796900_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	43.1	1.9e-42
AZA21499.1|797037_798087_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.7	8.3e-48
>prophage 10
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	812772	881499	2210811	tRNA,transposase,protease	Prochlorococcus_phage(12.5%)	53	NA	NA
AZA21509.1|812772_813717_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.2	6.2e-10
AZA21510.1|813667_815032_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
AZA22593.1|815036_815792_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
AZA21511.1|815781_817797_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SD90	Indivirus	26.6	2.4e-19
AZA21512.1|817797_818688_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
AZA21513.1|818700_819351_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AZA22594.1|821089_821395_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21514.1|821501_821687_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AZA21515.1|821842_822205_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AZA21516.1|822226_823888_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
AZA22595.1|823889_825920_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AZA21517.1|825940_826942_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
AZA21518.1|826972_827215_+	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	56.1	8.1e-07
AZA21519.1|827335_828370_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	4.6e-14
AZA21520.1|828373_829360_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	3.7e-13
AZA21521.1|829362_830322_+	ABC transporter permease	NA	NA	NA	NA	NA
AZA21522.1|830336_831266_+	ABC transporter permease	NA	NA	NA	NA	NA
AZA21523.1|831469_833221_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA21524.1|835304_835991_+	ribonuclease III	NA	M1HR51	Paramecium_bursaria_Chlorella_virus	30.6	8.2e-20
AZA21525.1|836006_839576_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AZA21526.1|839576_840869_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
AZA21527.1|840911_842333_+	dipeptidase	NA	NA	NA	NA	NA
AZA21528.1|842532_842820_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZA21529.1|842886_844314_-	amino acid permease	NA	NA	NA	NA	NA
AZA21530.1|844439_845396_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.2e-26
AZA21531.1|845510_845852_+	transcriptional regulator	NA	NA	NA	NA	NA
AZA21532.1|845856_847287_+	signal recognition particle protein	NA	NA	NA	NA	NA
AZA21533.1|847377_847650_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AZA21534.1|847718_848234_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AZA21535.1|848223_848943_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AZA21536.1|849055_849403_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZA21537.1|850443_851229_+	SGNH/GDSL hydrolase family protein	NA	Q6SEC0	Lactobacillus_prophage	24.0	1.2e-06
AZA21538.1|851257_851884_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	53.6	8.9e-13
AZA21539.1|852116_853295_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA21540.1|853406_854813_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA21541.1|854913_856191_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
AZA21542.1|858305_858569_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
AZA21543.1|858631_858850_+	YneF family protein	NA	NA	NA	NA	NA
AZA21544.1|859148_860378_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	40.8	1.1e-75
AZA21545.1|862904_864164_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.2	1.1e-123
AZA22596.1|865728_866994_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA21546.1|868573_870517_+	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.4	1.2e-60
AZA21547.1|870574_871756_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	36.1	2.7e-47
AZA21548.1|871810_872425_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZA21549.1|872490_873522_+	methyltransferase	NA	NA	NA	NA	NA
AZA21550.1|873684_874458_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
AZA21551.1|874491_875517_+	elongation factor Ts	NA	NA	NA	NA	NA
AZA21552.1|875655_876381_+	UMP kinase	NA	NA	NA	NA	NA
AZA21553.1|876380_876938_+	ribosome recycling factor	NA	NA	NA	NA	NA
AZA21554.1|876940_877675_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	39.0	2.5e-22
AZA21555.1|877676_878492_+	CDP-archaeol synthase	NA	NA	NA	NA	NA
AZA21556.1|878502_879759_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AZA21557.1|879801_881499_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 11
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	923531	945018	2210811	integrase,transposase	Lactobacillus_phage(75.0%)	32	925974:926001	942144:942171
AZA21584.1|923531_924560_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.7	2.6e-46
AZA21585.1|925109_925988_-	YitT family protein	NA	NA	NA	NA	NA
925974:926001	attL	ATCTAATTGATCCATATATGTTCCTTTT	NA	NA	NA	NA
AZA21586.1|926089_927211_-|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	41.4	1.2e-71
AZA22598.1|927372_928248_-	hypothetical protein	NA	Q38183	Lactococcus_phage	36.6	1.7e-17
AZA21587.1|928293_928698_-	ImmA/IrrE family metallo-endopeptidase	NA	Q6SEA2	Lactobacillus_prophage	37.5	4.8e-20
AZA21588.1|928702_929050_-	XRE family transcriptional regulator	NA	A0A097QQ00	Enterococcus_phage	40.0	3.3e-09
AZA21589.1|929342_929552_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA21590.1|929557_930325_+	phage repressor protein/antirepressor Ant	NA	L0P8P6	Lactobacillus_phage	77.2	1.7e-106
AZA21591.1|930337_930637_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21592.1|930599_930800_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21593.1|930775_930958_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22599.1|931289_931763_+	hypothetical protein	NA	L0P7B8	Lactobacillus_phage	87.3	1.4e-58
AZA21594.1|931769_932468_+	hypothetical protein	NA	L0P8M9	Lactobacillus_phage	93.1	4.9e-113
AZA21595.1|932464_933532_+	hypothetical protein	NA	L0P6D8	Lactobacillus_phage	97.5	1.1e-193
AZA21596.1|933504_933849_+	DUF2577 domain-containing protein	NA	L0P6Y6	Lactobacillus_phage	100.0	9.0e-60
AZA22600.1|933874_934288_+	DUF2634 domain-containing protein	NA	L0P6H1	Lactobacillus_phage	98.5	1.3e-68
AZA21597.1|934277_935423_+	hypothetical protein	NA	L0P7C2	Lactobacillus_phage	93.2	4.9e-203
AZA21598.1|935415_935787_+	DUF2313 domain-containing protein	NA	L0P8N4	Lactobacillus_phage	55.8	1.1e-29
AZA21599.1|935847_936090_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21600.1|936086_937505_+	hypothetical protein	NA	Q20DB8	Lactobacillus_phage	26.3	2.8e-06
AZA21601.1|937525_938398_+	hypothetical protein	NA	F8J1C9	Lactobacillus_phage	34.6	3.5e-23
AZA21602.1|938804_939353_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21603.1|939352_939535_+	XkdX family protein	NA	NA	NA	NA	NA
AZA21604.1|939494_939908_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21605.1|939927_940137_+	hypothetical protein	NA	L0P8N8	Lactobacillus_phage	89.9	7.2e-20
AZA21606.1|940120_940348_+	hypothetical protein	NA	L0P6E4	Lactobacillus_phage	100.0	2.7e-36
AZA22601.1|940356_940743_+	hypothetical protein	NA	L0P6Z4	Lactobacillus_phage	95.3	4.7e-57
AZA21607.1|940809_941931_+	lysin	NA	L0P6H6	Lactobacillus_phage	88.2	4.9e-187
AZA22602.1|942365_942821_-	M23 family peptidase	NA	NA	NA	NA	NA
942144:942171	attR	ATCTAATTGATCCATATATGTTCCTTTT	NA	NA	NA	NA
AZA21608.1|943191_944031_-	pyruvate, phosphate dikinase regulatory protein	NA	NA	NA	NA	NA
AZA21609.1|944287_944464_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AZA21610.1|944574_945018_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	32.9	2.0e-11
>prophage 12
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	982273	1034338	2210811	tRNA,transposase	Bacillus_phage(14.29%)	42	NA	NA
AZA21638.1|982273_983572_+|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	27.8	1.8e-47
AZA21639.1|983657_984302_+	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	36.0	4.2e-10
AZA21640.1|984303_984924_+	endonuclease III	NA	NA	NA	NA	NA
AZA21641.1|985135_987415_-	penicillin-binding protein	NA	NA	NA	NA	NA
AZA21642.1|987411_988044_-	Holliday junction resolvase RecU	NA	A0A1B1P798	Bacillus_phage	31.2	1.6e-17
AZA21643.1|988107_988677_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
AZA21644.1|988767_989184_+	DivIVA domain-containing protein	NA	NA	NA	NA	NA
AZA21645.1|989645_990770_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
AZA21646.1|992071_992356_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21647.1|992352_994029_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
AZA21648.1|994035_994500_+	signal peptidase II	NA	NA	NA	NA	NA
AZA21649.1|994492_995404_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.2	7.8e-10
AZA21650.1|995406_996462_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
AZA21651.1|996465_999657_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AZA21652.1|999724_1001419_-	fibronectin/fibrinogen-binding protein	NA	Q84500	Paramecium_bursaria_Chlorella_virus	40.0	3.2e-09
AZA21653.1|1002545_1003724_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21654.1|1003805_1004222_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZA21655.1|1004296_1005178_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.9	4.4e-10
AZA21656.1|1006841_1008179_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA22604.1|1008153_1008384_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA21657.1|1008423_1008771_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA21658.1|1009008_1010079_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
AZA21659.1|1010593_1011049_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21660.1|1011055_1011547_+	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	35.5	4.2e-18
AZA21661.1|1011592_1012210_-	DUF5052 family protein	NA	A0A2K9VCV0	Lactobacillus_phage	44.2	6.4e-40
AZA21662.1|1012407_1012779_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21663.1|1012828_1013032_-	gametolysin	NA	NA	NA	NA	NA
AZA21664.1|1014138_1015317_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21665.1|1017402_1018581_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21666.1|1018825_1019179_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA21667.1|1019209_1019794_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	44.6	8.2e-29
AZA21668.1|1019878_1020814_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
AZA21669.1|1020846_1021809_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA21670.1|1021959_1024416_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.3	3.0e-96
AZA21671.1|1024432_1026379_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.0	2.7e-116
AZA21672.1|1026475_1027093_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AZA21673.1|1028742_1029210_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
AZA21674.1|1029298_1029817_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	38.4	5.1e-22
AZA21675.1|1030030_1030891_+	Sir2 silent information regulator family NAD-dependent deacetylase	NA	NA	NA	NA	NA
AZA21676.1|1031656_1032247_+	Sir2 silent information regulator family NAD-dependent deacetylase	NA	NA	NA	NA	NA
AZA21677.1|1032266_1032749_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZA21678.1|1033288_1034338_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	2.1e-51
>prophage 13
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	1039578	1342317	2210811	integrase,tRNA,transposase,protease	Leptospira_phage(11.29%)	232	1033316:1033330	1143046:1144514
1033316:1033330	attL	TTCTCTTTCAAAGAT	NA	NA	NA	NA
AZA21683.1|1039578_1040199_-|integrase	site-specific integrase	integrase	E2ELN7	Clostridium_phage	36.4	7.4e-20
1033316:1033330	attL	TTCTCTTTCAAAGAT	NA	NA	NA	NA
AZA21684.1|1040314_1040953_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21684.1|1040314_1040953_-	hypothetical protein	NA	NA	NA	NA	NA
1040768:1040782	attR	TTCTCTTTCAAAGAT	NA	NA	NA	NA
AZA21685.1|1041674_1043012_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
1040768:1040782	attR	TTCTCTTTCAAAGAT	NA	NA	NA	NA
AZA22605.1|1042986_1043217_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA21686.1|1043256_1043604_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA21687.1|1044148_1045180_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	39.2	1.8e-34
AZA21688.1|1045998_1046859_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA22606.1|1046870_1047611_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	4.1e-33
AZA21689.1|1047620_1048295_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZA21690.1|1048275_1048935_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZA22607.1|1051198_1051411_+	DUF2255 family protein	NA	NA	NA	NA	NA
AZA21691.1|1052481_1053018_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AZA21692.1|1053029_1054121_-	dihydropteroate synthase	NA	NA	NA	NA	NA
AZA22608.1|1054110_1055448_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AZA21693.1|1055431_1056505_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	42.3	8.0e-38
AZA21694.1|1056501_1056852_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AZA21695.1|1057290_1057944_+	endonuclease III	NA	NA	NA	NA	NA
AZA22609.1|1058345_1059611_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA21696.1|1059932_1060370_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
AZA21697.1|1060371_1060785_+	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
AZA21698.1|1060874_1061318_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZA21699.1|1062793_1063006_+	transcriptional regulator	NA	NA	NA	NA	NA
AZA21700.1|1063182_1064463_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.5	1.3e-10
AZA21701.1|1064514_1067253_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AZA22610.1|1067365_1068379_-	serine hydrolase	NA	NA	NA	NA	NA
AZA21702.1|1068582_1069986_+	dipeptidase PepV	NA	NA	NA	NA	NA
AZA21703.1|1071343_1072723_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AZA21704.1|1073105_1073441_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21705.1|1074473_1074713_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21706.1|1074901_1076188_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	55.6	2.3e-116
AZA21707.1|1076247_1076889_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AZA21708.1|1076933_1077164_-	replication-associated protein RepA	NA	NA	NA	NA	NA
AZA21709.1|1077320_1077854_-	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AZA22611.1|1077988_1079167_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21710.1|1079716_1080760_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	53.7	3.7e-96
AZA21711.1|1080858_1082037_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22612.1|1082409_1083684_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
AZA21712.1|1085699_1087037_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA22613.1|1087011_1087242_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA21713.1|1087281_1087629_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA21714.1|1088653_1089841_-	amidohydrolase	NA	NA	NA	NA	NA
AZA21715.1|1089872_1091204_-	amino acid permease	NA	NA	NA	NA	NA
AZA21716.1|1091493_1091859_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
AZA21717.1|1095533_1096391_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA21718.1|1096442_1098128_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21719.1|1099513_1099864_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22614.1|1100405_1100618_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21720.1|1100623_1101910_-	peptidase T	NA	NA	NA	NA	NA
AZA22615.1|1103874_1105053_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21721.1|1106176_1107355_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21722.1|1107491_1108049_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21723.1|1108055_1108937_-	pyridoxamine kinase	NA	NA	NA	NA	NA
AZA21724.1|1108943_1110041_-	class C beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AZA21725.1|1110165_1110780_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
AZA21726.1|1110923_1112102_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21727.1|1112259_1112892_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AZA22616.1|1113671_1114850_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21728.1|1115894_1116944_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA21729.1|1117113_1118886_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.8	7.7e-78
AZA21730.1|1120681_1121797_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA21731.1|1122174_1123512_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA22617.1|1123486_1123717_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA21732.1|1123756_1124104_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA21733.1|1124450_1125710_-	aluminum resistance protein	NA	NA	NA	NA	NA
AZA21734.1|1125726_1127823_-	putative ornithine decarboxylase	NA	NA	NA	NA	NA
AZA22618.1|1128953_1130219_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA21735.1|1130590_1131406_+|integrase	integrase	integrase	NA	NA	NA	NA
AZA21736.1|1132473_1133373_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
AZA21737.1|1133735_1134083_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA22619.1|1134122_1134353_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA21738.1|1134327_1135665_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	5.6e-49
AZA21739.1|1135795_1137199_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	24.9	7.5e-28
AZA21740.1|1137209_1137734_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AZA21741.1|1137742_1138651_-	tyrosine recombinase	NA	A0A1P8DJJ6	Virus_Rctr41k	25.1	2.3e-14
AZA21742.1|1138650_1139967_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
AZA21743.1|1139988_1142103_-	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.9	1.3e-100
AZA22620.1|1143073_1144339_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA21744.1|1144552_1145305_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	38.7	2.6e-27
AZA21745.1|1145294_1146146_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
AZA21746.1|1146169_1147762_-	sodium:proton antiporter	NA	NA	NA	NA	NA
AZA21747.1|1147809_1148040_-	YozE family protein	NA	NA	NA	NA	NA
AZA22621.1|1148042_1148885_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	45.9	5.3e-21
AZA21748.1|1149001_1149694_+	hemolysin III family protein	NA	NA	NA	NA	NA
AZA21749.1|1149731_1150931_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.1	8.6e-49
AZA21750.1|1151023_1151911_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	37.6	3.4e-50
AZA21751.1|1151951_1153199_-	peptide-binding protein	NA	NA	NA	NA	NA
AZA21752.1|1153282_1153558_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	65.2	1.7e-24
AZA21753.1|1153733_1155041_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AZA21754.1|1155108_1156320_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AZA21755.1|1156391_1157066_-	(d)CMP kinase	NA	NA	NA	NA	NA
AZA21756.1|1157118_1157586_-	LysM domain-containing protein	NA	NA	NA	NA	NA
AZA21757.1|1157691_1158381_-	ECF transporter S component	NA	NA	NA	NA	NA
AZA21758.1|1158603_1159320_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AZA21759.1|1159320_1159914_-	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
AZA21760.1|1159903_1160644_-	segregation and condensation protein A	NA	NA	NA	NA	NA
AZA21761.1|1160636_1160993_-	reductase	NA	NA	NA	NA	NA
AZA21762.1|1161003_1161909_-	site-specific tyrosine recombinase XerD	NA	S5W9T9	Leptospira_phage	26.9	9.8e-21
AZA21763.1|1161895_1162789_-	RNA-binding protein	NA	NA	NA	NA	NA
AZA21764.1|1162915_1164685_-	pyruvate kinase	NA	NA	NA	NA	NA
AZA21765.1|1164718_1165681_-	6-phosphofructokinase	NA	H8ZJH0	Ostreococcus_tauri_virus	28.6	2.1e-05
AZA21766.1|1165848_1168956_-	DNA polymerase III subunit alpha	NA	A0A0K1Y9G6	Streptomyces_phage	32.5	1.2e-134
AZA21767.1|1169072_1169291_+	DUF2929 family protein	NA	NA	NA	NA	NA
AZA21768.1|1169350_1170913_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AZA21769.1|1170971_1171160_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
AZA21770.1|1171261_1171513_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
AZA21771.1|1171519_1172314_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.0	9.2e-07
AZA21772.1|1172310_1173249_-	ribonuclease Z	NA	NA	NA	NA	NA
AZA21773.1|1173267_1175202_-	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	29.7	1.1e-26
AZA21774.1|1175210_1176515_-	GTPase ObgE	NA	NA	NA	NA	NA
AZA21775.1|1176594_1178397_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
AZA21776.1|1180844_1182230_+	amino acid permease	NA	NA	NA	NA	NA
AZA21777.1|1184178_1185015_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	35.9	2.0e-36
AZA21778.1|1185186_1186380_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.4	3.3e-40
AZA21779.1|1186665_1187844_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21780.1|1189672_1190857_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AZA21781.1|1190945_1192799_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.4	2.2e-11
AZA21782.1|1192804_1194091_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.9	2.8e-21
AZA21783.1|1194381_1194819_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AZA21784.1|1194818_1197068_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.8	1.0e-10
AZA21785.1|1197238_1198288_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA21786.1|1198284_1198731_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21787.1|1198699_1199647_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AZA21788.1|1199707_1200217_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AZA21789.1|1200439_1201297_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA21790.1|1202881_1203388_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AZA21791.1|1203490_1204837_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
AZA21792.1|1205006_1205960_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZA21793.1|1205961_1206294_+	transporter	NA	A0A0P0I7G8	Lactobacillus_phage	43.6	8.3e-18
AZA21794.1|1206549_1206930_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AZA21795.1|1207003_1207609_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA21796.1|1207621_1209331_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.6	6.0e-19
AZA21797.1|1209323_1210157_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AZA21798.1|1210856_1212203_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.1	2.5e-52
AZA21799.1|1212501_1213680_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA21800.1|1213701_1214520_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21801.1|1216127_1217669_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
AZA21802.1|1217658_1218573_-	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
AZA21803.1|1218573_1218867_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
AZA21804.1|1218856_1219909_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
AZA21805.1|1219999_1220791_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZA21806.1|1220869_1222336_-	anion permease	NA	NA	NA	NA	NA
AZA21807.1|1222493_1223351_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA21808.1|1223512_1224850_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA22622.1|1224824_1225055_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA21809.1|1225094_1225442_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA21810.1|1225727_1226906_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA21811.1|1229191_1229476_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21812.1|1229480_1229720_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21813.1|1229880_1231836_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
AZA21814.1|1232287_1233214_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AZA21815.1|1233414_1234593_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA22623.1|1234755_1236264_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AZA21816.1|1237286_1237502_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21817.1|1237517_1238201_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21818.1|1238479_1239664_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	55.6	7.8e-111
AZA21819.1|1239730_1240075_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21820.1|1240081_1240582_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21821.1|1241641_1242820_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21822.1|1242940_1243204_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21823.1|1243272_1244352_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
AZA21824.1|1244386_1244554_-	mucus-binding protein	NA	NA	NA	NA	NA
AZA21825.1|1244601_1244904_-	mucus-binding protein	NA	NA	NA	NA	NA
AZA21826.1|1244890_1245577_-	mucus-binding protein	NA	NA	NA	NA	NA
AZA21827.1|1245701_1245893_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21828.1|1246187_1247564_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	32.3	5.8e-57
AZA21829.1|1247575_1248979_-	class II fumarate hydratase	NA	NA	NA	NA	NA
AZA21830.1|1249166_1249391_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21831.1|1250854_1251556_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA21832.1|1251548_1252610_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	1.4e-29
AZA21833.1|1252622_1253483_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA21834.1|1256290_1257148_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA21835.1|1257324_1257507_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZA21836.1|1257519_1257723_-	hypothetical protein	NA	Q9AZG0	Lactococcus_phage	50.0	2.5e-09
AZA21837.1|1257842_1258361_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	40.1	7.6e-26
AZA21838.1|1258375_1259332_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.5	2.7e-114
AZA21839.1|1260357_1261215_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA21840.1|1262638_1263496_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA21841.1|1263768_1265496_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	3.6e-88
AZA21842.1|1266719_1268006_+	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	51.7	2.3e-108
AZA21843.1|1268081_1268684_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
AZA21844.1|1268835_1269324_-	nitroreductase	NA	NA	NA	NA	NA
AZA21845.1|1270485_1271862_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
AZA21846.1|1271861_1272800_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AZA21847.1|1272959_1274201_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	56.8	7.4e-120
AZA21848.1|1274946_1275669_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZA21849.1|1276693_1277398_-	ADP-ribose pyrophosphatase	NA	G3MA14	Bacillus_virus	25.5	1.6e-07
AZA21850.1|1277664_1278843_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA21851.1|1280552_1281107_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.8	4.7e-34
AZA21852.1|1283248_1283884_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZA21853.1|1285456_1287163_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	4.6e-88
AZA21854.1|1287331_1288252_-	aldo/keto reductase	NA	NA	NA	NA	NA
AZA21855.1|1288390_1289320_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA21856.1|1289480_1290659_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21857.1|1290742_1291276_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21858.1|1291754_1292933_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21859.1|1294654_1295833_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21860.1|1296292_1296868_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AZA21861.1|1298986_1300267_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA21862.1|1300499_1300847_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA22624.1|1300886_1301117_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA21863.1|1301091_1302429_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA21864.1|1302728_1303787_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZA21865.1|1303798_1304965_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AZA21866.1|1304985_1305765_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AZA21867.1|1305757_1306645_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AZA21868.1|1306699_1307749_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA21869.1|1308943_1309948_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
AZA21870.1|1311621_1312212_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AZA21871.1|1312201_1313476_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.6	2.3e-132
AZA21872.1|1313605_1314937_-	trigger factor	NA	NA	NA	NA	NA
AZA21873.1|1315081_1316272_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	27.3	5.2e-30
AZA21874.1|1316571_1317621_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA21875.1|1317639_1318494_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AZA21876.1|1318496_1320269_-	RNase J family beta-CASP ribonuclease	NA	NA	NA	NA	NA
AZA22625.1|1320425_1320695_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
AZA21877.1|1320893_1321151_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AZA21878.1|1321211_1322198_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AZA21879.1|1325830_1326532_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
AZA21880.1|1326717_1327767_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	2.1e-51
AZA21881.1|1327808_1328843_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
AZA21882.1|1328826_1329321_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	36.2	9.7e-23
AZA21883.1|1329323_1329872_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AZA21884.1|1329868_1330213_-	DUF2129 domain-containing protein	NA	NA	NA	NA	NA
AZA21885.1|1330209_1331391_-	cell division protein FtsW	NA	NA	NA	NA	NA
AZA21886.1|1331486_1333331_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	41.5	3.6e-22
AZA21887.1|1333582_1334137_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.7	3.6e-10
AZA21888.1|1334491_1334713_+	DUF1447 family protein	NA	NA	NA	NA	NA
AZA21889.1|1334719_1336399_+	ribonuclease J	NA	NA	NA	NA	NA
AZA21890.1|1337442_1339794_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	26.9	6.2e-59
AZA21891.1|1339793_1340438_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AZA21892.1|1340437_1341097_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AZA21893.1|1341189_1342317_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 14
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	1345687	1410277	2210811	tRNA,transposase	Bacillus_phage(22.22%)	55	NA	NA
AZA21900.1|1345687_1348471_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.9	1.5e-88
AZA21901.1|1348692_1349490_-	DivIVA domain-containing protein	NA	NA	NA	NA	NA
AZA21902.1|1349465_1350266_-	RNA-binding protein	NA	NA	NA	NA	NA
AZA21903.1|1350265_1350502_-	YggT family protein	NA	NA	NA	NA	NA
AZA21904.1|1351427_1351865_-	cell division protein SepF	NA	NA	NA	NA	NA
AZA21905.1|1351882_1353202_-	cell division protein FtsZ	NA	NA	NA	NA	NA
AZA21906.1|1353216_1354575_-	cell division protein FtsA	NA	NA	NA	NA	NA
AZA21907.1|1354637_1355495_-	cell division protein FtsQ	NA	NA	NA	NA	NA
AZA21908.1|1355511_1356618_-	undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AZA21909.1|1356619_1357999_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AZA21910.1|1358011_1358977_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AZA21911.1|1361131_1361494_-	cell division protein FtsL	NA	NA	NA	NA	NA
AZA22626.1|1361507_1362455_-	ribosomal RNA small subunit methyltransferase H	NA	NA	NA	NA	NA
AZA21912.1|1362459_1362891_-	transcriptional regulator MraZ	NA	NA	NA	NA	NA
AZA21913.1|1362996_1364385_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	6.9e-58
AZA21914.1|1364407_1365535_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA21915.1|1365916_1366252_-	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
AZA21916.1|1366346_1366481_+	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
AZA21917.1|1366520_1367060_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AZA21918.1|1367059_1367911_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AZA21919.1|1367956_1368961_-	rod shape-determining protein	NA	NA	NA	NA	NA
AZA21920.1|1369056_1369680_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AZA21921.1|1369718_1370396_-	HAD family phosphatase	NA	NA	NA	NA	NA
AZA21922.1|1370385_1371660_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AZA21923.1|1371660_1374300_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	43.4	4.8e-161
AZA22627.1|1374722_1375901_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21924.1|1376394_1377654_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.9	7.3e-123
AZA21925.1|1379989_1381252_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	38.5	1.3e-58
AZA21926.1|1381366_1382545_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21927.1|1383793_1384210_-	GtrA family protein	NA	NA	NA	NA	NA
AZA21928.1|1384819_1385242_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA21929.1|1385256_1385967_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AZA21930.1|1387511_1387685_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21931.1|1387999_1388254_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21932.1|1388620_1389670_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	2.1e-51
AZA21933.1|1390040_1390898_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA21934.1|1390974_1391412_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA22628.1|1392006_1393185_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA21935.1|1394049_1394397_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA22629.1|1394436_1394667_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA21936.1|1394641_1395979_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA21937.1|1396580_1397162_-	DUF3232 domain-containing protein	NA	NA	NA	NA	NA
AZA21938.1|1397349_1397739_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21939.1|1398576_1399434_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA22630.1|1399748_1400441_-	pseudouridine synthase	NA	NA	NA	NA	NA
AZA21940.1|1400501_1400756_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21941.1|1400731_1400977_+	DUF3232 domain-containing protein	NA	NA	NA	NA	NA
AZA21942.1|1401465_1402683_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
AZA21943.1|1402682_1403843_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	32.4	5.1e-38
AZA21944.1|1403934_1405644_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
AZA21945.1|1405926_1406538_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
AZA21946.1|1406627_1407095_+	DUF1694 domain-containing protein	NA	NA	NA	NA	NA
AZA21947.1|1407094_1408408_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	49.3	4.8e-101
AZA21948.1|1408707_1408989_+	hypothetical protein	NA	NA	NA	NA	NA
AZA21949.1|1409098_1410277_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
>prophage 15
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	1427968	1626155	2210811	tRNA,bacteriocin,transposase,protease	Streptococcus_phage(25.64%)	155	NA	NA
AZA21971.1|1427968_1428826_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA22631.1|1428894_1430160_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA21972.1|1431812_1433153_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AZA21973.1|1433228_1433843_-	VanZ family protein	NA	NA	NA	NA	NA
AZA21974.1|1433966_1436138_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	43.2	1.6e-149
AZA21975.1|1436316_1436598_+	hypothetical protein	NA	Q5ULQ4	Lactobacillus_virus	61.4	4.1e-18
AZA21976.1|1437631_1439089_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	33.8	3.6e-33
AZA21977.1|1439088_1439811_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	1.6e-37
AZA21978.1|1439813_1440203_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21979.1|1440237_1441203_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
AZA21980.1|1443845_1445030_-	acetate kinase	NA	NA	NA	NA	NA
AZA21981.1|1445076_1446078_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZA21982.1|1446247_1446748_-	competence protein ComGF	NA	NA	NA	NA	NA
AZA21983.1|1446755_1446992_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21984.1|1447881_1448313_-	prepilin-type cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AZA21985.1|1448530_1449709_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA22632.1|1450020_1451022_-	type II secretion system protein F	NA	NA	NA	NA	NA
AZA21986.1|1450990_1451965_-	AAA family ATPase	NA	NA	NA	NA	NA
AZA21987.1|1452112_1452841_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZA21988.1|1452931_1453447_-	VanZ family protein	NA	NA	NA	NA	NA
AZA21989.1|1453541_1453727_-	type Z 30S ribosomal protein S14	NA	NA	NA	NA	NA
AZA21990.1|1459419_1461441_-	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
AZA21991.1|1462619_1463774_+	glycerate kinase	NA	NA	NA	NA	NA
AZA21992.1|1463778_1464246_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AZA21993.1|1464249_1464963_-	hypothetical protein	NA	NA	NA	NA	NA
AZA21994.1|1464979_1465795_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AZA21995.1|1465804_1466620_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AZA21996.1|1466714_1468067_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AZA21997.1|1469053_1469896_-	TIGR00159 family protein	NA	NA	NA	NA	NA
AZA21998.1|1469953_1471027_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZA21999.1|1471023_1471839_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA22000.1|1471835_1472648_-	ABC transporter permease	NA	NA	NA	NA	NA
AZA22633.1|1472637_1473735_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	40.7	1.6e-33
AZA22001.1|1473800_1474697_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
AZA22002.1|1474794_1475328_+	exonuclease	NA	M1PFD8	Streptococcus_phage	35.9	1.8e-22
AZA22003.1|1475334_1475835_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AZA22004.1|1475834_1476824_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AZA22005.1|1476835_1477534_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	42.6	7.8e-42
AZA22006.1|1477602_1478496_+	HAD family phosphatase	NA	NA	NA	NA	NA
AZA22007.1|1478529_1479708_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22008.1|1479868_1480390_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22009.1|1480720_1481479_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
AZA22010.1|1481504_1482716_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AZA22011.1|1482828_1483845_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZA22012.1|1483900_1484932_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22013.1|1486396_1487440_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA22014.1|1490926_1491742_+	HAD family hydrolase	NA	NA	NA	NA	NA
AZA22015.1|1491796_1493422_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22016.1|1493478_1494336_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA22017.1|1494581_1495166_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	54.4	6.3e-53
AZA22018.1|1495250_1496633_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AZA22019.1|1496672_1497608_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	35.2	1.4e-46
AZA22020.1|1497600_1498644_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	50.2	2.4e-87
AZA22021.1|1498654_1499530_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-08
AZA22022.1|1501824_1504665_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.9	5.0e-305
AZA22023.1|1504654_1506703_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
AZA22024.1|1506805_1508530_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	46.0	3.4e-147
AZA22634.1|1508630_1509062_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
AZA22025.1|1509517_1509865_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA22635.1|1509904_1510135_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA22026.1|1511446_1512466_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZA22027.1|1512507_1513350_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AZA22028.1|1513339_1514308_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
AZA22029.1|1514347_1514602_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22030.1|1514609_1515726_-	peptide chain release factor 2	NA	NA	NA	NA	NA
AZA22031.1|1515808_1518208_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AZA22032.1|1518347_1518893_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AZA22033.1|1518970_1519666_-	ComF family protein	NA	NA	NA	NA	NA
AZA22034.1|1519662_1520949_-	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	44.0	2.0e-83
AZA22035.1|1520993_1521656_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.8	5.8e-39
AZA22036.1|1521683_1522841_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
AZA22037.1|1522947_1524579_-	ribonuclease Y	NA	NA	NA	NA	NA
AZA22038.1|1524696_1525794_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.5	1.6e-118
AZA22039.1|1525978_1526539_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AZA22040.1|1526561_1527686_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZA22041.1|1527753_1528482_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZA22042.1|1528482_1529739_-	insulinase family protein	NA	A0A2P1EIE5	Megavirus	28.1	1.0e-12
AZA22043.1|1529735_1530968_-	insulinase family protein	NA	NA	NA	NA	NA
AZA22044.1|1530936_1533354_-	DNA translocase FtsK	NA	Q853W3	Mycobacterium_phage	48.0	1.7e-83
AZA22045.1|1533374_1533764_-	DUF1149 family protein	NA	NA	NA	NA	NA
AZA22046.1|1533763_1534324_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AZA22047.1|1534374_1535574_-	AI-2E family transporter	NA	NA	NA	NA	NA
AZA22048.1|1536041_1538798_-	cation-transporting P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.3	1.2e-74
AZA22049.1|1538950_1539979_+	lactonase family protein	NA	NA	NA	NA	NA
AZA22050.1|1540085_1540778_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
AZA22051.1|1540812_1542612_-	oleate hydratase	NA	NA	NA	NA	NA
AZA22052.1|1542827_1543175_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA22636.1|1543214_1543445_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA22053.1|1544993_1546043_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA22054.1|1546174_1547071_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.1	2.3e-06
AZA22055.1|1547054_1547867_-	NAD kinase	NA	NA	NA	NA	NA
AZA22056.1|1547863_1548496_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
AZA22057.1|1548619_1549234_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
AZA22058.1|1549312_1549930_+	DsbA family protein	NA	NA	NA	NA	NA
AZA22059.1|1550290_1551469_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22060.1|1552262_1553003_-	adaptor protein MecA	NA	NA	NA	NA	NA
AZA22061.1|1553094_1553493_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
AZA22062.1|1553724_1555458_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AZA22063.1|1555457_1555724_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AZA22064.1|1557253_1557571_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22065.1|1557805_1559995_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	40.6	2.3e-124
AZA22066.1|1560146_1560428_+	DUF1827 family protein	NA	NA	NA	NA	NA
AZA22067.1|1560495_1562067_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	26.2	5.5e-35
AZA22068.1|1563045_1563507_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22069.1|1563508_1563991_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22070.1|1564001_1564817_-	recombination regulator RecX	NA	NA	NA	NA	NA
AZA22071.1|1564938_1566321_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.2	3.9e-69
AZA22072.1|1566888_1567938_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA22073.1|1568523_1569702_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA22074.1|1570592_1571771_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA22075.1|1572083_1572353_-|transposase	transposase	transposase	NA	NA	NA	NA
AZA22076.1|1572706_1573795_+|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	38.8	7.6e-52
AZA22077.1|1574032_1574380_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA22637.1|1574419_1574650_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA22078.1|1574624_1575962_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA22638.1|1576953_1577238_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22079.1|1577276_1578440_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
AZA22080.1|1578439_1579651_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
AZA22081.1|1579650_1580811_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
AZA22082.1|1582436_1583336_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	48.1	6.4e-73
AZA22083.1|1583397_1584321_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
AZA22084.1|1584329_1585157_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AZA22639.1|1585343_1586522_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22085.1|1586676_1587123_+	flavodoxin	NA	NA	NA	NA	NA
AZA22086.1|1587115_1587655_+	GtrA family protein	NA	NA	NA	NA	NA
AZA22087.1|1587678_1588821_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.3	1.2e-28
AZA22088.1|1588928_1589117_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22089.1|1589284_1590613_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AZA22090.1|1590609_1591842_-	ATP-dependent helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	28.5	3.6e-34
AZA22091.1|1591841_1592546_-	lysozyme	NA	NA	NA	NA	NA
AZA22092.1|1593925_1594495_-	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	27.6	3.7e-10
AZA22093.1|1594603_1595965_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AZA22094.1|1596780_1597053_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22095.1|1598720_1599950_+|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.4	1.8e-65
AZA22096.1|1600102_1601281_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA22097.1|1601594_1602443_-	patatin family protein	NA	NA	NA	NA	NA
AZA22098.1|1602510_1604910_-	phosphoketolase family protein	NA	NA	NA	NA	NA
AZA22099.1|1605198_1605954_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AZA22100.1|1605959_1606325_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZA22101.1|1606411_1606735_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
AZA22102.1|1606734_1608138_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AZA22103.1|1608130_1608592_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
AZA22104.1|1608578_1609817_-	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.8	8.0e-98
AZA22105.1|1609791_1611069_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AZA22106.1|1611080_1611875_-	Fe-S cluster assembly ATPase SufC	NA	A0A1M7XV31	Cedratvirus	27.6	7.3e-12
AZA22107.1|1612996_1613815_+	HAD family hydrolase	NA	NA	NA	NA	NA
AZA22108.1|1613879_1614203_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22109.1|1614322_1615582_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.2	1.3e-124
AZA22110.1|1616600_1617527_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AZA22111.1|1617644_1619660_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	34.6	5.0e-65
AZA22112.1|1619720_1620413_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
AZA22113.1|1620412_1621339_-	ribokinase	NA	A0A2H4N7X4	Lake_Baikal_phage	37.5	6.3e-07
AZA22114.1|1621422_1622226_-	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
AZA22640.1|1622360_1623539_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22115.1|1625297_1626155_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 16
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	1649323	1783737	2210811	holin,tRNA,transposase	Bacillus_virus(13.89%)	107	NA	NA
AZA22134.1|1649323_1650181_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA22135.1|1650525_1651056_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
AZA22136.1|1651068_1652397_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.1	2.6e-62
AZA22137.1|1653318_1654578_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.4	5.0e-124
AZA22138.1|1656193_1657519_-|transposase	transposase	transposase	G3MB42	Bacillus_virus	36.0	4.7e-56
AZA22139.1|1658258_1658759_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZA22140.1|1659137_1659227_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22141.1|1661298_1661745_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22142.1|1662103_1662307_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.9	1.6e-19
AZA22143.1|1662480_1663416_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.7e-29
AZA22144.1|1663875_1665228_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	48.2	1.9e-116
AZA22145.1|1665593_1666970_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
AZA22146.1|1667006_1667348_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22147.1|1667530_1668235_+	BAX inhibitor (BI)-1/YccA family protein	NA	NA	NA	NA	NA
AZA22641.1|1668427_1669606_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22148.1|1669688_1670348_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
AZA22149.1|1670414_1671335_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	25.8	2.7e-18
AZA22150.1|1671359_1672790_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
AZA22151.1|1672794_1674234_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
AZA22152.1|1674233_1674542_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
AZA22153.1|1674555_1675704_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
AZA22154.1|1675716_1677723_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	35.9	2.7e-103
AZA22155.1|1677763_1680010_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.5	9.0e-132
AZA22156.1|1680095_1680743_-	N-acetylmuramidase	NA	S5M633	Brevibacillus_phage	47.7	1.0e-27
AZA22157.1|1680979_1681450_-	SprT family protein	NA	NA	NA	NA	NA
AZA22158.1|1681437_1682136_-	glycosyl transferase	NA	L7RBS6	Acanthamoeba_polyphaga_moumouvirus	26.5	4.3e-08
AZA22159.1|1682138_1683569_-	flippase	NA	NA	NA	NA	NA
AZA22160.1|1683573_1684728_-	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
AZA22161.1|1687604_1688846_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.4	5.3e-118
AZA22162.1|1689042_1689873_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	51.1	1.3e-67
AZA22163.1|1689869_1691348_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.6	1.3e-115
AZA22164.1|1691435_1692536_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
AZA22165.1|1692543_1693272_-	glycosyltransferase	NA	NA	NA	NA	NA
AZA22166.1|1693452_1694712_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.4	8.9e-121
AZA22167.1|1694822_1695209_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A0F7LBI5	uncultured_marine_virus	47.2	7.1e-13
AZA22642.1|1695409_1696675_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA22168.1|1696742_1697444_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZA22169.1|1697532_1698648_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22170.1|1703378_1704236_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA22171.1|1704477_1705173_-	glycerophosphodiester phosphodiesterase	NA	M1ICP4	Paramecium_bursaria_Chlorella_virus	25.8	1.4e-14
AZA22172.1|1705223_1706441_-	phosphoglycerate mutase	NA	A0A1X9IGJ2	Lactococcus_phage	37.3	1.8e-14
AZA22173.1|1706441_1707020_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	37.1	1.1e-22
AZA22174.1|1707089_1708148_-	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
AZA22175.1|1708285_1708981_-	hypothetical protein	NA	A0A249XZV3	Enterococcus_phage	50.7	4.9e-12
AZA22176.1|1709363_1709480_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22177.1|1709572_1710955_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AZA22178.1|1712124_1712517_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22179.1|1712618_1712828_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22180.1|1712926_1713325_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
AZA22181.1|1713590_1714832_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.2	1.3e-119
AZA22182.1|1715097_1716252_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AZA22183.1|1716268_1716982_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZA22184.1|1717161_1717377_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22185.1|1717855_1718905_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA22186.1|1719205_1719508_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22187.1|1719679_1721005_-|transposase	transposase	transposase	G3MB42	Bacillus_virus	36.3	2.1e-56
AZA22188.1|1721034_1721643_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
AZA22189.1|1721750_1722050_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22190.1|1722251_1723001_+	TIGR02452 family protein	NA	NA	NA	NA	NA
AZA22191.1|1723018_1723390_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22192.1|1723658_1724888_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.5	1.2e-125
AZA22193.1|1726547_1727405_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA22194.1|1727478_1727892_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AZA22195.1|1728053_1728281_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22196.1|1728367_1729099_-	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AZA22197.1|1729202_1730387_-	acetate kinase	NA	NA	NA	NA	NA
AZA22643.1|1731789_1732173_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22198.1|1732959_1733073_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AZA22199.1|1733256_1733550_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22200.1|1733623_1735435_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	37.2	4.7e-91
AZA22201.1|1735631_1738256_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
AZA22202.1|1738569_1739943_+	amino acid permease	NA	NA	NA	NA	NA
AZA22203.1|1740241_1740589_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA22644.1|1740628_1740859_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA22204.1|1740833_1742171_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA22205.1|1742990_1744169_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22206.1|1744304_1745135_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA22207.1|1745179_1745548_-	DUF956 family protein	NA	NA	NA	NA	NA
AZA22208.1|1745551_1746472_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
AZA22209.1|1746500_1747313_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AZA22210.1|1747349_1748369_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AZA22211.1|1748431_1748629_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22212.1|1749143_1750193_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	6.2e-51
AZA22645.1|1754329_1754515_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22213.1|1756646_1757954_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.1	6.2e-93
AZA22214.1|1758177_1758729_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZA22215.1|1758728_1759337_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	39.1	3.6e-35
AZA22216.1|1759466_1760264_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZA22217.1|1760260_1760368_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA22218.1|1760419_1761121_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA22219.1|1761204_1762587_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZA22220.1|1762650_1764033_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AZA22221.1|1764087_1765122_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22222.1|1768876_1769449_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZA22223.1|1769584_1770535_-	serine hydrolase	NA	NA	NA	NA	NA
AZA22224.1|1770547_1771465_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
AZA22225.1|1771603_1772905_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZA22226.1|1772956_1774252_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZA22227.1|1774235_1775060_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AZA22228.1|1775063_1775930_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZA22229.1|1775929_1777015_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	3.2e-26
AZA22230.1|1777158_1778016_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA22231.1|1778238_1779666_-	dipeptidase	NA	NA	NA	NA	NA
AZA22232.1|1779707_1780562_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
AZA22233.1|1780652_1781606_-	DNA polymerase III subunit epsilon	NA	A0A0K2SUJ2	Clostridium_phage	33.1	1.5e-11
AZA22234.1|1781614_1782436_-	Sir2 family NAD-dependent protein deacetylase	NA	NA	NA	NA	NA
AZA22646.1|1782702_1783737_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.8	5.6e-105
>prophage 17
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	1800746	1871536	2210811	protease,transposase	Bacillus_phage(15.38%)	50	NA	NA
AZA22250.1|1800746_1801433_+|protease	metalloprotease	protease	NA	NA	NA	NA
AZA22251.1|1801493_1802144_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AZA22252.1|1802294_1803473_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22253.1|1803751_1804522_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA22647.1|1804942_1805218_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22254.1|1805294_1805651_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22255.1|1805989_1806994_+	asparaginase	NA	NA	NA	NA	NA
AZA22256.1|1809241_1809913_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22257.1|1810001_1811273_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22258.1|1811417_1812167_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	2.9e-34
AZA22259.1|1812179_1813979_+	ABC transporter permease	NA	NA	NA	NA	NA
AZA22260.1|1814184_1815363_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA22261.1|1816390_1816897_+	transcriptional regulator	NA	NA	NA	NA	NA
AZA22262.1|1817119_1818001_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	49.8	2.6e-74
AZA22263.1|1818170_1819220_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA22648.1|1819612_1820791_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22264.1|1820824_1821256_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AZA22265.1|1821263_1822364_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	74.9	5.3e-162
AZA22266.1|1822372_1823371_-	glycosyltransferase	NA	NA	NA	NA	NA
AZA22267.1|1824583_1824931_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA22649.1|1824970_1825201_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA22268.1|1825175_1826513_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA22269.1|1827239_1828154_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22270.1|1828192_1829371_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA22271.1|1829549_1830326_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22272.1|1831587_1833693_-	putative ornithine decarboxylase	NA	NA	NA	NA	NA
AZA22273.1|1833917_1835369_+	APC family permease	NA	NA	NA	NA	NA
AZA22274.1|1836944_1837355_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22275.1|1837483_1838662_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22276.1|1840449_1841499_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA22277.1|1841614_1842172_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22278.1|1842182_1842413_+	ubiquitin	NA	NA	NA	NA	NA
AZA22279.1|1845075_1845987_+	PLP-dependent cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	41.7	1.7e-60
AZA22280.1|1846008_1847193_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
AZA22281.1|1847158_1847716_+	serine acetyltransferase	NA	NA	NA	NA	NA
AZA22282.1|1850444_1851827_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AZA22283.1|1851884_1852241_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22650.1|1853724_1854972_-	MFS transporter	NA	NA	NA	NA	NA
AZA22284.1|1855122_1856103_+	cytochrome C5	NA	NA	NA	NA	NA
AZA22285.1|1856166_1856526_-	aggregation promoting factor surface protein	NA	A0A0E3XCL7	Enterococcus_phage	67.1	1.5e-20
AZA22286.1|1856732_1859267_+	M1 family peptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.3	2.0e-71
AZA22287.1|1859376_1860870_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.9	2.4e-72
AZA22651.1|1861110_1862289_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22288.1|1862382_1863153_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZA22289.1|1863152_1863971_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZA22290.1|1863981_1864869_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZA22291.1|1864880_1865939_-	LytR family transcriptional regulator	NA	A0A1X9I5X1	Streptococcus_phage	30.6	1.4e-15
AZA22292.1|1868653_1869934_+	GTPase HflX	NA	NA	NA	NA	NA
AZA22293.1|1869993_1871331_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA22652.1|1871305_1871536_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	1876439	1939844	2210811	bacteriocin,transposase	Leptospira_phage(18.75%)	53	NA	NA
AZA22299.1|1876439_1877297_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA22300.1|1878097_1878379_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22301.1|1878389_1878650_-	ATPase	NA	NA	NA	NA	NA
AZA22302.1|1878742_1879294_-	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	45.2	8.6e-20
AZA22303.1|1879483_1880029_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	31.7	9.4e-11
AZA22304.1|1880123_1880423_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AZA22305.1|1880515_1882021_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22306.1|1882035_1882677_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22653.1|1884469_1885735_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
AZA22307.1|1885885_1886230_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22308.1|1886342_1886879_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22309.1|1887118_1888360_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.1	2.5e-120
AZA22310.1|1888510_1889224_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22311.1|1889427_1889913_-	threonine/serine exporter	NA	NA	NA	NA	NA
AZA22312.1|1889915_1890686_-	threonine/serine exporter	NA	NA	NA	NA	NA
AZA22313.1|1890696_1892238_-	ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	27.6	5.9e-42
AZA22314.1|1892246_1892624_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22315.1|1892789_1893314_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZA22316.1|1893912_1895172_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.9	1.7e-124
AZA22317.1|1895489_1896731_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AZA22318.1|1896892_1898689_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AZA22319.1|1899586_1899859_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZA22320.1|1901396_1902446_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	8.1e-51
AZA22321.1|1902668_1903847_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22322.1|1904091_1905057_+	glycosyltransferase	NA	NA	NA	NA	NA
AZA22323.1|1905080_1906544_+	flippase	NA	NA	NA	NA	NA
AZA22324.1|1907748_1908096_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA22654.1|1908135_1908366_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA22325.1|1908340_1909678_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA22326.1|1910027_1910375_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA22655.1|1910414_1910645_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA22327.1|1910619_1911957_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	5.6e-49
AZA22328.1|1912674_1914699_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22656.1|1914923_1916102_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22329.1|1916124_1916904_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22330.1|1916931_1918104_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AZA22331.1|1918615_1919653_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	47.1	3.4e-86
AZA22332.1|1919657_1920542_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	58.2	4.2e-93
AZA22333.1|1920563_1921172_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.4	7.2e-44
AZA22334.1|1921188_1922175_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	36.9	1.1e-28
AZA22335.1|1922256_1923114_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA22336.1|1923311_1924754_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22337.1|1924788_1925967_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA22338.1|1926165_1927215_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA22339.1|1929003_1930182_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22340.1|1930310_1931285_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AZA22341.1|1931292_1932393_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	75.4	1.4e-162
AZA22657.1|1932485_1933664_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA22342.1|1935052_1935400_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA22658.1|1935439_1935670_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA22343.1|1935644_1936982_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	5.6e-49
AZA22344.1|1937471_1938236_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
AZA22345.1|1938665_1939844_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
>prophage 19
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	1946397	2006336	2210811	bacteriocin,transposase	Bacillus_phage(25.0%)	54	NA	NA
AZA22659.1|1946397_1947576_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22352.1|1948557_1949811_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.5	7.2e-123
AZA22353.1|1949725_1950265_+	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
AZA22354.1|1950296_1950941_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22355.1|1950999_1951761_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
AZA22356.1|1951757_1952513_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AZA22357.1|1952656_1953256_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AZA22358.1|1953366_1953894_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZA22359.1|1955397_1956255_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA22360.1|1956790_1957465_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.7e-33
AZA22660.1|1959863_1961042_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22361.1|1961260_1961503_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22362.1|1961629_1962253_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZA22363.1|1962462_1963869_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AZA22364.1|1964024_1965323_+	MFS transporter	NA	NA	NA	NA	NA
AZA22365.1|1965794_1966334_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AZA22366.1|1966347_1966896_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	38.8	1.1e-27
AZA22367.1|1966988_1967780_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AZA22368.1|1967788_1968718_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AZA22369.1|1968759_1969296_-	CvpA family protein	NA	NA	NA	NA	NA
AZA22370.1|1969457_1970180_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
AZA22371.1|1970194_1971034_+	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	41.8	8.0e-17
AZA22372.1|1971049_1971829_+	ParA family protein	NA	Q8JL10	Natrialba_phage	31.5	4.3e-25
AZA22373.1|1971806_1972691_+	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	29.5	5.1e-14
AZA22374.1|1972683_1972947_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
AZA22375.1|1972996_1974097_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AZA22376.1|1974105_1974888_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
AZA22377.1|1975002_1976727_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	8.9e-39
AZA22661.1|1976736_1978596_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	6.2e-46
AZA22378.1|1978773_1979460_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.6	9.6e-37
AZA22379.1|1979463_1980612_+	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	31.7	2.0e-18
AZA22380.1|1980662_1982234_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AZA22381.1|1982242_1982992_+	amino acid racemase	NA	NA	NA	NA	NA
AZA22662.1|1984593_1984905_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZA22663.1|1985095_1986274_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22382.1|1986538_1987147_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.2e-33
AZA22383.1|1988728_1988956_+	transcriptional regulator	NA	NA	NA	NA	NA
AZA22384.1|1988945_1989167_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22664.1|1989465_1989657_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22385.1|1989927_1990236_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22386.1|1990216_1990384_+	toxin-antitoxin system protein	NA	NA	NA	NA	NA
AZA22665.1|1990737_1991493_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.8	5.0e-18
AZA22387.1|1991492_1992407_+	1-phosphofructokinase	NA	NA	NA	NA	NA
AZA22388.1|1992510_1993740_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.5	2.0e-125
AZA22389.1|1993852_1994950_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22666.1|1995153_1995426_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZA22390.1|1995688_1996606_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZA22391.1|1996637_1997285_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	7.5e-15
AZA22392.1|1997284_1998079_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AZA22393.1|1998513_1999896_+	L-cystine transporter	NA	NA	NA	NA	NA
AZA22394.1|2001157_2001511_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA22395.1|2001545_2002724_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZA22396.1|2003352_2004402_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA22667.1|2005070_2006336_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
>prophage 20
CP031016	Lactobacillus helveticus isolate NWC_2_3 chromosome, complete genome	2210811	2054995	2165231	2210811	tRNA,bacteriocin,transposase,protease	Bacillus_phage(16.0%)	85	NA	NA
AZA22429.1|2054995_2055199_-|tRNA	tRNA-modifying protein	tRNA	NA	NA	NA	NA
AZA22430.1|2055273_2056095_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZA22431.1|2056066_2056852_-	YibE/F family protein	NA	NA	NA	NA	NA
AZA22432.1|2056848_2057982_-	YibE/F family protein	NA	NA	NA	NA	NA
AZA22433.1|2058086_2058827_-	transcriptional regulator	NA	NA	NA	NA	NA
AZA22434.1|2058854_2059937_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AZA22435.1|2061363_2062101_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.7	4.5e-32
AZA22436.1|2062093_2063578_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
AZA22437.1|2063701_2064526_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22438.1|2064538_2065222_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZA22439.1|2065388_2066771_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	4.0e-58
AZA22440.1|2066827_2067814_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	34.1	1.2e-32
AZA22441.1|2068880_2069300_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22442.1|2069959_2070616_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZA22443.1|2070627_2071443_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AZA22444.1|2071604_2072549_+	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
AZA22445.1|2072595_2073354_-	ribonuclease	NA	C1KFJ1	Lactobacillus_virus	33.1	1.1e-28
AZA22446.1|2073441_2074368_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZA22447.1|2074387_2075845_+	cardiolipin synthase	NA	NA	NA	NA	NA
AZA22448.1|2075839_2076319_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22449.1|2076395_2077115_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
AZA22450.1|2077166_2077685_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	42.2	3.9e-14
AZA22451.1|2077671_2078460_+	DUF475 domain-containing protein	NA	A0A068EP98	Bacillus_phage	40.8	1.0e-37
AZA22452.1|2078496_2078859_-	DUF488 family protein	NA	NA	NA	NA	NA
AZA22453.1|2078928_2079561_+	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AZA22454.1|2079888_2081502_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
AZA22455.1|2081501_2082257_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.4e-28
AZA22456.1|2082309_2083227_-	HNH endonuclease	NA	NA	NA	NA	NA
AZA22457.1|2083227_2083875_-	HD domain-containing protein	NA	NA	NA	NA	NA
AZA22458.1|2084096_2084954_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA22459.1|2085012_2085246_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22460.1|2085220_2085547_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22461.1|2087730_2088591_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22462.1|2088695_2088836_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22463.1|2089169_2089574_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
AZA22464.1|2089751_2090858_+	cation transporter	NA	NA	NA	NA	NA
AZA22465.1|2090924_2091485_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	33.7	1.2e-13
AZA22466.1|2091499_2092396_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AZA22467.1|2092487_2092976_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	34.4	2.2e-11
AZA22468.1|2094064_2095006_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZA22469.1|2095164_2096514_+	ABC transporter ATP-binding protein	NA	A0A1V0SI78	Klosneuvirus	21.3	4.7e-11
AZA22470.1|2096517_2097171_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AZA22471.1|2097179_2098064_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AZA22672.1|2098309_2099488_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22472.1|2099733_2100963_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.9	3.6e-66
AZA22473.1|2101218_2102397_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22673.1|2104024_2104504_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AZA22474.1|2104969_2106211_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.0	2.4e-17
AZA22475.1|2106297_2107095_-	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	34.6	2.0e-30
AZA22476.1|2107110_2107935_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22477.1|2107937_2109296_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22674.1|2109276_2111133_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.6	3.0e-32
AZA22478.1|2111199_2111916_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.8	6.7e-41
AZA22479.1|2112229_2113087_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA22480.1|2113217_2113439_+	hypothetical protein	NA	NA	NA	NA	NA
AZA22675.1|2114259_2115438_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22481.1|2116872_2117196_-	helveticin	NA	NA	NA	NA	NA
AZA22676.1|2117500_2117854_+	XRE family transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	35.8	1.1e-12
AZA22482.1|2117850_2118273_+	ImmA/IrrE family metallo-endopeptidase	NA	X2CXW8	Lactobacillus_phage	36.6	1.3e-20
AZA22483.1|2118345_2119539_-	cell surface protein	NA	NA	NA	NA	NA
AZA22677.1|2120506_2121685_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22484.1|2121991_2122663_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22485.1|2122790_2123549_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZA22486.1|2125331_2126168_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
AZA22487.1|2126186_2127143_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
AZA22488.1|2128106_2128976_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZA22489.1|2129064_2129283_+	steroid-binding protein	NA	NA	NA	NA	NA
AZA22490.1|2129434_2130043_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZA22491.1|2130280_2130628_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZA22678.1|2130667_2130898_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA22492.1|2130872_2132210_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AZA22493.1|2133328_2134378_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.7e-51
AZA22679.1|2134611_2134770_-	branched-chain amino acid transporter	NA	NA	NA	NA	NA
AZA22680.1|2138168_2138354_-	hypothetical protein	NA	NA	NA	NA	NA
AZA22681.1|2140661_2141840_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
AZA22494.1|2148127_2148541_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.9	1.0e-09
AZA22495.1|2148641_2149499_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZA22496.1|2149686_2150814_+	class A beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AZA22497.1|2150853_2153685_-	DUF3427 domain-containing protein	NA	A0A0K2CZF8	Paenibacillus_phage	24.9	1.6e-29
AZA22498.1|2154703_2155531_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	63.5	3.4e-97
AZA22499.1|2156001_2156844_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
AZA22500.1|2156970_2157984_+	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	35.6	1.3e-50
AZA22501.1|2161263_2162121_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.1	5.0e-59
AZA22502.1|2163483_2163615_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AZA22503.1|2164040_2165231_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	59.7	8.4e-129
